CN109486983A - Buta-buta, Yunnan agalloch eaglewood, Aguilaria malaccensis Lamk SNP marker and application - Google Patents
Buta-buta, Yunnan agalloch eaglewood, Aguilaria malaccensis Lamk SNP marker and application Download PDFInfo
- Publication number
- CN109486983A CN109486983A CN201711398258.1A CN201711398258A CN109486983A CN 109486983 A CN109486983 A CN 109486983A CN 201711398258 A CN201711398258 A CN 201711398258A CN 109486983 A CN109486983 A CN 109486983A
- Authority
- CN
- China
- Prior art keywords
- buta
- primer
- seq
- agalloch eaglewood
- sequence
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
- C12Q1/6895—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms for plants, fungi or algae
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6844—Nucleic acid amplification reactions
- C12Q1/6858—Allele-specific amplification
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/156—Polymorphic or mutational markers
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/166—Oligonucleotides used as internal standards, controls or normalisation probes
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Organic Chemistry (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Engineering & Computer Science (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Analytical Chemistry (AREA)
- Health & Medical Sciences (AREA)
- Biotechnology (AREA)
- Molecular Biology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Immunology (AREA)
- Biophysics (AREA)
- Physics & Mathematics (AREA)
- Genetics & Genomics (AREA)
- Biochemistry (AREA)
- Microbiology (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Botany (AREA)
- Mycology (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention discloses a kind of for identifying the SNP marker of buta-buta, Yunnan agalloch eaglewood, Aguilaria malaccensis Lamk, the 81-84 bit base that the SNP marker is located at sequence shown in SEQ ID NO.1, SEQ ID NO.2 or SEQ ID NO.3 is that TGCC is then accredited as buta-buta, it is to be accredited as Yunnan agalloch eaglewood if base is CGCT if 81-84, if 81-84 bit base is that CGCC is accredited as Aguilaria malaccensis Lamk.The present invention is based on the systems that SNP marker establishes Rapid identification buta-buta, Yunnan agalloch eaglewood, Aguilaria malaccensis Lamk.To achieve the purpose that it is quick, accurately detect buta-buta, Yunnan agalloch eaglewood, Aguilaria malaccensis Lamk, examine work etc. to be of great significance port species.
Description
Technical field
The present invention relates to the molecular Biological Detection fields of wood material species identification, specifically, being related to for identifying that soil is heavy
Perfume, Yunnan agalloch eaglewood, Aguilaria malaccensis Lamk SNP marker and its application
Background technique
Agalloch eaglewood, also known as " lignum aquilariae resinatum ", " water agalloch eaglewood ", archaism write " Shen Xiang " (Shen, with heavy).Since time immemorial " the heavy Tan Long often said
Musk deer " its " heavy ", just refers to agalloch eaglewood.Agalloch eaglewood perfume (or spice) product are graceful, and very rare, are listed in first of many perfume since ancient times.
Different from santal, agalloch eaglewood is not a kind of timber, but what a kind of special fragrant tree " knot " went out, it is mixed with grease
The solid-state condensation product of (resin) ingredient and wood substance component.And the timber of this kind of fragrant tree itself has no special fragrance, and wooden
It is more soft.According to present research, several trees that Thymelaeceae agalloch eaglewood belongs to, such as Aguilaria malaccensis Lamk tree, tabernaemontanus bulrush perfume (or spice) tree, Aquilaria agallocha tree
Agalloch eaglewood can be formed.
The price of agalloch eaglewood it is expensive, be known as the title of " wood in diamond ".It is reported that name culture scholar Yang Zhishui is introduced, during agalloch eaglewood is
Traditional medicine and the rare natural perfume material of state, Japan, India and other countries in Southeast Asia, in traditional Chinese medicine, Tibetanmedicine and print
Have thousands of years applicating histories in degree traditional medicine, medicinal, essential oil, fragrance etc. market demand are huge." rough system
Meter, whole world agalloch eaglewood turnover is up to 20,000,000,000 yuan or more at present.According to Historical Data Data About, in the Song Dynasty, prime quality is one liang of one liang of agalloch eaglewood
Gold；The Ming Dynasty has been arrived, one-inch agalloch eaglewood one-inch gold has been reformed into ".
Morphological Identification be in agalloch eaglewood identification frequently with method, but shape feature is vulnerable to habitat, weather, physiological status etc.
Influence and frequently result in the deviation on subjective discrimination, be only difficult to precise Identification by morphological differences.
In recent years, using Protocols in Molecular Biology carry out species identification it is some treasure species and inspection and quarantine in terms of
It is applied, it will be heavy for how establishing efficient, quick, sensitive and high accuracy identification method using Protocols in Molecular Biology
One of the key technology in fragrant identification field.
Summary of the invention
The present invention provides a kind of for identifying the SNP marker of buta-buta, Yunnan agalloch eaglewood, Aguilaria malaccensis Lamk, the SNP
The 81-84 bit base that molecular labeling is located at sequence shown in SEQ ID NO.1, SEQ ID NO.2 or SEQ ID NO.3 is TGCC
It is then accredited as buta-buta, is accredited as Yunnan agalloch eaglewood if 81-84 bit base is CGCT, if 81-84 bit base is CGCC
It is accredited as Aguilaria malaccensis Lamk.
Application of the SNP marker in buta-buta, Yunnan agalloch eaglewood, Aguilaria malaccensis Lamk identification.
Further, the application is that identification is unearthed heavy respectively from buta-buta, Yunnan agalloch eaglewood, Aguilaria malaccensis Lamk mixing species
Fragrant, Yunnan agalloch eaglewood, Aguilaria malaccensis Lamk.
The present invention provides a kind of for identifying the oligonucleotides of buta-buta, Yunnan agalloch eaglewood, Aguilaria malaccensis Lamk, including SEQ
ID NO.1, SEQ ID NO.2 or SEQ ID NO.3 or SEQ ID NO.1, SEQ ID NO.2 or SEQ ID NO.3 institute
Corresponding cDNA or mRNA, the 81-84 bit base of the nucleotide sequence is that TGCC is then buta-buta, if 81-84 alkali
Base is that CGCT is then Yunnan agalloch eaglewood, is Aguilaria malaccensis Lamk if being CGCC if 81-84 bit base.
The present invention provides a kind of kits for identifying buta-buta, Yunnan agalloch eaglewood, Aguilaria malaccensis Lamk, including for specificity inspection
Survey SEQ ID NO.1, SEQ ID NO.2 or SEQ ID NO.3 sequence 81-84 bit base be TGCC or CGCT or
One or more primers of CGCC or the combination of primer and probe.
Further, the primer and/or probe are selected from: specificity amplification primer and sequencing for detection to be sequenced draw
Object, primer sequence are respectively as follows:
Upstream primer F1:5'-CGTAACAAGGTTTTCGTAGGTGAAC-3'
Downstream primer R1:5'-GCTACGTTCTTCATCGAT-3'
Sequencing primer: 5'-CGTAACAAGGTTTTCGTAGGTGAAC-3'；
Alternatively, it is used for the specific amplification amplimer and probe of fluorescence quantitative PCR detection, primer and probe sequence difference
Are as follows:
Upstream primer F2:5'-CCGTGAACGTTAATAACAATGTGC-3'
Downstream primer R2:5'-ATCAAGTTCCTTGGCGCAGTC-3'
Probe 2-1:5'-FAM-GTGTCGTTATGCCCATTCCCTCCT-BHQ1-3'
Probe 2-2:5'-HEX-GTGTCGTTACGCTCCATTCCCTCCT-BHQ1-3'
Probe 2-3:5'-ROX-GTGTCGTTACGCCCATTCCCTCCT-BHQ1-3'；
Alternatively, the specificity amplification primer for ARMS-PCR amplification, primer sequence are as follows:
Buta-buta specific primer:
Upstream primer T1:5'-GATGCGCGCTATGATTGAAC-3'
Downstream primer T2:5'-CGGTGTATGCCATGATGCA-3'
Yunnan agalloch eaglewood specific primer:
Upstream primer Y1:5'-GATGCGCGCTATGATTGTGT-3'
Downstream primer Y2:5'-CGGTGTATGCCATGATGCG-3'
Aguilaria malaccensis Lamk specific primer
Upstream primer M1:5'-GATGCGCGCTATGATTGTAT-3'
Downstream primer M2:5'-CGGTGTATGCCATGATGCG-3'.
The kit further includes positive quality control product and negative quality-control product.
The present invention provides a kind of methods for preparing identification buta-buta, Yunnan agalloch eaglewood, Aguilaria malaccensis Lamk kit, including preparation
The step of detecting reaction reagent, the reaction reagent include for specific detection SEQ ID NO.1, SEQ ID NO.2 or
SEQ ID NO.3 sequence 81-84 bit base be TGCC or CGCT or CGCC one or more primers or primer and
The combination of probe.
The present invention provides a kind of for identifying the oligonucleotides of buta-buta, Yunnan agalloch eaglewood, Aguilaria malaccensis Lamk, the few nucleosides
Acid is TGCC for specific detection SEQ ID NO.1, SEQ ID NO.2 or SEQ ID NO.3 sequence 81-84 bit base
Either one or more primers of CGCT or CGCC, the oligonucleotides are selected from the specificity amplification primer sequence for sequencing
With sequencing primer sequence, respectively
Upstream primer F1:5'-CGTAACAAGGTTTTCGTAGGTGAAC-3'
Downstream primer R1:5'-GCTACGTTCTTCATCGAT-3'
Sequencing primer: 5'-CGTAACAAGGTTTTCGTAGGTGAAC-3'；
Alternatively, being used for fluorescent quantitative PCR specific forward primer F2 sequence, downstream primer R2 sequence and probe P2 sequence
Column are respectively as follows:
Upstream primer F2:5'-CCGTGAACGTTAATAACAATGTGC-3'
Downstream primer R2:5'-ATCAAGTTCCTTGGCGCAGTC-3'
Probe 2-1:5'-FAM-GTGTCGTTATGCCCATTCCCTCCT-BHQ1-3'
Probe 2-2:5'-HEX-GTGTCGTTACGCTCCATTCCCTCCT-BHQ1-3'
Probe 2-3:5'-ROX-GTGTCGTTACGCCCATTCCCTCCT-BHQ1-3'；
Alternatively, the specific forward primer sequence and downstream primer sequence of progress ARMS-PCR amplification are respectively as follows:
Buta-buta specific primer:
Upstream primer T1:5'-GATGCGCGCTATGATTGAAC-3'
Downstream primer T2:5'-CGGTGTATGCCATGATGCA-3'
Yunnan agalloch eaglewood specific primer:
Upstream primer Y1:5'-GATGCGCGCTATGATTGTGT-3'
Downstream primer Y2:5'-CGGTGTATGCCATGATGCG-3'
Aguilaria malaccensis Lamk specific primer
Upstream primer M1:5'-GATGCGCGCTATGATTGTAT-3'
Downstream primer M2:5'-CGGTGTATGCCATGATGCG-3'
The present invention also provides a kind of methods for identifying buta-buta, Yunnan agalloch eaglewood, Aguilaria malaccensis Lamk, comprising the following steps:
(1) genomic DNA to measuring plants is extracted；
(2) genomic DNA extracted using step (1) is template, progress PCR amplification, detection detection SEQ ID NO.1,
SEQ ID NO.2 or SEQ ID NO.3 sequence 81-84 bit base；
(3) through detecting, it is accredited as buta-buta if 81-84 bit base is TGCC, if 81-84 bit base is CGCT
It is accredited as Yunnan agalloch eaglewood, is accredited as Aguilaria malaccensis Lamk if 81-84 bit base is CGCC.
Primer needed for PCR amplification or probe be selected from upstream primer F1, downstream primer R1, sequencing primer, upstream primer F2,
Downstream primer R2, probe P2, upstream primer T1, downstream primer T2, upstream primer Y1, downstream primer Y2, upstream primer M1, downstream
Primer M2.
Compared with the prior art, the present invention has the following advantages and effect: the present invention to agalloch eaglewood, especially to buta-buta,
On the basis of three kinds of Yunnan agalloch eaglewood, Aguilaria malaccensis Lamk agalloch eaglewood lots of genes information carry out analysis comparison, and it is polymorphic according to sequence site
Property, design buta-buta, Yunnan agalloch eaglewood, Aguilaria malaccensis Lamk special primer and probe, it is heavy to establish buta-buta, Yunnan agalloch eaglewood, Malaysia
The quantitative fluorescent PCR of fragrant specificity identifies detection method.The present invention, which does not need timber, complete morphosis, only need to be from wood
Minute quantity wood sample is taken on material, can meet testing requirements, it is easy to operate.And it is judged, is reflected by SNP marker
It is objective, accurate to determine process.It overcomes conventional identification method and depends on Morphological Identification method, and must be set up having completely easily
Technical limitation on the basis of the morphosis of identification.The present invention utilizes primer pair mutated target sequence using ARMS technology
High precisely PCR amplification amplification is carried out, at the same time, amplified production is detected using probe, it is flat in real-time fluorescence quantitative PCR
The high specific detect to buta-buta, Yunnan agalloch eaglewood, Aguilaria malaccensis Lamk and high sensitivity are realized on platform.
Detailed description of the invention
Fig. 1 is buta-buta quality-control product.
Fig. 2 present invention identifies the result of buta-buta using fluorescence quantitative PCR method.
The Yunnan Fig. 3 agalloch eaglewood quality-control product.
Fig. 4 present invention identifies the result of Yunnan agalloch eaglewood using fluorescence quantitative PCR method.
Fig. 5 Aguilaria malaccensis Lamk quality-control product.
Fig. 6 present invention identifies the result of Aguilaria malaccensis Lamk using fluorescence quantitative PCR method.
The result figure of Fig. 7 PCR sequencing PCR identification buta-buta.
The result of Fig. 8 PCR sequencing PCR identification Yunnan agalloch eaglewood.
The result of Fig. 9 PCR sequencing PCR identification Aguilaria malaccensis Lamk.
Figure 10-1 present invention identifies 1 amplification of reaction tube of buta-buta using arms-PCR method.
Figure 10-2 present invention identifies 2 amplification of reaction tube of buta-buta using arms-PCR method.
Figure 10-3 present invention identifies 3 amplification of reaction tube of buta-buta using arms-PCR method.
Figure 11-1 present invention identifies 1 amplification of reaction tube of Yunnan agalloch eaglewood using arms-qPCR method
Figure 11-2 present invention identifies 2 amplification of reaction tube of Yunnan agalloch eaglewood using arms-qPCR method
Figure 11-3 present invention identifies 3 amplification of reaction tube of Yunnan agalloch eaglewood using arms-qPCR method
Figure 12-1 present invention identifies 1 amplification of reaction tube of Aguilaria malaccensis Lamk using arms-PCR method
Figure 12-2 present invention identifies 2 amplification of reaction tube of Aguilaria malaccensis Lamk using arms-PCR method
Figure 12-3 present invention identifies 3 amplification of reaction tube of Aguilaria malaccensis Lamk using arms-PCR method
Figure 13 buta-buta, Yunnan agalloch eaglewood, Aguilaria malaccensis Lamk alignment figure.
Specific embodiment
Present invention will be further explained below with reference to specific examples.But therefore do not limit the present invention to the tool
In body embodiment.Unaccounted condition and method in embodiment, usually routinely use method according to fields experimenter: example
Such as, the molecular cloning experiment handbooks such as Sambrook (NewYork:Cold Spring Harbor Laboratory Press,
1989) the operating technology regulation described in, or according to experiment condition proposed by manufacturer.
Embodiment 1 is used to identify the acquisition of buta-buta, Yunnan agalloch eaglewood, Aguilaria malaccensis Lamk SNP marker
5.8,18 and 28SrRNA gene on rDNA has great conservative, i.e., there is extensive xenogenesis homologys.
And since the area ITS is added without mature ribosomes, so the natural selection pressure that ITS segment is born during evolution is very small,
Therefore it can tolerate more variations.Extremely wide sequence polymorphism is shown in most of eucaryote, even if
It is that very close 2 kinds of affiliation can show difference in ITS sequence, shows nearest Evolution.This spy
It puts between the Molecular Identification for making ITS be suitable for species and the interior species of category or the obvious Phylogenetic Relationships of intraspecies variation is analyzed.
Due to the sequence analysis of ITS can substantially reflect belong between, the base pair difference of inter-species, furthermore ITS sequence segment is smaller, easy
In analysis, it has been widely used in the systematic growth research between different inter-species or approximate category at present.
1, the ITS gene according to disclosed in ncbi database designs corresponding primer and carries out PCR amplification, using upstream primer
F1:5 '-CGTAACAAGGTTTTCGTAGGTGAAC-3 ' (SEQ ID NO.4), downstream primer R1:5 '-
GCTACGTTCTTCATCGAT-3 ' (SEQ ID NO.5) and following PCR reaction system and PCR response procedures, through Zhejiang Province
Buta-buta (Aquilaria sinensis (Lour.) Spreng.), the Aguilaria malaccensis Lamk (Aquilaria of entry and exit identification
) and 3 agalloch eaglewood species genomes of Yunnan agalloch eaglewood (Aquilaria yunnanensis S. C.Huang) malaccensis
DNA is template, carries out PCR amplification, and amplified production is detected through 1.5% agarose gel electrophoresis and seen in ultraviolet gel imaging system
It is sequenced after examining qualification.
Wherein, Vazyme AceTaq DNA enzymatic (article No. p401-d1 250U)
Plant genome DNA is traditionally extracted, commercialization DNA extraction kit can also be used and carry out DNA extraction.
For example, the extraction of the agalloch eaglewood species genomic DNA steps the plant genome DNA of Biological Co., Ltd. using Hangzhou hundred
Extracts kit (KoningTM xylem genome DNA extracting reagent kit, article No. F2612), illustrates to be grasped referring to kit
Make, the DNA of extraction is placed at -20 DEG C and is saved backup.
2, the exploitation of sequence alignment and the species specific molecular labeling of object
The ITS gene order for 3 agalloch eaglewood species that step 1 is obtained carries out sequence alignment by DNAMAN software and seeks
Look for suitable SNP site.Sequence alignment result is as shown in figure 13, finds to be located at the intragenic sequence (SEQ of agalloch eaglewood ITS through analysis
ID NO.1, SEQ ID NO.2 or SEQ ID NO.3) 81-84 bit base there is specificity, the i.e. sequence between species
81-84 bit base be the sequence in specific position, if 81-84 bit base be TGCC if be accredited as buta-buta, if
81-84 bit base is that CGCT is then accredited as Yunnan agalloch eaglewood, is accredited as Aguilaria malaccensis Lamk if 81-84 bit base is CGCC.
Has the buta-buta sequence (SEQ ID NO.1) of the SNP site
GGGTAGTCTTGTCGATTCTTGCACAGCAGCATGACCCGTGAACGTTAATAA
CCCTTGTGGCCGTCATAACCAAACCCCGGCGCGGACTGCGCCAAGGAACT
TGATCACATAATACGTTTGCCTCGTGCACCCAGAAATGGGGGCGGTGGGGA
TCAAGCGTTGAAACGAATCTAAAATGACTCCCGGCAACGGATATCTCGGCT CTCGCATCGATAAG
Has the Yunnan agalloch eaglewood sequence (SEQ ID NO.2) of the SNP site
TCTTAGTCTTGTCGATTCCTGCACAGCAGCATGACCCGTGAACGTTAATAAC
CCTTGTGGCCGTCATAACCAAACCCCGGCGCGGACTGCGCCAAGGAACTT
GATCACATAATATGTTTGCCCCGTGCACCCAGAAATGGGGGCGTTGGGGAT
CAAGCGTTGAAACGAATCTAAAATGACTCCCGGCAACGGATATCTCGGCTC TCGCATCGATGACAACGTAGCAA
Has the Aguilaria malaccensis Lamk sequence (SEQ ID NO.3) of the SNP site
AAGGATCATTGTCGATTCCTGCACAGCAGCACGACCCGTGAACGTTAATAA
CCCTTGCGGCCGTCATAACCAAACCCCGGCGCGGACTGCGCCAAGGAACT
TGATCACATAATACGTCTGCCCCGCGCACCCAGAAATGGGGGCGCCGGGGA
TCAAGCGTTGAAATGAATCTAAAATGACTCCCGGCAACGGATATCTCGGCT CTTGCATCGATG
2 agalloch eaglewood SNP marker of embodiment is in fluorescent PCR amplification identification buta-buta, Yunnan agalloch eaglewood, Aguilaria malaccensis Lamk
Using
The present embodiment is on the basis of obtaining buta-buta, Yunnan agalloch eaglewood, Aguilaria malaccensis Lamk SNP site, for comprising described
The gene order of SNP site, using PrimerPremier5.0 separately design out specific forward primer F2, downstream primer R2 and
Probe P2, primer and probe are synthesized by Suzhou Jin Weizhi Biotechnology Co., Ltd.Utilize the specific primer and probe pair
Buta-buta sample, Aguilaria malaccensis Lamk sample and Yunnan agalloch eaglewood sample carry out fluorescent PCR augmentation detection.Specifically, the upstream primer
The sequence of F2, downstream primer R2 and probe P2 are respectively:
Upstream primer F2:5'-CCGTGAACGTTAATAACAATGTGC-3'(SEQ ID NO.6)
Downstream primer R2:5'-ATCAAGTTCCTTGGCGCAGTC-3'(SEQ ID NO.7)
Probe 2-1:5'-GTGTCGTTATGCCCATTCCCTCCT-3'(SEQ ID NO.8)
Probe 2-2:5'-GTGTCGTTACGCTCCATTCCCTCCT-3'(SEQ ID NO.9)
Probe 2-3:5'-GTGTCGTTACGCCCATTCCCTCCT-3'(SEQ ID NO.10)
The fluorophor at the end probe 5' is selected from FAM, T HEX, TET etc., the quenching group at the end 3': BHQ1, TAMRA etc..Example
Such as have the probe of fluorophor and quenching group are as follows:
Probe 2-1:5'-FAM-GTGTCGTTATGCCCATTCCCTCCT-BHQ1-3'
Probe 2-2:5'-HEX-GTGTCGTTACGCTCCATTCCCTCCT-BHQ1-3'
Probe 2-3:5'-ROX-GTGTCGTTACGCCCATTCCCTCCT-BHQ1-3'
Using 3 agalloch eaglewood species genomic DNAs template, include: in 20 μ LPCR reaction systems
Fluorescence PCR program:
The following steps are included: 1) extract the genomic DNA to measuring plants；2) using the genomic DNA to measuring plants as mould
Plate utilizes primer and probe, PCR amplification agalloch eaglewood ITS gene；Buta-buta, Yunnan agalloch eaglewood and Aguilaria malaccensis Lamk are increased separately simultaneously
Quality-control product control；3) pcr amplification product is detected using fluorescent PCR method, amplification curve has the S type curve of standard, when FAM access has
Amplification curve and Ct≤36 are then buta-buta when other accesses are without amplified signal；When HEX access has amplification curve and Ct≤36,
It is then Yunnan agalloch eaglewood when other accesses are without amplified signal；When ROX access has amplification curve and Ct≤36, other accesses are without amplification
It is then Aguilaria malaccensis Lamk when signal.
Buta-buta, Aguilaria malaccensis Lamk and the Yunnan agalloch eaglewood sample that the present embodiment 2 uses be also through existing method identification it is different with
Another group of sample of embodiment 1, under testing result shown in Fig. 2 to 6, the amplification of buta-buta are as follows: FAM access has amplification bent
Line and Ct≤36 (as shown in Figure 2), other accesses are without amplified signal；The amplification of Yunnan agalloch eaglewood are as follows: HEX access has amplification bent
Line and Ct≤36 (as shown in Figure 4), other accesses are without amplified signal；The amplification of Aguilaria malaccensis Lamk are as follows: ROX access has amplification bent
Line and Ct≤36 (as shown in Figure 6), other accesses are without amplified signal.This shows of the invention for agalloch eaglewood ITS gene SNP site
Which with high specificity, therefore can be used for Rapid identification to go out being the object in buta-buta, Yunnan agalloch eaglewood and Aguilaria malaccensis Lamk
Kind.
It is heavy to buta-buta, Yunnan agalloch eaglewood and the Malaysia in the present embodiment 2 using primer described in embodiment 1 and sequencing approach
It is fragrant.Sample is identified that qualification result is as shown in Fig. 7 to 9.Sequencing result is that buta-buta 81-84 bit base is TGCC, cloud
South incense 81-84 bit base is CGCT, and Aguilaria malaccensis Lamk 81-84 bit base is CGCC.
3 agalloch eaglewood SNP marker of embodiment answering in arms-qPCR method identification buta-buta, Yunnan agalloch eaglewood, Aguilaria malaccensis Lamk
With
The present embodiment is on the basis of obtaining buta-buta, Yunnan agalloch eaglewood, Aguilaria malaccensis Lamk SNP site, for comprising described
The gene order of SNP site separately designs out specific forward primer, downstream primer, primer using PrimerPremier5.0
It is synthesized with probe by Suzhou Jin Weizhi Biotechnology Co., Ltd.Using the specific primer and probe to buta-buta sample,
Aguilaria malaccensis Lamk sample and Yunnan agalloch eaglewood sample carry out fluorescent PCR augmentation detection.Specifically, the upstream primer sequence, downstream are drawn
Object sequence and probe sequence P are respectively:
Buta-buta specific primer:
Upstream primer T1:5'-GATGCGCGCTATGATTGAAC-3'(SEQ ID NO.11)
Downstream primer T2:5'-CGGTGTATGCCATGATGCA-3'(SEQ ID NO.12)
Yunnan agalloch eaglewood specific primer:
Upstream primer Y1:5'-GATGCGCGCTATGATTGTGT-3'(SEQ ID NO.13)
Downstream primer Y2:5'-CGGTGTATGCCATGATGCG-3'(SEQ ID NO.14)
Aguilaria malaccensis Lamk specific primer
Upstream primer M1:5'-GATGCGCGCTATGATTGTAT-3'(SEQ ID NO.15)
Downstream primer M2:5'-CGGTGTATGCCATGATGCG-3'(SEQ ID NO.16)
Probe sequence P:5'-FAM-AGGGCATGATGCACATGATGCT-BHQ1-3'(SEQ ID NO.17)
Using 3 agalloch eaglewood species genomic DNAs template, each species carry out 3 reactions, and system difference is as follows:
Arms-PCR response procedures:
The following steps are included: 1) extract the genomic DNA to measuring plants；2) using the genomic DNA to measuring plants as mould
Plate utilizes primer and probe, PCR amplification buta-buta ITS gene；3) pcr amplification product is detected using arms-PCR method, each
Sample carries out above three reaction (1~reaction tube of reaction tube 3) respectively.When reaction tube 1 has a standard S type amplification curve, and Ct≤
36, and reaction tube 2 and reaction tube 3 without amplified signal when, then be buta-buta；When reaction tube 2 has standard S type amplification curve, and
Ct≤36, and reaction tube 1 and reaction tube 3 without amplified signal when, then be Yunnan agalloch eaglewood；When reaction tube 3 has the amplification of standard S type bent
Line, and Ct≤36, and reaction tube 1 and reaction tube 2 without amplified signal when, then be Aguilaria malaccensis Lamk；
Buta-buta, Aguilaria malaccensis Lamk and the Yunnan agalloch eaglewood sample that the present embodiment 2 uses be also through existing method identification it is different with
Another group of sample of embodiment 1, shown in testing result following figure 10.1-12.3, the amplification of buta-buta are as follows: reaction tube 1 has mark
Quasi- S type amplification curve, and Ct≤36, and reaction tube 2 and reaction tube 3 are without amplified signal；The amplification of Yunnan agalloch eaglewood are as follows: anti-
Should pipe 2 have standard S type amplification curve, and Ct≤36, and reaction tube 1 and reaction tube 3 are without amplified signal；The amplification of Aguilaria malaccensis Lamk
As a result are as follows: reaction tube 3 has standard S type amplification curve, and Ct≤36, and reaction tube 1 and reaction tube 2 are without amplified signal.This table
Bright of the invention be directed to buta-buta, Yunnan agalloch eaglewood and Aguilaria malaccensis Lamk ITS gene SNP site have high specificity, therefore can
To be used for Rapid identification buta-buta, Yunnan agalloch eaglewood and Aguilaria malaccensis Lamk.
| Zhejiang Province's entry and exit qualification result | Qualification result of the present invention | PCR sequencing PCR result |
| Buta-buta | Buta-buta (see .1~10.3 Figure 10) | TGCC (see Fig. 7) |
| Yunnan agalloch eaglewood | Yunnan agalloch eaglewood (see .1~11.3 Figure 11) | CGCT (see Fig. 8) |
| Aguilaria malaccensis Lamk | Aguilaria malaccensis Lamk (see .1~12.3 Figure 12) | CGCC (see Fig. 9) |
Listed reaction system in the embodiment of the present application, response procedures and detecting step etc. are a kind of specific embodiment party
Formula, those skilled in the art can also be according to actual needs to reaction systems, and response procedures etc. carry out the adjustment of adaptability.
Sequence table
<110>Hangzhou hundred steps Biological Co., Ltd.
<120>SNP marker and application of buta-buta, Yunnan agalloch eaglewood, Aguilaria malaccensis Lamk
<130> 201705
<150> 2017108141124
<151> 2017-09-11
<160> 17
<170> SIPOSequenceListing 1.0
<210> 1
<211> 269
<212> DNA
<213>buta-buta (Aquilaria sinensis)
<400> 1
gggtagtctt gtcgattctt gcacagcagc atgacccgtg aacgttaata acaatgtgcc 60
gagttggaat tgtgtcgtta tgccccattc cctcttcggt tggcccttgt ggccgtcata 120
accaaacccc ggcgcggact gcgccaagga acttgatcac ataatacgtt tgcctcgtgc 180
acccagaaat gggggcggtg gggatcaagc gttgaaacga atctaaaatg actcccggca 240
acggatatct cggctctcgc atcgataag 269
<210> 2
<211> 279
<212> DNA
<213>Yunnan agalloch eaglewood (Aquilaria yunnanensis)
<400> 2
tcttagtctt gtcgattcct gcacagcagc atgacccgtg aacgttaata acaatgtgcc 60
gagttggaat tgtgtcgtta cgctccattc cctcctcggt tggcccttgt ggccgtcata 120
accaaacccc ggcgcggact gcgccaagga acttgatcac ataatatgtt tgccccgtgc 180
acccagaaat gggggcgttg gggatcaagc gttgaaacga atctaaaatg actcccggca 240
acggatatct cggctctcgc atcgatgaca acgtagcaa 279
<210> 3
<211> 267
<212> DNA
<213>Aguilaria malaccensis Lamk (Aquilaria malaccensis)
<400> 3
aaggatcatt gtcgattcct gcacagcagc acgacccgtg aacgttaata acaatgtgcc 60
gagttggaat tgtgtcgtta cgccccattc cctcttcggt tggcccttgc ggccgtcata 120
accaaacccc ggcgcggact gcgccaagga acttgatcac ataatacgtc tgccccgcgc 180
acccagaaat gggggcgccg gggatcaagc gttgaaatga atctaaaatg actcccggca 240
acggatatct cggctcttgc atcgatg 267
<210> 4
<211> 25
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 4
cgtaacaagg ttttcgtagg tgaac 25
<210> 5
<211> 18
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 5
gctacgttct tcatcgat 18
<210> 6
<211> 24
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 6
ccgtgaacgt taataacaat gtgc 24
<210> 7
<211> 21
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 7
atcaagttcc ttggcgcagt c 21
<210> 8
<211> 24
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 8
gtgtcgttat gcccattccc tcct 24
<210> 9
<211> 25
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 9
gtgtcgttac gctccattcc ctcct 25
<210> 10
<211> 24
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 10
gtgtcgttac gcccattccc tcct 24
<210> 11
<211> 20
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 11
gatgcgcgct atgattgaac 20
<210> 12
<211> 19
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 12
cggtgtatgc catgatgca 19
<210> 13
<211> 20
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 13
gatgcgcgct atgattgtgt 20
<210> 14
<211> 19
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 14
cggtgtatgc catgatgcg 19
<210> 15
<211> 20
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 15
gatgcgcgct atgattgtat 20
<210> 16
<211> 19
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 16
cggtgtatgc catgatgcg 19
<210> 17
<211> 22
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 17
agggcatgat gcacatgatg ct 22
Claims (10)
1. for identifying the SNP marker of buta-buta, Yunnan agalloch eaglewood, Aguilaria malaccensis Lamk, which is characterized in that the SNP molecule mark
The 81-84 bit base that note is located at sequence shown in SEQ ID NO.1, SEQ ID NO.2 or SEQ ID NO.3 is that TGCC is then identified
For buta-buta, it is accredited as Yunnan agalloch eaglewood if 81-84 bit base is CGCT, if 81-84 bit base is that CGCC is accredited as
Aguilaria malaccensis Lamk.
2. application of the SNP marker described in claim 1 in buta-buta, Yunnan agalloch eaglewood, Aguilaria malaccensis Lamk identification.
3. application according to claim 2, which is characterized in that from buta-buta, Yunnan agalloch eaglewood, Aguilaria malaccensis Lamk mixing species
Buta-buta, Yunnan agalloch eaglewood, Aguilaria malaccensis Lamk are identified respectively.
4. for identifying the oligonucleotides of buta-buta, Yunnan agalloch eaglewood, Aguilaria malaccensis Lamk, which is characterized in that the nucleotide includes SEQ
ID NO.1, SEQ ID NO.2 or SEQ ID NO.3 or SEQ ID NO.1, SEQ ID NO.2 or SEQ ID NO.3 institute are right
The cDNA or mRNA answered, the 81-84 bit base of the nucleotide sequence is that TGCC is then buta-buta, if 81-84 bit base
Then it is Yunnan agalloch eaglewood for CGCT, is Aguilaria malaccensis Lamk if being CGCC if 81-84 bit base.
5. a kind of kit for identifying buta-buta, Yunnan agalloch eaglewood, Aguilaria malaccensis Lamk, which is characterized in that including being used for specific detection
SEQ ID NO.1, SEQ ID NO.2 or SEQ ID NO.3 sequence 81-84 bit base are TGCC's or CGCT or CGCC
The combination of one or more primers or primer and probe.
6. kit according to claim 5, which is characterized in that the primer and/or probe are selected from: for detection to be sequenced
Specificity amplification primer and sequencing primer, primer sequence is respectively as follows:
Upstream primer F1:5'-CGTAACAAGGTTTTCGTAGGTGAAC-3'
Downstream primer R1:5'-GCTACGTTCTTCATCGAT-3'
Sequencing primer: 5'-CGTAACAAGGTTTTCGTAGGTGAAC-3'；
Alternatively, being used for the specific amplification amplimer and probe of fluorescence quantitative PCR detection, primer and probe sequence is respectively as follows:
Upstream primer F2:5'-CCGTGAACGTTAATAACAATGTGC-3'
Downstream primer R2:5'-ATCAAGTTCCTTGGCGCAGTC-3'
Probe 2-1:5'-FAM-GTGTCGTTATGCCCATTCCCTCCT-BHQ1-3'
Probe 2-2:5'-HEX-GTGTCGTTACGCTCCATTCCCTCCT-BHQ1-3'
Probe 2-3:5'-ROX-GTGTCGTTACGCCCATTCCCTCCT-BHQ1-3'；
Alternatively, the specificity amplification primer for ARMS-PCR amplification, primer sequence are as follows:
Buta-buta specific primer:
Upstream primer T1:5'-GATGCGCGCTATGATTGAAC-3'
Downstream primer T2:5'-CGGTGTATGCCATGATGCA-3'
Yunnan agalloch eaglewood specific primer:
Upstream primer Y1:5'-GATGCGCGCTATGATTGTGT-3'
Downstream primer Y2:5'-CGGTGTATGCCATGATGCG-3'
Aguilaria malaccensis Lamk specific primer
Upstream primer M1:5'-GATGCGCGCTATGATTGTAT-3'
Downstream primer M2:5'-CGGTGTATGCCATGATGCG-3'.
7. a kind of method for preparing identification buta-buta, Yunnan agalloch eaglewood, Aguilaria malaccensis Lamk kit, including preparation detection reaction reagent
Step, which is characterized in that the reaction reagent includes to be used for specific detection SEQ ID NO.1, SEQ ID NO.2 or SEQ ID
NO.3 sequence 81-84 bit base is one or more primers of TGCC or CGCT or CGCC or the group of primer and probe
It closes.
8. for identifying the oligonucleotides of buta-buta, Yunnan agalloch eaglewood, Aguilaria malaccensis Lamk, which is characterized in that the oligonucleotides is used for
Specific detection SEQ ID NO.1, SEQ ID NO.2 or SEQ ID NO.3 sequence 81-84 bit base are TGCC or CGCT
Or one or more primers of CGCC, the oligonucleotides is selected to be drawn for the specificity amplification primer sequence of sequencing and sequencing
Object sequence, respectively
Upstream primer F1:5'-CGTAACAAGGTTTTCGTAGGTGAAC-3'
Downstream primer R1:5'-GCTACGTTCTTCATCGAT-3'
Sequencing primer: 5'-CGTAACAAGGTTTTCGTAGGTGAAC-3'；
Alternatively, for fluorescent quantitative PCR specific forward primer F2 sequence, downstream primer R2 sequence and probe P2 sequence point
Not are as follows:
Upstream primer F2:5'-CCGTGAACGTTAATAACAATGTGC-3'
Downstream primer R2:5'-ATCAAGTTCCTTGGCGCAGTC-3'
Probe 2-1:5'-FAM-GTGTCGTTATGCCCATTCCCTCCT-BHQ1-3'
Probe 2-2:5'-HEX-GTGTCGTTACGCTCCATTCCCTCCT-BHQ1-3'
Probe 2-3:5'-ROX-GTGTCGTTACGCCCATTCCCTCCT-BHQ1-3'；
Alternatively, the specific forward primer sequence and downstream primer sequence of progress ARMS-PCR amplification are respectively as follows:
Buta-buta specific primer:
Upstream primer T1:5'-GATGCGCGCTATGATTGAAC-3'
Downstream primer T2:5'-CGGTGTATGCCATGATGCA-3'
Yunnan agalloch eaglewood specific primer:
Upstream primer Y1:5'-GATGCGCGCTATGATTGTGT-3'
Downstream primer Y2:5'-CGGTGTATGCCATGATGCG-3'
Aguilaria malaccensis Lamk specific primer
Upstream primer M1:5'-GATGCGCGCTATGATTGTAT-3'
Downstream primer M2:5'-CGGTGTATGCCATGATGCG-3'.
9. a kind of method for identifying buta-buta, Yunnan agalloch eaglewood, Aguilaria malaccensis Lamk, comprising the following steps:
(1) genomic DNA to measuring plants is extracted；
(2) genomic DNA extracted using step (1) carries out PCR amplification as template, detects SEQ ID NO.1, SEQ ID NO.2
Or SEQ ID NO.3 sequence 81-84 bit base；
(3) through detecting, it is accredited as buta-buta if 81-84 bit base is TGCC, if 81-84 bit base is that CGCT is identified
For Yunnan agalloch eaglewood, Aguilaria malaccensis Lamk is accredited as if 81-84 bit base is CGCC.
10. according to the method described in claim 9, it is characterized in that, primer needed for PCR amplification or probe are selected from claim
8。
Applications Claiming Priority (2)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201710814112 | 2017-09-11 | ||
| CN2017108141124 | 2017-09-11 |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN109486983A true CN109486983A (en) | 2019-03-19 |
Family
ID=65688568
Family Applications (2)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201711397665.0A Pending CN109486978A (en) | 2017-09-11 | 2017-12-22 | Buta-buta, Yunnan agalloch eaglewood, Aguilaria malaccensis Lamk SNP marker and its application |
| CN201711398258.1A Pending CN109486983A (en) | 2017-09-11 | 2017-12-22 | Buta-buta, Yunnan agalloch eaglewood, Aguilaria malaccensis Lamk SNP marker and application |
Family Applications Before (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201711397665.0A Pending CN109486978A (en) | 2017-09-11 | 2017-12-22 | Buta-buta, Yunnan agalloch eaglewood, Aguilaria malaccensis Lamk SNP marker and its application |
Country Status (1)
| Country | Link |
|---|---|
| CN (2) | CN109486978A (en) |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN111254211A (en) * | 2020-02-28 | 2020-06-09 | 广东药科大学 | Aquilaria plant identification method based on ITS sequence and machine learning |
Families Citing this family (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN113061662B (en) * | 2021-04-21 | 2024-06-25 | 澳门科技大学 | DNA bar code and reagent for identifying agilawood, and detection method and application thereof |
| CN117230246B (en) * | 2023-11-15 | 2024-04-02 | 中国林业科学研究院热带林业研究所 | Core SNP marker for identifying agilawood easy to form and application |
Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US20110160152A1 (en) * | 2009-12-29 | 2011-06-30 | Taipei Medical University | Extracts of aquilaria hulls and use thereof in the treatment of cancer |
| CN105087566A (en) * | 2015-08-21 | 2015-11-25 | 浙江出入境检验检疫局检验检疫技术中心 | Fluorescent quantitative PCR (polymerase chain reaction) method for identifying aquilaria sinensis, primer, probe and application of fluorescent quantitative PCR method |
| CN105112410A (en) * | 2015-08-21 | 2015-12-02 | 浙江出入境检验检疫局检验检疫技术中心 | Gene detection primer, probe and method for identifying Aquilaria malaccensis |
Family Cites Families (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN105132540B (en) * | 2015-08-21 | 2019-02-01 | 浙江出入境检验检疫局检验检疫技术中心 | The double PCR identification method of suspension culture of Aquilaria sinensis, primer and probe |
-
2017
- 2017-12-22 CN CN201711397665.0A patent/CN109486978A/en active Pending
- 2017-12-22 CN CN201711398258.1A patent/CN109486983A/en active Pending
Patent Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US20110160152A1 (en) * | 2009-12-29 | 2011-06-30 | Taipei Medical University | Extracts of aquilaria hulls and use thereof in the treatment of cancer |
| CN105087566A (en) * | 2015-08-21 | 2015-11-25 | 浙江出入境检验检疫局检验检疫技术中心 | Fluorescent quantitative PCR (polymerase chain reaction) method for identifying aquilaria sinensis, primer, probe and application of fluorescent quantitative PCR method |
| CN105112410A (en) * | 2015-08-21 | 2015-12-02 | 浙江出入境检验检疫局检验检疫技术中心 | Gene detection primer, probe and method for identifying Aquilaria malaccensis |
Non-Patent Citations (7)
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN111254211A (en) * | 2020-02-28 | 2020-06-09 | 广东药科大学 | Aquilaria plant identification method based on ITS sequence and machine learning |
Also Published As
| Publication number | Publication date |
|---|---|
| CN109486978A (en) | 2019-03-19 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN104911256B (en) | A kind of Radix Angelicae Sinensis SCAR molecular labelings and its authentication method and specific primer pair | |
| CN109486979A (en) | For identifying the SNP marker and application of Xizang Taxus chinensis | |
| CN109486983A (en) | Buta-buta, Yunnan agalloch eaglewood, Aguilaria malaccensis Lamk SNP marker and application | |
| CN107164556A (en) | It is a kind of to be used to identify bulbus fritillariae cirrhosae and fluorescent PCR detecting primer, probe compositions, kit and the detection method of adulterant and application | |
| CN104017859A (en) | Method for identifying sugarcane germplasm resources based on SSR (Simple Sequence Repeats) and CE (capillary electrophoresis) technique | |
| CN104293778A (en) | Establishing method of cymbidium microsatellite labels, core fingerprint label database and kit | |
| CN108642208A (en) | A kind of Cinnamomum and its general SSR molecular marker of relative genus plant and its development approach and application | |
| CN113151567B (en) | SSR molecular marker and method for identifying Lepista sordida N006# strain | |
| CN102191309A (en) | Bupleurum DNA (deoxyribonucleic acid) identifying kit and identifying method | |
| CN105063028A (en) | SSR (simple sequence repeat) primer group and method for constructing malt fingerprint maps by aid of primer group | |
| Sun et al. | Database and primer selections affect nematode community composition under different vegetations of Changbai Mountain | |
| CN102559878B (en) | Composite amplification system and detection kit of mouse short tandem repeat | |
| AU2020102481A4 (en) | Method for Preparing Molecular ID Cards of Apple Germplasm Resource | |
| CN107164525B (en) | A kind of DNA for differentiating 6 kinds of Pterocarpus timber combines bar code and its discrimination method and application | |
| CN105112410B (en) | For genetic test primer, probe and the method for Aguilaria malaccensis Lamk identification | |
| CN102719543B (en) | Method for identifying plant varieties by utilizing chemical molecular formulas of nucleotides | |
| CN104673790A (en) | Molecular-specificity labeling primer for oil-tea good-variety longlin 18 and identification method | |
| CN110878376A (en) | SSR molecular marker primer for identifying dendrobium huoshanense and application thereof | |
| CN103290107A (en) | Construction method of SSR fingerprint suitable for identification of rice hybrid authenticity | |
| CN109666758A (en) | Genuine rhizome of chuanxiong identification primer and identification method based on InDel label | |
| CN102358911A (en) | Method for improving purity identification efficiency of hybrid seeds | |
| CN105002166A (en) | Molecular standard sample of brown cockroaches and preparation method of molecular standard sample | |
| CN105087566A (en) | Fluorescent quantitative PCR (polymerase chain reaction) method for identifying aquilaria sinensis, primer, probe and application of fluorescent quantitative PCR method | |
| CN104087665A (en) | Universal primer for detecting aspergillus flavus and aspergillus fumigatus and real-time fluorescence tHDA (Thermophilic Helicase Dependent Amplification) kit | |
| CN112680542B (en) | Universal SSR molecular marker primer composition for orchidaceae plants and application of universal SSR molecular marker primer composition |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination |