CN106011265B - Molecular biology distinguishing method for two rice leaf roller larvae - Google Patents
Molecular biology distinguishing method for two rice leaf roller larvae Download PDFInfo
- Publication number
- CN106011265B CN106011265B CN201610505791.2A CN201610505791A CN106011265B CN 106011265 B CN106011265 B CN 106011265B CN 201610505791 A CN201610505791 A CN 201610505791A CN 106011265 B CN106011265 B CN 106011265B
- Authority
- CN
- China
- Prior art keywords
- sequence
- rice leaf
- leaf roller
- patnalis
- test sequence
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6806—Preparing nucleic acids for analysis, e.g. for polymerase chain reaction [PCR] assay
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6869—Methods for sequencing
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/166—Oligonucleotides used as internal standards, controls or normalisation probes
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Organic Chemistry (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Analytical Chemistry (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Health & Medical Sciences (AREA)
- Engineering & Computer Science (AREA)
- Biophysics (AREA)
- Immunology (AREA)
- Microbiology (AREA)
- Molecular Biology (AREA)
- Biotechnology (AREA)
- Physics & Mathematics (AREA)
- Biochemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention relates to a molecular biology distinguishing method of two rice leaf roller (Cnaphalocrocis medinalis and Marsamia patnalis) larvae in rice production, which respectively takes two rice leaf roller larva genome DNAs as templates, uses specific primers to carry out PCR amplification, carries out sequencing on amplification products, utilizes gene analysis software GENEDOC to analyze the two, obtains a pair of sequences with obvious difference, and respectively defines the sequences as a test sequence A and a test sequence B; the sequence of the amplified product of the genome DNA of the rice leaf roller larva sample to be detected is respectively compared with a known test sequence A and a test sequence B, the Cnaphalocrocis medinalis which is consistent with the test sequence A is Marsamia patnalis which is consistent with the test sequence B. The method has high stability and high sensitivity, and is especially used for high-sensitivity accurate detection and discrimination of two rice leaf roller larvae.
Description
Technical Field
The invention relates to a molecular biological distinguishing method for two larvae of Cnaphalocrocis medinalis and Marsamia patnalis in rice production, belonging to the technical field of biology.
Background
The Cnaphalocrocis medinalis and Marsamia patnalis are two important pests in rice production, and both eating the Cnaphalocrocis medinalis and the Marsamia patnalis damage rice leaves and longitudinally form leaf rolling, so that photosynthesis of the leaves is influenced, and yield reduction of rice is caused.
The forms and damage modes of two kinds of larvae of Cnaphalocrocis medinalis and Marsamia patnalis are similar, the larvae are damaged by tips of rice leaves firstly and then damaged towards the middle parts of the rice leaves, and the leaves are longitudinally rolled by spinning and taken for eating. The state of damage to rice is similar, and white leaves are formed. It is difficult to judge which kind of rice leaf roller is according to the field hazard condition. The two rice leaf roller larvae are yellow green, and the slight difference between the two larvae is difficult to distinguish by naked eyes. Furthermore, when the insect body is infected by microorganism, the original morphological characteristics of the insect body can be completely lost, so that the rice leaf roller can not be judged.
At present, the identification of the two rice leaf roller larvae is usually distinguished by morphological characteristics, and the two types of rice leaf roller larvae are easily confused due to extremely similar forms. The key morphological characteristics of the sample to be detected must be completely preserved during the distinguishing process, but the two rice leaf rollers cannot be accurately distinguished after the morphological characteristics are lost or deformed, so that the related research work of the two rice leaf rollers is greatly limited. For example, in order to study the microbial infection of cnaphalocrocis medinalis after a certain application of a microbial drug, the research on the field is greatly limited because it is impossible to accurately distinguish which kind of cnaphalocrocis medinalis in an infected sample. To solve this problem, we invented this molecular biological differentiation method.
Disclosure of Invention
Provides a molecular biological method for accurately distinguishing the larvae of Cnaphalocrocis medinalis and Marsamia patnalis, and provides a reliable method for distinguishing the larvae of Cnaphalocrocis medinalis and Marsamia patnalis for related personnel in the non-traditional taxonomic education background.
In one aspect, the present invention provides a method for accurately distinguishing two larvae of Cnaphalocrocis medinalis (Cnaphalocrocis medinalis) and Marsamia patnalis (Cnaphalocrocis medinalis) by using a molecular biological method, wherein the method comprises:
Extracting the genome DNA of a sample of rice leaf roller larvae to be detected as a PCR template, respectively carrying out PCR amplification on the template DNA by using designed primers, sequencing the amplified product, and analyzing the obtained sequence and a test sequence A and a test sequence B respectively, wherein the sequence is matched with the test sequence A by Cnaphalocrocis medinalis, and the sequence is matched with the test sequence B by Marsamia patnalis; wherein, the TEST sequence A is shown as TEST-A in figure 1, and the TEST sequence B is shown as TEST-B in figure 1. Preferably, the test sequence A is the sequence shown in SEQ ID NO. 1, and the test sequence B is the sequence shown in SEQ ID NO. 2.
Preferably, the specific primer for the amplification of the genomic DNA of the rice leaf roller larva detection sample is an upstream primer F: 5'-ATGAACATCGACATTTCGAACGCACAT-3', and the downstream primer R: 5 'TTCTTTTCCTCCGCTTAGTAATATGCTTAA-3'.
Preferably, the system for PCR amplification products is: 25 μ l of a PCR reaction system comprising: 2.5. mu.l of 10 XPCR Buffer (Mg)2+Free), 2. mu.l dNTPs (2.5mmol/L), 1.5. mu.l MgCl2(25mmol/L), upstream and downstream primers, 1. mu.l of sample genomic DNA, 0.125. mu.l of Taq DNA Polymerase, and a 25. mu.l portion of sterile water was added.
In another aspect, the present invention provides the use of a sequence A and a sequence B in the manufacture of a reagent for molecularly differentiating between two species of Cnaphalocrocis medinalis and Marsamia patnalis, wherein the sequence A is the sequence shown as TEST-A in figure 1 and the sequence B is the sequence shown as TEST-B in figure 1. Preferably, the test sequence A is the sequence shown in SEQ ID NO. 1, and the test sequence B is the sequence shown in SEQ ID NO. 2.
Preferably, the kit also comprises a specific primer sequence pair for amplifying two types of Cnaphalocrocis medinalis and Marsamia patnalis, wherein the specific primers are as follows: f: 5'-ATGAACATCGACATTTCGAACGCACAT-3', R: 5 'TTCTTTTCCTCCGCTTAGTAATATGCTTAA-3'.
Extracting the genome DNA of the two cnaphalocrocis medinalis larva samples as a PCR template, and utilizing a designed specific primer F: 5'-ATGAACATCGACATTTCGAACGCACAT-3', R: 5'TTCTTTTCCTCCGCTTAGTAATATGCTTAA-3' was subjected to PCR amplification. Sequencing the amplified product, analyzing the obtained sequences by using gene analysis software GENEDOC to obtain a section of sequence with obvious difference between the two sequences, and respectively defining the section of sequence as a test sequence A and a test sequence B.
The PCR amplification is carried out on the genome DNA of the sample of the larvae of the leaf roller to be detected by using the primer designed by us, the sequence of the amplification product is compared with a test sequence A and a test sequence B, the Cnaphalocrocismedinalis is matched with the test sequence A, and the Marsamia patnalis is matched with the test sequence B.
The specific sequence is shown in figure 1. The method for extracting genomic DNA is the same as that of "extraction of sample genomic DNA" in the embodiment, and the PCR system and the amplification procedure are the same as those of "preparation of PCR system" and "PCR amplification procedure" in the embodiment.
Advantageous effects
Compared with the traditional method, the method has the main advantages that: (1) the accuracy is high: conventional methods can lead to errors in the identification results due to inaccuracies in the different authenticators' confidence in the classification characteristics. The method is a molecular biology detection and identification technology based on PCR, but the current PCR technology is developed quite mature, has a standardized and foolproof experimental process, and ensures high accuracy of results. (2): the sensitivity is high: traditional morphological classification methods cannot distinguish samples that have lost morphological features. Based on the method of the invention, only trace amount of genome DNA can be extracted from the sample, and the target PCR fragment can be amplified, thereby completing the detection and identification of the sample to be detected.
Drawings
FIG. 1 shows the TEST sequence A and TEST sequence B of two rice leaf rollers, wherein "TEST-A" and "TEST-B" are TEST sequences,
FIG. 2 is a sample test result of the rice leaf roller in the field; wherein, in FIG. 2, "SAM-1", "SAM-2", "SAM-3" and "SAM-4" are samples collected in our field. In FIG. 2, "SAM-1", "SAM-2" and "SAM-3" are identical to "TEST-A", and are Cnaphalococci medinalis, and "SAM-4" are identical to "TEST-B", and are Marsamia patnalis
Detailed Description
Example 1: obtaining of test sequences A and B
1. Extraction of sample genomic DNA
Sample genome DNA is extracted by adopting AxyPrep genome DNA small-scale kit of Hangzhou love, and the specific operation is as follows:
(1) Two kinds of rice leaf roller larvae A and B (wherein A is Cnaphalocrocis medinalis and B is Marsamia patnalis) which are subjected to morphological characteristic identification are respectively placed into a 1.5ml centrifuge tube, liquid nitrogen is added to the centrifuge tube to be ground into powder, 350 mu l of Buffer PBS and 0.9 mu l of RNase A are added to the powder, and the mixture is gently ground for 30 s.
(2) 350 μ l of the ground homogenate was collected and transferred to a 2ml centrifuge tube. If the homogenate volume is less than 350. mu.l, PBS is supplemented to 350. mu.l. Mu.l Buffer C-L and 20. mu.l proteinase K were added. Immediately vortex and mix well for 1 min. After brief centrifugation, the tube was placed in a 56 ℃ water bath for 10 min.
(3) Add 350. mu.l Buffer P-D, mix well by vortexing for 30s, centrifuge for 10min at 12,000 Xg.
(4) The DNA preparation tube was placed in a 2ml centrifuge tube, the mixture in step 3 was transferred to the preparation tube, and centrifuged at 12,000 Xg for 1 min.
(5) the filtrate was discarded, the preparation tube was returned to the original 2ml centrifuge tube, 500. mu.l of Buffer W1 was added, and centrifugation was carried out at 12,000 Xg for 1 min.
(6) The filtrate was discarded, the preparation tube was returned to the original 2ml centrifuge tube, 700. mu.l of Buffer W2 was added, centrifugation was carried out at 12,000 Xg for 1min, and the tube was washed once more with 700. mu.l of Buffer W2 in the same manner.
(7) The filtrate was discarded, and the preparation tube was returned to the original 2ml centrifuge tube and centrifuged at 12,000 Xg for 1 min.
(8) The DNA preparation tube was placed in another clean 1.5ml centrifuge tube, 100-200. mu.l of Eluent or deionized water was added to the center of the membrane of the preparation tube, and the tube was left standing at room temperature for 1min and centrifuged at 12,000 Xg for 1min to elute the DNA. And (4) obtaining the genome DNA from the liquid in the centrifugal tube.
2. preparation of PCR System
A25. mu.l PCR reaction was used, comprising: 2.5. mu.l of 10 XPCR Buffer (Mg)2+Free), 2. mu.l dNTPs (2.5mmol/L), 1.5. mu.l MgCl2(25mmol/L), the forward and reverse primers (10. mu. mol/L) were each 1. mu.l (F: 5'-ATGAACATCGACATTTCGAACGCACAT-3', R: 5'TTCTTTTCCTCCGCTTAGTAATATGCT3'), sample genomic DNA 1. mu.l, 0.125. mu.l of Taq DNA Polymerase, and sterilized water was added to make up 25. mu.l.
3. PCR amplification procedure
4min at 94 ℃; 95 ℃ 40s, 64 ℃ 20s, 72 ℃ 40s (35 cycles); 72 ℃ for 2min 40 s.
4. Sequencing of amplification products
The amplified product was purified and added to ABI3730XL sequencer for sequencing.
5. Sequence analysis
And (3) introducing the sample sequence into GENEDOC software to remove redundant sequences, and then respectively obtaining a sequence A and a sequence B. Wherein the sequence A is the following sequence (SEQ ID NO: 1):
GCTGCATAAAAACAATGACCACATTGCGCGCGTTACGCGCGCTGATGACGGTTCTTGATGATTATGATATTAACTTATCGTTGTCGTCTGGTCCGTTCAAATATTATTATGATCGTTTCACGCTCGTACGCACACAGTACGACGTGCACGATTGTGACGTCGCCTCACACTACGTTAACAGTAGCGCGCGACTCTTCGACTTACACCAAAGTCTATAGAGAGAGCGGCATAATCTGTTTTAAATGTATGTGCGAAGCGCTGACGTCACGTTTAATATCGTGCACGTTTAGTACGTGTGTAAACAACGTTGTGTGTCTAAACGATGATTAAAAAAAAGGCGGACTCCTCGACCGACGAGGAGGATCAACGCCGCCGCCGCCGCCTCCTATGATGGTGACTACGTCGTAGCACTGACGAATATCATGTCTGCCTCTCCTTTTATCAT
Sequence B is the following sequence (SEQ ID NO: 2):
GCTGCATAAAAACAATGACCACATTGCGCGCGCGGCGCGCTTATGACGGTTCTTGATGATTATGTATATAATCGTCTGGTCCGTTCAAATATTATTATGATCGTTTCACGCGCGTACGCACAGTACGACGTGCACGATTGTGACGTCGCTCACCACTACGTCAATAGTAGCGCGACTCTTCGACTTACTCCAAAGTCTATAGAGAGAGCAGCATATCTATTGCACGTACGTGTGCGAGCGACGCTCGCTTTTAATGTCGTGAACGTTTTGTACGTGTGTCAAACGTTGTGTGTTCAAACGACGATCGAACAAAATATAAAAGTAGGCGGACTCGACGTCCGAAGAGGCGCATCGACGCCGTCGCCGCCGTCTCGTATGGTGGTTACGTCGTCGTAGCGCTGACGGATATCGTGTCTGCCTCTCATTTTATCGT。
the analysis shows that the homology between the sequence A and the sequence B is 81 percent, and the homology between the sequence A and the sequence B has obvious difference, as shown in figure 1, the sequence B at the position of the upper digit of the sequence in figure 1 is lack of a 10bp sequence compared with the sequence A, and the sequence B is added with a 9bp sequence compared with the sequence A before the position of the upper digit of the sequence is 340, and the sequence A and the sequence B have obvious characteristic difference. Sequence a and sequence B are defined as check sequence a and check sequence B, respectively.
Example 2 of implementation: the test sequences A and B provided by the invention are used for verifying whether the sample to be detected is Cnaphalocrocis medinalis or Marsamia patnalis
In 2014, 4 samples of rice leaf roller larvae infected by microorganisms are collected in the field, and people with non-traditional taxonomic education background cannot determine Cnaphalocrocis medinalis or Marsamia patnalis through morphological observation, and then the method is used for identification.
1. Extraction of sample genomic DNA
Sample genome DNA is extracted by adopting AxyPrep genome DNA small-scale kit of Hangzhou love, and the specific operation is as follows:
(1) Samples to be tested (SAM-1, SAM-2, SAM-3 and SAM-4) were each placed in a 1.5ml centrifuge tube, pulverized by adding liquid nitrogen, and gently pulverized for 30 seconds after adding 350. mu.l Buffer PBS and 0.9. mu.l RNase A.
(2) 350 μ l of the ground homogenate was collected and transferred to a 2ml centrifuge tube. If the homogenate volume is less than 350. mu.l, PBS is supplemented to 350. mu.l. Mu.l Buffer C-L and 20. mu.l proteinase K were added. Immediately vortex and mix well for 1 min. After brief centrifugation, the tube was placed in a 56 ℃ water bath for 10 min.
(3) Add 350. mu.l Buffer P-D, mix well by vortexing for 30s, centrifuge for 10min at 12,000 Xg.
(4) The DNA preparation tube was placed in a 2ml centrifuge tube, the mixture in step 3 was transferred to the preparation tube, and centrifuged at 12,000 Xg for 1 min.
(5) The filtrate was discarded, the preparation tube was returned to the original 2ml centrifuge tube, 500. mu.l of Buffer W1 was added, and centrifugation was carried out at 12,000 Xg for 1 min.
(6) The filtrate was discarded, the preparation tube was returned to the original 2ml centrifuge tube, 700. mu.l of Buffer W2 was added, centrifugation was carried out at 12,000 Xg for 1min, and the tube was washed once more with 700. mu.l of Buffer W2 in the same manner.
(7) The filtrate was discarded, and the preparation tube was returned to the original 2ml centrifuge tube and centrifuged at 12,000 Xg for 1 min.
(8) The DNA preparation tube was placed in another clean 1.5ml centrifuge tube, 100-200. mu.l of Eluent or deionized water was added to the center of the membrane of the preparation tube, and the tube was left standing at room temperature for 1min and centrifuged at 12,000 Xg for 1min to elute the DNA. And (4) obtaining the genome DNA from the liquid in the centrifugal tube.
2. Preparation of PCR System
A25. mu.l PCR reaction was used, comprising: 2.5. mu.l of 10 XPCR Buffer (Mg)2+free), 2. mu.l dNTPs (2.5mmol/L), 1.5. mu.l MgCl2(25mmol/L), the forward and reverse primers (10. mu. mol/L) were each 1. mu.l (F: 5'-ATGAACATCGACATTTCGAACGCACAT-3', R: 5'TTCTTTTCCTCCGCTTAGTAATATGCT3'), sample genomic DNA 1. mu.l, 0.125. mu.l of Taq DNA Polymerase, and sterilized water was added to make up 25. mu.l.
3. PCR amplification procedure
4min at 94 ℃; 95 ℃ 40s, 64 ℃ 20s, 72 ℃ 40s (35 cycles); 72 ℃ for 2min 40 s.
4. Sequencing of amplification products
The amplified product was purified and added to ABI3730XL sequencer for sequencing.
5. sequence analysis
And (3) introducing the sample sequence into GENEDOC software to remove redundant sequences to obtain sequences SAM-1, SAM-2, SAM-3 and SAM-4, comparing the sequences with the test sequence A and the test sequence B, and finding that the SAM-1, the SAM-2 and the SAM-3 are matched with the test sequence A and the SAM-4 is matched with the test sequence B.
The results showed that three of the four samples were Cnaphalocrocis medinalis and one was marsami patnalis. The detection result is shown in the attached figure 2 in the specification.
Also, the results of morphological distinction by taxonomic professionals for two different larvae distinguished by gene level were compared by morphological distinction and found to be the same as the results of the test of the present invention, which further illustrates that two different pest-free distinctions can be made completely by using test sequences A and B.
rganization Applicant
----------------------
Street :
City :
State :
Country :
PostalCode :
PhoneNumber :
FaxNumber :
EmailAddress :
<110> OrganizationName agricultural scientific college in Zhejiang province
Application Project
-------------------
<120> Title two molecular biology distinguishing methods for rice leaf roller larva
<130> AppFileReference :
<140> CurrentAppNumber : 2014107187678
<141> CurrentFilingDate : - -
Sequence
--------
<213> OrganismName : Cnaphalocrocis medinalis
<400> PreSequenceString :
gctgcataaa aacaatgacc acattgcgcg cgttacgcgc gctgatgacg gttcttgatg 60
attatgatat taacttatcg ttgtcgtctg gtccgttcaa atattattat gatcgtttca 120
cgctcgtacg cacacagtac gacgtgcacg attgtgacgt cgcctcacac tacgttaaca 180
gtagcgcgcg actcttcgac ttacaccaaa gtctatagag agagcggcat aatctgtttt 240
aaatgtatgt gcgaagcgct gacgtcacgt ttaatatcgt gcacgtttag tacgtgtgta 300
aacaacgttg tgtgtctaaa cgatgattaa aaaaaaggcg gactcctcga ccgacgagga 360
ggatcaacgc cgccgccgcc gcctcctatg atggtgacta cgtcgtagca ctgacgaata 420
tcatgtctgc ctctcctttt atcat 445
<212> Type : DNA
<211> Length : 445
SequenceName : 1
SequenceDescription :
Sequence
--------
<213> OrganismName : Marsamia patnalis
<400> PreSequenceString :
gctgcataaa aacaatgacc acattgcgcg cgcggcgcgc ttatgacggt tcttgatgat 60
tatgtatata atcgtctggt ccgttcaaat attattatga tcgtttcacg cgcgtacgca 120
cagtacgacg tgcacgattg tgacgtcgct caccactacg tcaatagtag cgcgactctt 180
cgacttactc caaagtctat agagagagca gcatatctat tgcacgtacg tgtgcgagcg 240
acgctcgctt ttaatgtcgt gaacgttttg tacgtgtgtc aaacgttgtg tgttcaaacg 300
acgatcgaac aaaatataaa agtaggcgga ctcgacgtcc gaagaggcgc atcgacgccg 360
tcgccgccgt ctcgtatggt ggttacgtcg tcgtagcgct gacggatatc gtgtctgcct 420
ctcattttat cgt 433
<212> Type : DNA
<211> Length : 433
SequenceName : 2
SequenceDescription :
Claims (5)
1. A method for accurately detecting larvae of rice leaf roller Marsamia patnalis by using a molecular biological method, wherein the method comprises the following steps:
Extracting the genome DNA of a rice leaf roller larva sample to be detected as a PCR template, performing PCR amplification on the template DNA by using a designed primer, sequencing an amplification product, analyzing an obtained sequence and a test sequence B, and determining that Marsamia patnalis is matched with the test sequence B; not matched by test sequence B is marsami patnalis; wherein the test sequence B is a sequence shown in SEQ ID NO. 2.
2. The method according to claim 1, wherein the specific primers for amplifying the genomic DNA of the sample to be detected of the rice leaf roller larvae are an upstream primer F: 5' -
ATGAACATCGACATTTCGAACGCACAT-3' and a downstream primer R: 5'
TTCTTTTCCTCCGCTTAGTAATATGCTTAA-3'。
3. The method of claim 2, wherein the PCR amplification system is: 25 μ l of a PCR reaction system comprising: 2.5. mu.l of 10 XPCR Buffer, 2. mu.l of dNTPs at a concentration of 2.5mmol/L and 1.5. mu.l of MgCl without magnesium ions225mmol/L of the upstream and downstream primers, 1. mu.l of the sample genomic DNA, 0.125. mu.l of Taq DNApolymerase, and sterilized water to make up 25. mu.l.
4. The application of a sequence B in preparing a reagent for detecting the difference between Marsamia patnalis of rice leaf roller on a molecular level, wherein the sequence B is a sequence shown as SEQ ID NO. 2.
5. The use of claim 4, further comprising a specific primer sequence pair for amplifying the rice leaf roller Marsamia patnalis, wherein the specific primer is an upstream primer: f: 5'-ATGAACATCGACATTTCGAACGCACAT-3', and the downstream primer R: 5 'TTCTTTTCCTCCGCTTAGTAATATGCTTAA-3'.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201610505791.2A CN106011265B (en) | 2014-12-01 | 2014-12-01 | Molecular biology distinguishing method for two rice leaf roller larvae |
Applications Claiming Priority (2)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201410718767.8A CN104561270B (en) | 2014-12-01 | 2014-12-01 | The molecular biology differentiating method of two kinds of rice leaf folder larvas |
| CN201610505791.2A CN106011265B (en) | 2014-12-01 | 2014-12-01 | Molecular biology distinguishing method for two rice leaf roller larvae |
Related Parent Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201410718767.8A Division CN104561270B (en) | 2014-12-01 | 2014-12-01 | The molecular biology differentiating method of two kinds of rice leaf folder larvas |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN106011265A CN106011265A (en) | 2016-10-12 |
| CN106011265B true CN106011265B (en) | 2019-12-13 |
Family
ID=53078344
Family Applications (2)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201410718767.8A Active CN104561270B (en) | 2014-12-01 | 2014-12-01 | The molecular biology differentiating method of two kinds of rice leaf folder larvas |
| CN201610505791.2A Active CN106011265B (en) | 2014-12-01 | 2014-12-01 | Molecular biology distinguishing method for two rice leaf roller larvae |
Family Applications Before (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201410718767.8A Active CN104561270B (en) | 2014-12-01 | 2014-12-01 | The molecular biology differentiating method of two kinds of rice leaf folder larvas |
Country Status (1)
| Country | Link |
|---|---|
| CN (2) | CN104561270B (en) |
Families Citing this family (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN106755569B (en) * | 2017-01-18 | 2019-07-09 | 江苏里下河地区农业科学研究所 | The special primer and detection method of a kind of rice leaf roller PuGV PCR detection and application |
| CN108004333B (en) * | 2017-12-28 | 2021-05-14 | 浙江省农业科学院 | Molecular biology-based primer and method for identifying black-belly chelonian and rice-lice red-swamp |
Family Cites Families (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101921828B (en) * | 2010-01-28 | 2012-11-07 | 东华大学 | High-throughput multi-LDR parting kit for detecting farmland ecological environment |
-
2014
- 2014-12-01 CN CN201410718767.8A patent/CN104561270B/en active Active
- 2014-12-01 CN CN201610505791.2A patent/CN106011265B/en active Active
Non-Patent Citations (3)
| Title |
|---|
| ITS2 sequence variations among members of Diachasmimorpha longicaudata complex (Hymenoptera: Braconidae) in Thailand;Sangvorn Kitthawee;《Journal of Asia-Pacific Entomology》;20130630;第16卷(第2期);第173-179页 * |
| Population genetic structure of the migratory rice leaf roller, Cnaphalocrocis medinalis (Lepidoptera: Pyralidae), inferred from the mitochondrial A+T-rich region and nuclear ITS2 sequences;Wan X等;《Genet Mol Res》;20110222;第10卷(第1期);第273-294页 * |
| 稻螟赤眼蜂ｒＤＮＡ特异引物设计及诊断引物在赤眼蜂分子鉴定中的应用;郭震等;《中国水稻科学》;20120229;第26卷(第1期);第123-126页 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN104561270A (en) | 2015-04-29 |
| CN104561270B (en) | 2016-10-05 |
| CN106011265A (en) | 2016-10-12 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN103898235B (en) | A kind of DNA bar code method for identifying molecules of Hirudo | |
| CN103898234A (en) | Method for identifying DNA bar code molecule of earthworm | |
| CN102337345A (en) | Medicolegal composite assay kit based on twenty triallelic SNP (single nucleotide polymorphism) genetic markers | |
| CN108060257A (en) | It is a kind of that strong male rotten mould Primer composition and its detection method are detected based on loop-mediated isothermal amplification technique | |
| CN106011265B (en) | Molecular biology distinguishing method for two rice leaf roller larvae | |
| CN104611424B (en) | The PCR RFLP methods of quick discriminating Radix Apioris Fortunei (Radix Lespedezae Buergeri) and its various pseudo- mixed product | |
| CN109486978A (en) | Buta-buta, Yunnan agalloch eaglewood, Aguilaria malaccensis Lamk SNP marker and its application | |
| CN106755515A (en) | A kind of method of Rapid identification Roscoea intermedia and Holothuria scabra | |
| CN105177138A (en) | Primer and method used for detecting Oidium heveae and application | |
| CN114540519B (en) | Primer, kit and identification method for identifying bacillus amyloliquefaciens in Daqu | |
| RU2550257C2 (en) | METHOD OF DIFFERENTIATING TYPICAL AND ATYPICAL STRAINS Yersinia pestis OF MEDIEVAL BIOVAR BY PCR METHOD WITH HYBRIDISATION-FLUORESCENT RECORDING RESULTS | |
| CN107937567B (en) | Specific primers for identifying bombyx batryticatus and identification method thereof | |
| CN106566891B (en) | Method for identifying two juvenile salmonids by using specific primer group | |
| CN109609679A (en) | Identify characteristic nucleotide sequence, nucleic acid molecular probe, kit and the method for ganoderma strain GIMS1524 | |
| CN106011277B (en) | A kind of primer pair, kit and the detection method of quick detection coffee rust | |
| CN105002166A (en) | Molecular standard sample of brown cockroaches and preparation method of molecular standard sample | |
| CN106701989A (en) | DNA (Deoxyribonucleic Acid) barcode molecular identification method of holothuria fuscopunctata | |
| KR102461752B1 (en) | Primer Set for Detecting Peronospora Destructor Berk, Diagnostic kit using the same | |
| CN110894551A (en) | RAA constant-temperature fluorescence detection method and reagent for grass carp hemorrhagic disease type I virus (GCRV-I) | |
| CN113151309B (en) | Streptococcus suis specific sequence with high risk of human beings and livestock and application thereof | |
| US20240158873A1 (en) | Dna barcode for screening floccularia luteovirens with high antioxidant activity | |
| CN109609668B (en) | Detection primer group and kit for MLVA typing of salmonella typhimurium and application of detection primer group and kit | |
| CN110656194A (en) | Callicarpa nudiflora DNA bar code standard detection sequence and application thereof | |
| KR101389776B1 (en) | Primers of polymerase chain reactions for the detection of Phytophthora species broken out on bulbs and tubers, and detection kits and methods thereof | |
| CN106967793B (en) | Molecular detection method for rapidly identifying cornus wisoniana population |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |