CN109486978A - Buta-buta, Yunnan agalloch eaglewood, Aguilaria malaccensis Lamk SNP marker and its application - Google Patents
Buta-buta, Yunnan agalloch eaglewood, Aguilaria malaccensis Lamk SNP marker and its application Download PDFInfo
- Publication number
- CN109486978A CN109486978A CN201711397665.0A CN201711397665A CN109486978A CN 109486978 A CN109486978 A CN 109486978A CN 201711397665 A CN201711397665 A CN 201711397665A CN 109486978 A CN109486978 A CN 109486978A
- Authority
- CN
- China
- Prior art keywords
- buta
- primer
- seq
- agalloch eaglewood
- sequence
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
- C12Q1/6895—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms for plants, fungi or algae
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6844—Nucleic acid amplification reactions
- C12Q1/6858—Allele-specific amplification
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/156—Polymorphic or mutational markers
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/166—Oligonucleotides used as internal standards, controls or normalisation probes
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Organic Chemistry (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Engineering & Computer Science (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Analytical Chemistry (AREA)
- Health & Medical Sciences (AREA)
- Biotechnology (AREA)
- Molecular Biology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Immunology (AREA)
- Biophysics (AREA)
- Physics & Mathematics (AREA)
- Genetics & Genomics (AREA)
- Biochemistry (AREA)
- Microbiology (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Botany (AREA)
- Mycology (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention discloses a kind of for identifying the SNP marker and its application of buta-buta, Yunnan agalloch eaglewood, Aguilaria malaccensis Lamk.The present invention is based on the systems that SNP marker establishes Rapid identification buta-buta, Yunnan agalloch eaglewood, Aguilaria malaccensis Lamk, to realize quick, accurately detection buta-buta, Yunnan agalloch eaglewood, Aguilaria malaccensis Lamk purpose, work etc. is examined to be of great significance port species.
Description
Technical field
The present invention relates to the molecular Biological Detection fields of wood material species identification, specifically, being related to for identifying that soil is heavy
Perfume, Yunnan agalloch eaglewood, Aguilaria malaccensis Lamk SNP marker and its application.
Background technique
Agalloch eaglewood, also known as " lignum aquilariae resinatum ", " water agalloch eaglewood ", archaism write " Shen Xiang " (Shen, with heavy).Since time immemorial " the heavy Tan Long often said
Musk deer " its " heavy ", just refers to agalloch eaglewood.Agalloch eaglewood perfume (or spice) product are graceful, and very rare, are listed in first of many perfume since ancient times.
Different from santal, agalloch eaglewood is not a kind of timber, but what a kind of special fragrant tree " knot " went out, it is mixed with grease
The solid-state condensation product of (resin) ingredient and wood substance component.And the timber of this kind of fragrant tree itself has no special fragrance, and wooden
It is more soft.According to present research, several trees that Thymelaeceae agalloch eaglewood belongs to, such as Aguilaria malaccensis Lamk tree, tabernaemontanus bulrush perfume (or spice) tree, Aquilaria agallocha tree
Agalloch eaglewood can be formed.
The price of agalloch eaglewood it is expensive, be known as the title of " wood in diamond ".It is reported that name culture scholar Yang Zhishui is introduced, during agalloch eaglewood is
Traditional medicine and the rare natural perfume material of state, Japan, India and other countries in Southeast Asia, in traditional Chinese medicine, Tibetanmedicine and print
Have thousands of years applicating histories in degree traditional medicine, medicinal, essential oil, fragrance etc. market demand are huge." rough system
Meter, whole world agalloch eaglewood turnover is up to 20,000,000,000 yuan or more at present.According to Historical Data Data About, in the Song Dynasty, prime quality is one liang of one liang of agalloch eaglewood
Gold；The Ming Dynasty has been arrived, one-inch agalloch eaglewood one-inch gold has been reformed into."
Morphological Identification be in agalloch eaglewood identification frequently with method, but shape feature is vulnerable to habitat, weather, physiological status etc.
Influence and frequently result in the deviation on subjective discrimination, be only difficult to precise Identification by morphological differences.
In recent years, using Protocols in Molecular Biology carry out species identification it is some treasure species and inspection and quarantine in terms of
It is applied, it will be heavy for how establishing efficient, quick, sensitive and high accuracy identification method using Protocols in Molecular Biology
One of the key technology in fragrant identification field.
Summary of the invention
The present invention provides a kind of for identifying the SNP marker of buta-buta, Yunnan agalloch eaglewood, Aguilaria malaccensis Lamk, the SNP
Molecular labeling is located at the 190-191 base of sequence shown in SEQ ID NO.1, SEQ ID NO.2 or SEQ ID NO.3, if the
190-191 bases are that GT is then accredited as buta-buta, are accredited as Yunnan agalloch eaglewood if 190-191 base is TT, if the
190-191 base is that CC is then accredited as Aguilaria malaccensis Lamk.
Application of the SNP marker in buta-buta, Yunnan agalloch eaglewood, Aguilaria malaccensis Lamk identification.
The application further comprises that identification is unearthed heavy respectively from buta-buta, Yunnan agalloch eaglewood, Aguilaria malaccensis Lamk Mixed tree species
Fragrant, Yunnan agalloch eaglewood, Aguilaria malaccensis Lamk.
The present invention provides a kind of for identifying the nucleotide sequence of buta-buta, Yunnan agalloch eaglewood, Aguilaria malaccensis Lamk, the nucleosides
Acid sequence include SEQ ID NO.1, SEQ ID NO.2 or SEQ ID NO.3 or SEQ ID NO.1, SEQ ID NO.2 or
CDNA or mRNA corresponding to SEQ ID NO.3,190-191 bases of the nucleotide sequence are that GT is then accredited as soil
Agalloch eaglewood is accredited as Yunnan agalloch eaglewood if 190-191 base is TT, if 190-191 base is that CC is accredited as Aguilaria malaccensis Lamk.
The present invention provides a kind of kits for identifying buta-buta, Yunnan agalloch eaglewood, Aguilaria malaccensis Lamk, including for specificity inspection
Survey SEQ ID NO.1, one kind that SEQ ID NO.2 or SEQ ID NO.3 sequence 190-191 bases are GT, TT or CC
Or the combination of a variety of primers or primer and probe.
Further, the primer in the kit and/or probe are selected from: the specific amplification for detection to be sequenced draws
Object and sequencing primer, primer sequence are respectively as follows:
Upstream primer F1:5'-CGTAACAAGGTTTTCGTAGGTGAAC-3'
Downstream primer R1:5'-GCTACGTTCTTCATCGAT-3'
Sequencing primer: 5'-CGTAACAAGGTTTTCGTAGGTGAAC-3'；
Alternatively, the specific amplification for the identification of HRM-PCR method extends primer and probe, primer and probe sequence difference
Are as follows:
Upstream primer F2:5 '-AAGGAACTTGATCACATAATATGTT-3 '
Downstream primer R2:5 '-TCATTTTAGATTCGTTTCAACGC-3 '；
Alternatively, the specific primer for ARMS-PCR amplification, primer sequence are as follows:
Upstream primer FP:5 '-CTTGTGGCCGTCATAACCAAACC-3 '
Buta-buta downstream primer TR:5 '-CGTTTCAACGCTTGATCTCA-3 '
Yunnan agalloch eaglewood downstream primer YR:5 '-CGTTTCAACGCTTGATCTAA-3 '
Aguilaria malaccensis Lamk downstream primer MR:5 '-CGTTTCAACGCTTGATCTGG-3 '
The kit further includes positive quality control product and negative quality-control product.
The present invention provides a kind of methods for preparing identification buta-buta, Yunnan agalloch eaglewood, Aguilaria malaccensis Lamk kit, including preparation
The step of detecting reaction reagent, the reaction reagent include to be used for specific detection SEQ ID NO.1, SEQ ID NO.2 or SEQ
The base that ID NO.3 is sequence 190-191 is one or more primers of GT, TT or CC or the combination of primer and probe.
The present invention provides a kind of for identifying the oligonucleotides of buta-buta, Yunnan agalloch eaglewood, Aguilaria malaccensis Lamk, the few nucleosides
Acid is used for specific detection SEQ ID NO.1, SEQ ID NO.2 or SEQ ID NO.3 sequence 190-191 bases are
The one or more primers or primer and probe of GT, TT or CC combine, and the oligonucleotides is selected to be expanded for the specificity of sequencing
Increase primer sequence and sequencing primer sequence, respectively
Upstream primer F1:5'-CGTAACAAGGTTTTCGTAGGTGAAC-3'
Downstream primer R1:5'-GCTACGTTCTTCATCGAT-3'
Sequencing primer: 5'-CGTAACAAGGTTTTCGTAGGTGAAC-3'；
Alternatively, specific amplification upstream primer F2 sequence, downstream primer R2 sequence and spy for the identification of HRM-PCR method
Needle P2 sequence is respectively as follows:
Upstream primer F2:5 '-AAGGAACTTGATCACATAATATGTT-3 '
Downstream primer R2:5 '-TCATTTTAGATTCGTTTCAACGC-3 '；
Probe P2:
Or it is respectively as follows: for the ARMS-PCR specific forward primer sequence expanded and downstream primer sequence
Upstream primer FP:5 '-CTTGTGGCCGTCATAACCAAACC-3 '
Buta-buta downstream primer TR:5 '-CGTTTCAACGCTTGATCTCA-3 '
Yunnan agalloch eaglewood downstream primer YR:5 '-CGTTTCAACGCTTGATCTAA-3 '
Aguilaria malaccensis Lamk downstream primer MR:5 '-CGTTTCAACGCTTGATCTGG-3 '
The present invention provides a kind of methods for identifying buta-buta, Yunnan agalloch eaglewood, Aguilaria malaccensis Lamk, comprising the following steps:
(1) genomic DNA to measuring plants is extracted；
(2) using step (1) extract genomic DNA as template, carry out PCR amplification, with detection detect SEQ ID NO.1,
SEQ ID NO.2 or SEQ ID NO.3 sequence 190-191 bit base situation；
(3) through detecting, it is accredited as buta-buta if 190-191 bases are GT, if 190-191 base is TT
It is accredited as Yunnan agalloch eaglewood, is accredited as Aguilaria malaccensis Lamk if 190-191 base is CC.
Compared with the prior art, the present invention has the following advantages and effect: the present invention to agalloch eaglewood, especially to buta-buta,
On the basis of three kinds of Yunnan agalloch eaglewood, Aguilaria malaccensis Lamk agalloch eaglewood lots of genes information carry out analysis comparison, and it is polymorphic according to sequence site
Property, design buta-buta, Yunnan agalloch eaglewood, Aguilaria malaccensis Lamk special primer and probe, it is heavy to establish buta-buta, Yunnan agalloch eaglewood, Malaysia
The quantitative fluorescent PCR of fragrant specificity identifies detection method.The present invention, which does not need timber, complete morphosis, only need to be from wood
Minute quantity wood sample is taken on material, can meet testing requirements, it is easy to operate.And it is judged, is reflected by SNP marker
It is objective, accurate to determine process.It overcomes conventional identification method and depends on Morphological Identification method, and must be set up having completely easily
Technical limitation on the basis of the morphosis of identification.The present invention utilizes primer pair mutated target sequence using ARMS technology
High precisely PCR amplification amplification is carried out, at the same time, amplified production is detected using probe, it is flat in real-time fluorescence quantitative PCR
The high specific detect to buta-buta, Yunnan agalloch eaglewood, Aguilaria malaccensis Lamk and high sensitivity are realized on platform.
Detailed description of the invention
Fig. 1 HRM-PCR method qualification result.
The result of Fig. 2 PCR sequencing PCR identification buta-buta.
The result of Fig. 3 PCR sequencing PCR identification Yunnan agalloch eaglewood.
The result of Fig. 4 PCR sequencing PCR identification Aguilaria malaccensis Lamk.
Fig. 5 buta-buta electrophoresis verification result: what 1 swimming lane indicated is buta-buta quality-control product PCR result；2 swimming lanes indicate be
The PCR result of reaction tube 1；3 indicate be reaction tube 2 PCR result；4 indicate be reaction tube 3 PCR result；5 expressions
It is 100bp ladder maker.
The Yunnan Fig. 6 agalloch eaglewood electrophoresis verification result: what 1 swimming lane indicated is Yunnan agalloch eaglewood quality-control product PCR result；2 swimming lanes indicate
Be reaction tube 1 PCR result；3 indicate be reaction tube 2 PCR result；4 indicate be reaction tube 3 PCR result；5 tables
That show is 100bp ladder maker.
Fig. 7 Aguilaria malaccensis Lamk electrophoresis verification result: what 1 swimming lane indicated is Aguilaria malaccensis Lamk quality-control product PCR result；2 swimming lanes indicate
Be reaction tube 1 PCR result；3 indicate be reaction tube 2 PCR result；4 indicate be reaction tube 3 PCR result；5 tables
That show is 100bp ladder maker.
Fig. 8 is alignment's figure of buta-buta, Yunnan agalloch eaglewood, Aguilaria malaccensis Lamk.
Specific embodiment
Present invention will be further explained below with reference to specific examples.But therefore do not limit the present invention to the tool
In body embodiment.Unaccounted condition and method in embodiment, usually routinely use method according to fields experimenter: example
Such as, the molecular cloning experiment handbooks such as Sambrook (NewYork:Cold Spring Harbor Laboratory Press,
1989) the operating technology regulation described in, or according to experiment condition proposed by manufacturer.
Embodiment 1 is used to identify the acquisition of buta-buta, Yunnan agalloch eaglewood, Aguilaria malaccensis Lamk SNP marker
5.8,18 and 28SrRNA gene on rDNA has great conservative, i.e., there is extensive xenogenesis homologys.And
Since the area ITS is added without mature ribosomes, so the natural selection pressure that ITS segment is born during evolution is very small, because
This can tolerate more variations.Extremely wide sequence polymorphism is shown in most of eucaryote, even
Very close 2 kinds of affiliation can show difference in ITS sequence, show nearest Evolution.This feature
Make ITS be suitable for the Molecular Identification of species and belong between species or the obvious Phylogenetic Relationships analysis of intraspecies variation.By
In ITS sequence analysis can substantially reflect belong between, the base pair difference of inter-species, furthermore ITS sequence segment is smaller, is easy to
Analysis has been widely used at present in the systematic growth research between different inter-species or approximate category.
1, the ITS gene according to disclosed in ncbi database designs corresponding primer and carries out PCR amplification, using upstream primer
F1:5 '-CGTAACAAGGTTTTCGTAGGTGAAC-3 ' (SEQ ID NO.4), downstream primer R1:5 '-
GCTACGTTCTTCATCGAT-3 ' (SEQ ID NO.5) and following PCR reaction system and PCR response procedures, through Zhejiang Province
Buta-buta (Aquilaria sinensis (Lour.) Spreng.), the Aguilaria malaccensis Lamk (Aquilaria of entry and exit identification
) and 3 agalloch eaglewood species genomic DNAs of Yunnan agalloch eaglewood (Aquilaria yunnanensis S.C.Huang) malaccensis
For template, PCR amplification is carried out, amplified production is detected through 1.5% agarose gel electrophoresis and observed in ultraviolet gel imaging system
It is sequenced after qualification.
Wherein, Vazyme AceTaq DNA enzymatic (article No. p401-d1 250U)
Plant genome DNA is traditionally extracted, commercialization DNA extraction kit can also be used and carry out DNA extraction.Example
Such as, the extraction of the agalloch eaglewood species genomic DNA is mentioned using the plant genome DNA that Hangzhou hundred steps Biological Co., Ltd.
Kit (KoningTM xylem genome DNA extracting reagent kit, article No. F2612) is taken, illustrates to be operated referring to kit,
The DNA of extraction is placed at -20 DEG C and is saved backup.
2, the exploitation of sequence alignment and the species specific molecular labeling of object
The ITS gene order for 3 agalloch eaglewood species that step 1 is obtained carries out sequence alignment by DNAMAN software and seeks
Look for suitable SNP site.Sequence alignment result through analysis as shown in figure 8, find to be located at the intragenic sequence (SEQ of agalloch eaglewood ITS
ID NO.1-SEQ ID NO.3) 190-191 bit base there are specificity, i.e. 190-191 of the sequence between species
Base is the specific position in the sequence, buta-buta is accredited as if SEQ ID NO.1 190-191 base is GT, if SEQ
ID NO.2 190-191 base is that TT is then accredited as Yunnan agalloch eaglewood, is identified if SEQ ID NO.3 190-191 base is CC
For Aguilaria malaccensis Lamk.The gene order of SEQ ID NO.1-3 is as follows:
Has the buta-buta sequence (SEQ ID NO.1) of the SNP site
TTGTCGATTCTTGCACAGCAGCATGACCCGTGAACGTTAATAACAATGTGCCGAGTTGGAATTGTGTCGTTATGCCC
CATTCCCTCTTCGGTTGGCCCTTGTGGCCGTCATAACCAAACCCCGGCGCGGACTGCGCCAAGGAACTTGATCACAT
GAAACGAATCTAAAATGACTCCCGGCAACGGATATCTCGGCTCTCGCATCGATAAG
Has the Yunnan agalloch eaglewood sequence (SEQ ID NO.2) of the SNP site
TTGTCGATTCCTGCACAGCAGCATGACCCGTGAACGTTAATAACAATGTGCCGAGTTGGAATTGTGTCGTTACGCTC
CATTCCCTCCTCGGTTGGCCCTTGTGGCCGTCATAACCAAACCCCGGCGCGGACTGCGCCAAGGAACTTGATCACAT
GAAACGAATCTAAAATGACTCCCGGCAACGGATATCTCGGCTCTCGCATCGATGACAACGTAGCAA
Has the Aguilaria malaccensis Lamk sequence (SEQ ID NO.3) of the SNP site
TTGTCGATTCCTGCACAGCAGCACGACCCGTGAACGTTAATAACAATGTGCCGAGTTGGAATTGTGTCGTTACGCCC
CATTCCCTCTTCGGTTGGCCCTTGCGGCCGTCATAACCAAACCCCGGCGCGGACTGCGCCAAGGAACTTGATCACAT
TGAAATGAATCTAAAATGACTCCCGGCAACGGATATCTCGGCTCTTGCATCGATG
2 agalloch eaglewood SNP marker of embodiment is in HRM-PCR amplification identification buta-buta, Yunnan agalloch eaglewood, Aguilaria malaccensis Lamk
Using
The present embodiment is on the basis of obtaining buta-buta, Yunnan agalloch eaglewood, Aguilaria malaccensis Lamk SNP site, for comprising described
The gene order of SNP site, using PrimerPremier5.0 separately design out specific forward primer F2, downstream primer R2 and
Probe, primer are synthesized by Suzhou Jin Weizhi Biotechnology Co., Ltd.Using the specific primer to buta-buta sample, Malaysia
Agalloch eaglewood sample and Yunnan agalloch eaglewood sample carry out HRM-PCR augmentation detection.Specifically, the upstream primer F, downstream primer R and spy
Needle is respectively:
Upstream primer F2:5 '-AAGGAACTTGATCACATAATATGTT-3 ' (SEQ ID NO.6)
Downstream primer R2:5 '-TCATTTTAGATTCGTTTCAACGC-3 ' (SEQ ID NO.7)
Using 3 agalloch eaglewood species genomic DNAs template, include: in 20 μ LPCR reaction systems
Fluorescence PCR program:
The following steps are included: 1) extract the genomic DNA to measuring plants；2) using the genomic DNA to measuring plants as template,
Utilize primer and probe, PCR amplification agalloch eaglewood ITS gene；Simultaneously with quality-control product (buta-buta quality-control product, Aguilaria malaccensis Lamk quality-control product and
Yunnan agalloch eaglewood quality-control product) it is that template is expanded；3) pcr amplification product is detected using HRM-PCR method, according to different genotype Tm
The different types of agalloch eaglewood of the different identification of value difference.
Buta-buta, Aguilaria malaccensis Lamk and the Yunnan agalloch eaglewood sample that the present embodiment 2 uses be also through existing method identification it is different with
Another group of sample of embodiment 1, testing result as shown in Figure 1, buta-buta amplification are as follows: the Tm value with buta-buta quality-control product
Unanimously, mobility scale is ± 0.2 DEG C；The amplification of Yunnan agalloch eaglewood are as follows: it is consistent with the Tm value of Yunnan agalloch eaglewood quality-control product, change model
Enclose is ± 0.2 DEG C；The amplification of Aguilaria malaccensis Lamk are as follows: consistent with the Tm value of Aguilaria malaccensis Lamk quality-control product, mobility scale is ± 0.2
℃.This shows that the buta-buta ITS gene SNP site that is directed to of the invention has high specificity, therefore can be used for quickly reflecting
Determine buta-buta.Tm the results are shown in Table 1:
Table 1:
| Quality-control product (Tm) | Sample (Tm) | |
| Aguilaria malaccensis Lamk | 75.99 | 75.93 |
| Buta-buta | 75.25 | 75.2 |
| Yunnan agalloch eaglewood | 74.17 | 74.13 |
It is heavy to buta-buta, Yunnan agalloch eaglewood and the Malaysia in the present embodiment 2 using primer described in embodiment 1 and sequencing approach
It is fragrant.Sample is identified that qualification result is as shown in Fig. 2 to 4.Buta-buta 190-191 bit base is GT, Yunnan agalloch eaglewood 190-
191 bit bases are TT, if Aguilaria malaccensis Lamk 190-191 bit base is CC.
| Zhejiang Province's entry and exit qualification result | Qualification result of the present invention | PCR sequencing PCR result |
| Buta-buta | Buta-buta (see Fig. 1) | GT (see Fig. 2) |
| Yunnan agalloch eaglewood | Yunnan agalloch eaglewood (see Fig. 1) | TT (see Fig. 3) |
| Aguilaria malaccensis Lamk | Aguilaria malaccensis Lamk (see Fig. 1) | CC (see Fig. 4) |
3 agalloch eaglewood SNP marker of embodiment answering in ARMS-PCR method identification buta-buta, Yunnan agalloch eaglewood, Aguilaria malaccensis Lamk
With
The present embodiment is on the basis of obtaining buta-buta, Yunnan agalloch eaglewood, Aguilaria malaccensis Lamk SNP site, for comprising described
The gene order of SNP site separately designs out specific forward primer, downstream primer, primer using PrimerPremier5.0
By Suzhou, Jin Weizhi Biotechnology Co., Ltd is synthesized.It is heavy to buta-buta sample, Malaysia using the specific primer and probe
Fragrant sample and Yunnan agalloch eaglewood sample carry out standard PCR amplification detection.Specifically, the upstream primer F, downstream primer R and difference
It is:
Upstream primer FP:5 '-CTTGTGGCCGTCATAACCAAACC-3 ' (SEQ ID NO.8)
Buta-buta downstream primer TR:5 '-CGTTTCAACGCTTGATCTCA-3 ' (SEQ ID NO.9)
Yunnan agalloch eaglewood downstream primer YR:5 '-CGTTTCAACGCTTGATCTAA-3 ' (SEQ ID NO.10)
Aguilaria malaccensis Lamk downstream primer MR:5 '-CGTTTCAACGCTTGATCTGG-3 ' (SEQ ID NO.11)
Using 3 agalloch eaglewood species genomic DNAs template, each species carry out 3 reactions, and system difference is as follows:
Arms-PCR response procedures:
The following steps are included: 1) extract the genomic DNA to measuring plants；2) using the genomic DNA to measuring plants as mould
Plate, PCR amplification agalloch eaglewood ITS gene；3) pcr amplification product is detected using arms-PCR method, each sample carries out above-mentioned three respectively
A reaction (1~reaction tube of reaction tube 3).When the electrophoresis result of reaction tube 1 has a purpose segment, and reaction tube 2 and the equal nothing of reaction tube 3
It is then buta-buta when target fragment；When 2 electrophoresis result of reaction tube has purpose segment, and reaction tube 1 and reaction tube 3 are without purpose
It is then Yunnan agalloch eaglewood when segment；When 3 electrophoresis result of reaction tube has purpose segment, and reaction tube 1 and reaction tube 2 are without purpose piece
Duan Shi is then Aguilaria malaccensis Lamk.
Buta-buta, Aguilaria malaccensis Lamk and the Yunnan agalloch eaglewood sample that the present embodiment 2 uses be also through existing method identification it is different with
Another group of sample of embodiment 1, testing result as illustrated in figs. 5-7, the amplification of buta-buta are as follows: the electrophoresis result of reaction tube 1
There is purpose segment, and reaction tube 2 and reaction tube 3 are without target fragment；The amplification of Yunnan agalloch eaglewood are as follows: 2 electrophoresis knot of reaction tube
Fruit and target fragment, and reaction tube 1 and reaction tube 3 are without target fragment；The amplification of Aguilaria malaccensis Lamk are as follows: 3 electrophoresis of reaction tube
As a result target fragment again, and reaction tube 1 and reaction tube 2 are without target fragment.This shows of the invention heavy for buta-buta, Yunnan
Fragrant and Aguilaria malaccensis Lamk ITS gene SNP site has high specificity, therefore it is heavy to can be used for Rapid identification buta-buta, Yunnan
Fragrant and Aguilaria malaccensis Lamk.
Listed reaction system in the embodiment of the present application, response procedures and detecting step etc. are a kind of specific embodiment party
Formula, those skilled in the art can also be according to actual needs to reaction systems, and response procedures etc. carry out the adjustment of adaptability.
Sequence table
<110>Hangzhou hundred steps Biological Co., Ltd.
<120>SNP marker and its application of buta-buta, Yunnan agalloch eaglewood, Aguilaria malaccensis Lamk
<130> 201706
<150> 2017108141124
<151> 2017-09-11
<160> 11
<170> SIPOSequenceListing 1.0
<210> 1
<211> 261
<212> DNA
<213>buta-buta (Aquilaria sinensis)
<400> 1
ttgtcgattc ttgcacagca gcatgacccg tgaacgttaa taacaatgtg ccgagttgga 60
attgtgtcgt tatgccccat tccctcttcg gttggccctt gtggccgtca taaccaaacc 120
ccggcgcgga ctgcgccaag gaacttgatc acataatacg tttgcctcgt gcacccagaa 180
atgggggcgg tggggatcaa gcgttgaaac gaatctaaaa tgactcccgg caacggatat 240
ctcggctctc gcatcgataa g 261
<210> 2
<211> 271
<212> DNA
<213>Yunnan agalloch eaglewood (Aquilaria yunnanensis)
<400> 2
ttgtcgattc ctgcacagca gcatgacccg tgaacgttaa taacaatgtg ccgagttgga 60
attgtgtcgt tacgctccat tccctcctcg gttggccctt gtggccgtca taaccaaacc 120
ccggcgcgga ctgcgccaag gaacttgatc acataatatg tttgccccgt gcacccagaa 180
atgggggcgt tggggatcaa gcgttgaaac gaatctaaaa tgactcccgg caacggatat 240
ctcggctctc gcatcgatga caacgtagca a 271
<210> 3
<211> 259
<212> DNA
<213>Aguilaria malaccensis Lamk (Aquilaria malaccensis)
<400> 3
ttgtcgattc ctgcacagca gcacgacccg tgaacgttaa taacaatgtg ccgagttgga 60
attgtgtcgt tacgccccat tccctcttcg gttggccctt gcggccgtca taaccaaacc 120
ccggcgcgga ctgcgccaag gaacttgatc acataatacg tctgccccgc gcacccagaa 180
atgggggcgc cggggatcaa gcgttgaaat gaatctaaaa tgactcccgg caacggatat 240
ctcggctctt gcatcgatg 259
<210> 4
<211> 25
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 4
cgtaacaagg ttttcgtagg tgaac 25
<210> 5
<211> 18
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 5
gctacgttct tcatcgat 18
<210> 6
<211> 25
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 6
aaggaacttg atcacataat atgtt 25
<210> 7
<211> 23
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 7
tcattttaga ttcgtttcaa cgc 23
<210> 8
<211> 23
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 8
cttgtggccg tcataaccaa acc 23
<210> 9
<211> 20
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 9
cgtttcaacg cttgatctca 20
<210> 10
<211> 20
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 10
cgtttcaacg cttgatctaa 20
<210> 11
<211> 20
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 11
cgtttcaacg cttgatctgg 20
Claims (10)
1. for identifying the SNP marker of buta-buta, Yunnan agalloch eaglewood, Aguilaria malaccensis Lamk, which is characterized in that the SNP molecule mark
Note is located at the 190-191 base of sequence shown in SEQ ID NO.1, SEQ ID NO.2 or SEQ ID NO.3, if 190-191
The base of position is that GT is then accredited as buta-buta, Yunnan agalloch eaglewood is accredited as if 190-191 base is TT, if 190-191 alkali
Base is that CC is then accredited as Aguilaria malaccensis Lamk.
2. application of the SNP marker described in claim 1 in buta-buta, Yunnan agalloch eaglewood, Aguilaria malaccensis Lamk identification.
3. application according to claim 2, which is characterized in that from buta-buta, Yunnan agalloch eaglewood, Aguilaria malaccensis Lamk Mixed tree species
Buta-buta, Yunnan agalloch eaglewood, Aguilaria malaccensis Lamk are identified respectively.
4. for identifying the nucleotide sequence of buta-buta, Yunnan agalloch eaglewood, Aguilaria malaccensis Lamk, which is characterized in that the nucleotide sequence
Including SEQ ID NO.1, SEQ ID NO.2 or SEQ ID NO.3 or SEQ ID NO.1, SEQ ID NO.2 or SEQ ID
The 190-191 bases of cDNA corresponding to NO.3 or mRNA, the nucleotide sequence are then accredited as buta-buta for GT, if
190-191 base is that TT is then accredited as Yunnan agalloch eaglewood, is accredited as Aguilaria malaccensis Lamk if 190-191 base is CC.
5. a kind of kit for identifying buta-buta, Yunnan agalloch eaglewood, Aguilaria malaccensis Lamk, which is characterized in that including being used for specific detection
SEQ ID NO.1, SEQ ID NO.2 or SEQ ID NO.3 sequence 190-191 bases be GT, TT or CC one kind or
The combination of a variety of primers or primer and probe.
6. kit according to claim 5, which is characterized in that the primer and/or probe are selected from: for detection to be sequenced
Specificity amplification primer and sequencing primer, primer sequence is respectively as follows:
Upstream primer F1:5'-CGTAACAAGGTTTTCGTAGGTGAAC-3'
Downstream primer R1:5'-GCTACGTTCTTCATCGAT-3'
Sequencing primer: 5'-CGTAACAAGGTTTTCGTAGGTGAAC-3'；
Alternatively, the specific amplification for the identification of HRM-PCR method extends primer, primer sequence are as follows:
Upstream primer F2:5 '-AAGGAACTTGATCACATAATATGTT-3 '
Downstream primer R2:5 '-TCATTTTAGATTCGTTTCAACGC-3 '；
Alternatively, the specific primer for ARMS-PCR amplification, primer sequence are as follows:
Upstream primer FP:5 '-CTTGTGGCCGTCATAACCAAACC-3 '
Buta-buta downstream primer TR:5 '-CGTTTCAACGCTTGATCTCA-3 '
Yunnan agalloch eaglewood downstream primer YR:5 '-CGTTTCAACGCTTGATCTAA-3 '
Aguilaria malaccensis Lamk downstream primer MR:5 '-CGTTTCAACGCTTGATCTGG-3 '.
7. a kind of method for preparing identification buta-buta, Yunnan agalloch eaglewood, Aguilaria malaccensis Lamk kit, including preparation detection reaction reagent
Step, which is characterized in that the reaction reagent includes to be used for specific detection SEQ ID NO.1, SEQ ID NO.2 or SEQ ID
The base of NO.3 sequence 190-191 is one or more primers of GT, TT or CC or the combination of primer and probe.
8. for identifying the oligonucleotides of buta-buta, Yunnan agalloch eaglewood, Aguilaria malaccensis Lamk, which is characterized in that the oligonucleotides is used for
Specific detection SEQ ID NO.1, SEQ ID NO.2 or SEQ ID NO.3 sequence 190-191 bases be GT, TT or
The one or more primers or primer and probe of CC combine, and the oligonucleotides is selected from the specificity amplification primer for sequencing
Sequence and sequencing primer sequence, respectively
Upstream primer F1:5'-CGTAACAAGGTTTTCGTAGGTGAAC-3'
Downstream primer R1:5'-GCTACGTTCTTCATCGAT-3'
Sequencing primer: 5'-CGTAACAAGGTTTTCGTAGGTGAAC-3'；
Alternatively, specific amplification upstream primer F2 sequence, the downstream primer R2 sequence for the identification of HRM-PCR method are respectively as follows:
Upstream primer F2:5 '-AAGGAACTTGATCACATAATATGTT-3 '
Downstream primer R2:5 '-TCATTTTAGATTCGTTTCAACGC-3 '；
Or it is respectively as follows: for the ARMS-PCR specific forward primer sequence expanded and downstream primer sequence
Upstream primer FP:5 '-CTTGTGGCCGTCATAACCAAACC-3 '
Buta-buta downstream primer TR:5 '-CGTTTCAACGCTTGATCTCA-3 '
Yunnan agalloch eaglewood downstream primer YR:5 '-CGTTTCAACGCTTGATCTAA-3 '
Aguilaria malaccensis Lamk downstream primer MR:5 '-CGTTTCAACGCTTGATCTGG-3 '.
9. a kind of method for identifying buta-buta, Yunnan agalloch eaglewood, Aguilaria malaccensis Lamk, comprising the following steps:
(1) genomic DNA to measuring plants is extracted；
(2) genomic DNA extracted using step (1) carries out PCR amplification as template, detects SEQ ID NO.1, SEQ with detection
ID NO.2 or SEQ ID NO.3 sequence 190-191 bit base situation；
(3) through detecting, it is accredited as buta-buta if 190-191 bases are GT, if 190-191 base is that TT is identified
For Yunnan agalloch eaglewood, Aguilaria malaccensis Lamk is accredited as if 190-191 base is CC.
10. according to the method described in claim 9, it is characterized in that, primer needed for PCR amplification or probe are selected from claim
8。
Applications Claiming Priority (2)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201710814112 | 2017-09-11 | ||
| CN2017108141124 | 2017-09-11 |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN109486978A true CN109486978A (en) | 2019-03-19 |
Family
ID=65688568
Family Applications (2)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201711397665.0A Pending CN109486978A (en) | 2017-09-11 | 2017-12-22 | Buta-buta, Yunnan agalloch eaglewood, Aguilaria malaccensis Lamk SNP marker and its application |
| CN201711398258.1A Pending CN109486983A (en) | 2017-09-11 | 2017-12-22 | Buta-buta, Yunnan agalloch eaglewood, Aguilaria malaccensis Lamk SNP marker and application |
Family Applications After (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201711398258.1A Pending CN109486983A (en) | 2017-09-11 | 2017-12-22 | Buta-buta, Yunnan agalloch eaglewood, Aguilaria malaccensis Lamk SNP marker and application |
Country Status (1)
| Country | Link |
|---|---|
| CN (2) | CN109486978A (en) |
Cited By (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN111254211A (en) * | 2020-02-28 | 2020-06-09 | 广东药科大学 | Aquilaria plant identification method based on ITS sequence and machine learning |
| CN113061662A (en) * | 2021-04-21 | 2021-07-02 | 澳门科技大学 | DNA bar code and reagent for identifying agilawood, and detection method and application thereof |
| CN117230246A (en) * | 2023-11-15 | 2023-12-15 | 中国林业科学研究院热带林业研究所 | Core SNP marker for identifying agilawood easy to form and application |
Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US20110160152A1 (en) * | 2009-12-29 | 2011-06-30 | Taipei Medical University | Extracts of aquilaria hulls and use thereof in the treatment of cancer |
| CN105112410A (en) * | 2015-08-21 | 2015-12-02 | 浙江出入境检验检疫局检验检疫技术中心 | Gene detection primer, probe and method for identifying Aquilaria malaccensis |
| CN105132540A (en) * | 2015-08-21 | 2015-12-09 | 浙江出入境检验检疫局检验检疫技术中心 | Double-PCR (polymerase chain reaction) method, primer and probe for identifying aquilaria sinensis |
Family Cites Families (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN105087566B (en) * | 2015-08-21 | 2017-12-26 | 浙江出入境检验检疫局检验检疫技术中心 | Identify fluorescence quantifying PCR method, primer and probe and its application of suspension culture of Aquilaria sinensis |
-
2017
- 2017-12-22 CN CN201711397665.0A patent/CN109486978A/en active Pending
- 2017-12-22 CN CN201711398258.1A patent/CN109486983A/en active Pending
Patent Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US20110160152A1 (en) * | 2009-12-29 | 2011-06-30 | Taipei Medical University | Extracts of aquilaria hulls and use thereof in the treatment of cancer |
| CN105112410A (en) * | 2015-08-21 | 2015-12-02 | 浙江出入境检验检疫局检验检疫技术中心 | Gene detection primer, probe and method for identifying Aquilaria malaccensis |
| CN105132540A (en) * | 2015-08-21 | 2015-12-09 | 浙江出入境检验检疫局检验检疫技术中心 | Double-PCR (polymerase chain reaction) method, primer and probe for identifying aquilaria sinensis |
Non-Patent Citations (8)
Cited By (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN111254211A (en) * | 2020-02-28 | 2020-06-09 | 广东药科大学 | Aquilaria plant identification method based on ITS sequence and machine learning |
| CN113061662A (en) * | 2021-04-21 | 2021-07-02 | 澳门科技大学 | DNA bar code and reagent for identifying agilawood, and detection method and application thereof |
| CN117230246A (en) * | 2023-11-15 | 2023-12-15 | 中国林业科学研究院热带林业研究所 | Core SNP marker for identifying agilawood easy to form and application |
| CN117230246B (en) * | 2023-11-15 | 2024-04-02 | 中国林业科学研究院热带林业研究所 | Core SNP marker for identifying agilawood easy to form and application |
Also Published As
| Publication number | Publication date |
|---|---|
| CN109486983A (en) | 2019-03-19 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN104911256B (en) | A kind of Radix Angelicae Sinensis SCAR molecular labelings and its authentication method and specific primer pair | |
| CN109486979A (en) | For identifying the SNP marker and application of Xizang Taxus chinensis | |
| KR101331740B1 (en) | SSR primer derived from Paeonia lactiflora and use thereof | |
| CN109486978A (en) | Buta-buta, Yunnan agalloch eaglewood, Aguilaria malaccensis Lamk SNP marker and its application | |
| CN109517925A (en) | Flax SSR molecular marker and its application | |
| CN106636342A (en) | EST-SSR marker primer group developed on basis of sequence of transcriptome of ligusticum wallichii, and acquisition method and application of EST-SSR marker primer group | |
| CN104017859A (en) | Method for identifying sugarcane germplasm resources based on SSR (Simple Sequence Repeats) and CE (capillary electrophoresis) technique | |
| CN103882147B (en) | The method of genome random amplification sequence SNP polymorphism and the polymorphism that methylates | |
| KR102009712B1 (en) | Primer set for discriminating Zizyphus jujuba 'Bokjo' cultivar and uses thereof | |
| CN105087813B (en) | A kind of Cultivars of Ginkgo biloba L molecular detection primer composition and its kind detection method | |
| CN113151567B (en) | SSR molecular marker and method for identifying Lepista sordida N006# strain | |
| CN107164525B (en) | A kind of DNA for differentiating 6 kinds of Pterocarpus timber combines bar code and its discrimination method and application | |
| CN105543373A (en) | Rapid molecular identification method for glycyrrhiza uralensis, glycyrrhiza glabra, glycyrrhiza inflate and hybrid variety thereof | |
| CN104673790A (en) | Molecular-specificity labeling primer for oil-tea good-variety longlin 18 and identification method | |
| Sun et al. | Database and primer selections affect nematode community composition under different vegetations of Changbai Mountain | |
| CN105112410B (en) | For genetic test primer, probe and the method for Aguilaria malaccensis Lamk identification | |
| CN102719543A (en) | Method for identifying plant varieties by utilizing chemical molecular formulas of nucleotides | |
| CN109666758A (en) | Genuine rhizome of chuanxiong identification primer and identification method based on InDel label | |
| KR102335806B1 (en) | Molecular marker based on chloroplast genome sequence for discriminating Zizyphus jujuba 'SanJo' cultivar and uses thereof | |
| CN103290107A (en) | Construction method of SSR fingerprint suitable for identification of rice hybrid authenticity | |
| CN106011265B (en) | Molecular biology distinguishing method for two rice leaf roller larvae | |
| KR102147340B1 (en) | A composition for detecting Ganoderma microorganism and diagnosing basal stem rot and a method using the same | |
| CN112980988A (en) | Asarum molecular identity card and application thereof | |
| CN105018481B (en) | A kind of DNA fingerprinting and its acquisition methods and primer special of eight king of river | |
| CN105002166A (en) | Molecular standard sample of brown cockroaches and preparation method of molecular standard sample |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination |