CN102358911A - Method for improving purity identification efficiency of hybrid seeds - Google Patents
Method for improving purity identification efficiency of hybrid seeds Download PDFInfo
- Publication number
- CN102358911A CN102358911A CN2011103521524A CN201110352152A CN102358911A CN 102358911 A CN102358911 A CN 102358911A CN 2011103521524 A CN2011103521524 A CN 2011103521524A CN 201110352152 A CN201110352152 A CN 201110352152A CN 102358911 A CN102358911 A CN 102358911A
- Authority
- CN
- China
- Prior art keywords
- snp
- seed
- gene frequency
- site
- purity
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Images
Abstract
The invention discloses a method for improving purity identification efficiency of hybrid seeds. The method comprises the following steps of: extracting DNA from three full seeds with uniform size or other tissue samples, and calculating allelic frequency for polymerase chain reaction (PCR) amplification and pyrosequencing SNP/InDel site detection and a purity conversion data model in a tested sample as follows: allelic frequency conversion of the SNP site: Y=-15.427X+111.44, shown as a figure 1; and allelic frequency conversion of the InDel site: Y=-15.141X+109.33, shown as a figure 2. By the method for detecting the purity of the hybrid seeds by combining a pyrosequencing technology and an SNP/InDel technology, the identification efficiency can be improved by 3 times, the detection cost is effectively reduced, and the detection time is shortened; and the method has good market application prospect.
Description
Technical field
The invention belongs to the seed purity inspection technology field of agricultural; Being specifically related to improve based on SNP mark (SNP/InDel)-tetra-sodium sequencing technologies and detecting the method that purity of hybrid is identified efficient, is that a kind of pooling quantity based on DNA pond (DNA pooling) technology is confirmed and the application of data somatotype on the cross-fertilize seed seed purity is identified.
Background technology
The method that seed purity is identified has technology such as field test morphology mark, isoenzyme mark, RAPD mark, SSR mark, but above labeling technique can not be satisfied the demand at aspects such as operability, stability, polymorphums.SNP (single nucleotide polymorphism; SNP); Be meant on genomic level to have the density height by the caused dna sequence polymorphism of the variation of single Nucleotide, genetic stability is good, be prone to advantage such as automated analysis; Become the genetics labeling technique of new generation after the SSR mark, be widely used in crop marker assisted selection and cultivar identification in recent years.(2010) such as Jin-kee Jung utilize Allele Specific PCR (AS-PCR) from conserved ortholog set II (COSII) markers, to filter out 40 capsicum SNP sites; 79 in 81 commodity seeds can be distinguished, 17 paprikes can be identified; The SNP mark is excavated from the public est database of muskmelon in (2009) such as Wim Deleu, identifies to obtain 45 SNP sites, has enriched muskmelon genovariation collection of illustrative plates, and the SNP mark is used for the melon variety evaluation.
Tetra-sodium sequencing technologies (Pyrosequencing) is the technical tool of new generation that is applied to dna sequence analysis.In genetic analysis, can provide the molecular detection technology of nucleic acid sequence information to be " golden standard ", its authority is hybridized than other DNA analysis methods such as Northern, and gene chip and real-time quantitative PCR (Taqman probe) technology is better.Its principle is: under the synergy of archaeal dna polymerase, ATP sulfurylase, luciferase and 4 kinds of enzymes of apyrase; Each dNTP polymerization and first order fluorescence signal on the primer are discharged coupling to get up; Through detecting the release and the intensity of fluorescence, reach the purpose of The real time measure dna sequence dna.This technology is used to measure the short dna chain-ordering, is present unique technology that can obtain quantitative sequence results in real time, has the susceptibility of round pcr and the accuracy of sequencing technologies concurrently, has the accuracy height, good reproducibility, and level of automation is high, characteristics simple to operate.
Tetra-sodium sequencing technologies platform can carry out somatotype and gene frequency is analyzed to target SNP/InDel mark.
DNA pool technology (DNA pooling) is meant and mixes the DNA of a plurality of samples by a certain percentage; Carry out subsequent experimental analysis (Sham et a1. such as pcr amplification, genescan, gene type; 2002) sample size thousand samples from several to several of, forming the DNA pond do not wait.The DNA pool technology combines methods such as DHPLC, Sanger order-checking to be used for researchs such as SNP site, gene frequency analysis, gene linkage more.The DNA pool technology improves research efficient not reducing to detect under the prerequisite of effectiveness, shorten research cycle, saves reasearch funds, has been widely used in the gene studies work such as medical science, animal, plant at present.
Summary of the invention
The objective of the invention is to disclose a kind of method of identifying efficient based on the raising cross-fertilize seed seed purity of DNA pool technology (DNA pooling).Through the data reduction analysis, obtain seed purity, improve purity of hybrid and identify 3 times of efficient.
For realizing above-mentioned purpose, the present invention provides following technical scheme:
A kind of method that improves cross-fertilize seed seed purity evaluation efficient is characterized in that 3 even, full seed or other tissue samples of size are carried out DNA extraction, is used for the gene frequency analysis that the order-checking of pcr amplification and tetra-sodium detects the SNP/InDel site; Wherein the method for calculation of gene frequency and test sample book moderate purity conversion data model are following:
SNP site gene frequency converts: Y=-15.427X+111.44, as shown in Figure 1;
InDel site gene frequency converts: Y=-15.141X+109.33, as shown in Figure 2;
Wherein the Y value is a gene frequency percentage ratio, and the X value is a cross-fertilize seed proportion in the test sample book.
Method of the present invention is characterized in that being undertaken by following step:
(1) sample pre-treatment: if be the seed sample, get 3 seeds that size is even, full, be ground to pulverizing, fully mixing is got 100-200mg and is carried out DNA extraction; If be the leaf tissue sample, get 3 strain same area blades, stack is placed, and uses the punch tool that is fit to size to beat and gets 3 blade-sections that wait size, and the homogenate mixing carries out DNA extraction;
(2) SNP/InDel site gene frequency is measured and is converted: carry out pcr amplification to crop SNP/InDel site, increase required primer shown in sequence table NO1-NO8; The tetra-sodium order-checking detects, and under the AQ pattern, obtains the gene frequency of this SNP/InDel site different genotype; Judge the cross-fertilize seed quantity in the 3 strain test sample books, and then be converted into seed purity.
Pcr amplification primer and tetra-sodium sequencing primer use PSQ Assay Designsoftware to design according to this crop SNP/InDel site in the method for the present invention.
The present invention confirms the cross-fertilize seed seed purity through the examination cross-fertilize seed carries out sample pre-treatments, SNP/InDel site gene frequency is measured conversion to supplying.
Supply examination cross-fertilize seed pre-treating process to be: every kind is got big or small even, full seed (30 strain plant; Get same position blade), per 3 seeds are (per 3 strain blades stack together, beat with punch tool and get the homalographic blade) together; Dna sample is extracted in low temperature pulverizing/grinding down.The DNA extraction method is undertaken by the commercial reagent box.
Supply examination cross-fertilize seed SNP/InDel site gene frequency mensuration conversion method to be:
To crop SNP/InDel site, design pcr amplification primer and tetra-sodium sequencing primer; Carry out pcr amplification, the order-checking of (increasing required primer shown in sequence table NO1-NO8) and tetra-sodium, sequencing result is analyzed through the AQ pattern, obtains the gene frequency of test sample book; Calculate the purity of 3 plant through the data reduction data model:
Y=-15.427X+111.44 are suitable for SNP site gene frequency and convert
Y=-15.141X+109.33 are suitable for InDel site gene frequency and convert
Wherein the Y value is a gene frequency percentage ratio, and the X value is a cross-fertilize seed proportion in the test sample book.
For measuring method of the present invention can more clearly be described, do with detailed explanation in the face of TP of the present invention down.
1, principle
Through DNA pool technology (DNA pooling) with 3 sample equivalent uniform mixing; Detect SNP/InDel site gene frequency through DNA extraction, pcr amplification and tetra-sodium order-checking; It is linear to pollute seed amount from female parent in gene frequency and 3 samples; Through data reduction, can draw cross-fertilize seed quantity in 3 samples.
2, the selection in SNP/InDel site
Being suitable for the SNP/InDel site that purity of hybrid identifies is male parent, maternal different at this site somatotype, and F1 is on behalf of male parent, hybridization of female parent somatotype.For example:
The SNP male parent is A, and female parent is T, and cross-fertilize seed F1 is on behalf of A/T
The InDel male parent is CC, and female parent is-(CC disappearance) that cross-fertilize seed F1 is on behalf of CC/--
Pcr amplification primer and tetra-sodium sequencing primer use PSQ Assay Designsoftware to design according to this crop SNP/InDel site in the method for the present invention.
3, supply the test agent pre-treatment
Seed supplies test agent: every kind get size evenly, full seed, per 3 seeds together, low temperature pulverizings/grinding down, extraction dna sample.
Plant supplies test agent: every kind is chosen the average plant of growing way, gets same position blade, and per 3 strain blades stack together, beats with punch tool and gets the homalographic blade, and dna sample is extracted in low temperature pulverizing/grinding down.
The DNA extraction method is undertaken by the commercial reagent box.
4, supplying examination cross-fertilize seed SNP/InDel site gene frequency to measure converts
To being used for the SNP/InDel site that crop hybrid kind purity is identified, design pcr amplification primer and tetra-sodium sequencing primer; Through pcr amplification and tetra-sodium order-checking, sequencing result is analyzed through the AQ pattern, obtains the gene frequency of test sample book; Calculate the quantity of cross-fertilize seed in 3 plant through the data reduction data model:
Be suitable for SNP site gene frequency convert (Fig. 1) Y=-15.427X+111.44;
Be suitable for InDel site gene frequency convert (Fig. 2) Y=-15.141X+109.33;
Wherein the Y value is a gene frequency percentage ratio, and the X value is a cross-fertilize seed proportion in the test sample book.
A kind of positively effect that the cross-fertilize seed seed purity identifies that the method for efficient is compared with prior art had that improves disclosed by the invention:
(1) improve detection efficiency: detection method originally is that the simple grain individual plant extracts DNA, PCR and tetra-sodium order-checking, uses the present invention's technology, can raise the efficiency 3 times;
(2) reduce the detection cost.
Description of drawings:
Fig. 1 is a SNP site gene frequency conversion chart; Wherein Y=-15.427X+111.44; The Y value is a gene frequency percentage ratio, and the X value is a cross-fertilize seed proportion in the test sample book;
Fig. 2 is that InDel site gene frequency converts; Wherein Y=-15.141X+109.33Y value is a gene frequency percentage ratio, the X value is a cross-fertilize seed proportion in the test sample book.
Embodiment:
Below in conjunction with embodiment the present invention is described; The scheme of embodiment described here; Do not limit the present invention; One of skill in the art can make improvements and change according to spirit of the present invention, and described these improvement and variation all should be regarded as within the scope of the invention, and scope of the present invention and essence are limited claim.Use therein biological crusher is bought in RECHI, is model M400.
Embodiment 1:
DNA pooling technology is used for the purity of cucumber hybrid seed Rapid identification
(1) supplying the examination cucumber variety is that Hybrid Tianjin is excellent 38, belongs to the Viola grypoceras A. Gray kind, Tianjin, the place of production.
(2) being used for the InDel site that purity identifies is the TT/--site, this site in Tianjin excellent 38 parent materials be respectively TT/TT (TT insertion) and--/--(TT disappearance) is TT/--in first familiar generation.
PCR primer and tetra-sodium sequencing primer design synthetic according to the site
PCR primer (F1/R1) and tetra-sodium sequencing primer (S1) see the following form:
| Id | Sequence | Bp | Tm, °C | %GC |
| F1 | ACTATCATTCTTTATCCCCATCA（NO1） | 24 bp | 65.8 | 33.3% |
| R1 | Biotin-ATACAAAAATGCACAT（NO2） | 23 bp | 67.8 | 34.8% |
| S1 | ACTATCATTCTTTATCCCCATCA（NO3） | 24 bp | 65.8 | 33.3% |
(3) supply the test agent pre-treatment
From seed packet, get size evenly, 30 of full seeds, per 3 seeds together, totally 10 duplicate samples are used pulverizing sample biological crusher low temperature under, extract 10 parts of dna samples.
The DNA extraction method is undertaken by the commercial reagent box.
(4) supplying examination cross-fertilize seed InDel site gene frequency to measure converts
To being used for the InDel site that excellent 38 purity in Tianjin are identified, design pcr amplification primer and tetra-sodium sequencing primer; Get above-mentioned 10 parts of dna samples, through pcr amplification reaction and tetra-sodium sequencing reaction (Qiagen company), sequencing result is analyzed through gene frequency (AQ) pattern, obtains 10 increments gene frequency originally, and the result does
I%45.9?44.3 46.6 44.5 45.3 44.0 45.9 46.3 58.2 41.7
Calculate the quantity of cross-fertilize seed in 3 seeds through Fig. 2 data model:
Y=-15.141X+109.33 are suitable for InDel site gene frequency and convert
Wherein the Y value is a gene frequency percentage ratio, and the X value is a cross-fertilize seed proportion in the test sample book.The result is:
F1 F1 F1 F1 F1 F1 F1 F1 I1 F1
The result shows, in the 9th increment basis, contains 1--/--seed of (TT disappearance) type, pollute from the parent.
In 30 seeds, has 1 non-cross-fertilize seed, so the purity of this experimental cultivar is 96.7%.
Embodiment 2
DNA pooling technology is used for hybrid rice seed seed purity Rapid identification
(1) rice varieties that supplies to try the water is assorted No. 1 of Hybrid Tianjin round-grained rice, Tianjin, the place of production.
(2) being used for the SNP site that purity identifies is the T/C site, and assorted No. 1 parent material of round-grained rice is respectively T/T (TT is pure and mild) and C/C (CC is pure and mild) in Tianjin in this site, is T/C in first familiar generation.PCR primer and tetra-sodium sequencing primer design synthetic according to the site.
PCR primer (F1/R1) and tetra-sodium sequencing primer (S1) see the following form
| Id | Sequence | Bp | Tm,°C | %GC |
| F1 | GGGAGGATATCAATGGGAGCTAC（NO4） | 23 | 70.9 | 52.2 |
| R1 | Biotin-GCACATACCGCAGAAACCAGA（NO5） | 21 | 72.3 | 52.4 |
| S1 | GCATGAAGTATTGATCAGC（NO6） | 19 | 53.4 | 42.1 |
(3) supply the test agent pre-treatment:
From seed packet, get size evenly, 30 of full seeds, per 3 seeds together with the 2mL centrifuge tube in, totally 10 duplicate samples are used pulverizing sample biological crusher low temperature under, extract 10 parts of dna samples.
The DNA extraction method is undertaken by the commercial reagent box.
(4) supplying examination cross-fertilize seed SNP site gene frequency to measure converts
To being used for the SNP site that round-grained rice assorted No. 1 purity in Tianjin is identified, design pcr amplification primer and tetra-sodium sequencing primer; Get above-mentioned 10 parts of dna samples, through pcr amplification reaction and tetra-sodium sequencing reaction (Qiagen company), sequencing result is analyzed through gene frequency (AQ) pattern, obtains 10 increments gene frequency originally, and the result does
T%44.4?42.9 43.9 37.5 47.5 49.0 49.5 52.5 51.0 50.5
Calculate the quantity of cross-fertilize seed in 3 seeds through Fig. 1 data model:
Y=-15.427X+111.44 are suitable for SNP site gene frequency and convert
Wherein the Y value is a gene frequency percentage ratio, and the X value is a cross-fertilize seed proportion in the test sample book.The result is:
F1 F1 F1 C1 F1 F1 F1 F1 F1 F1
The result shows, in the 4th increment basis, contains the seed of 1 C/C (CC is pure and mild) type, pollutes from the parent.
In 30 seeds, has 1 non-cross-fertilize seed, so the purity of this experimental cultivar is 96.7%.
Embodiment 3
DNA pooling technology is used for corn hybrid seed seed purity Rapid identification
(1) rice varieties that supplies to try the water is a Hybrid scape color glutinous 918.
(2) being used for the SNP site that purity identifies is the A/G site, and this site is respectively A/A (AA is pure and mild) and G/G (GG is pure and mild) at color glutinous 918 parent materials of scape, is A/G in first familiar generation.PCR primer and tetra-sodium sequencing primer design synthetic according to the site.
PCR primer (F1/R1) and tetra-sodium sequencing primer (S1) see the following form:
| Id | Sequence | Bp | Tm, °C | %GC |
| F1 | Biotin-GACCTGACCATCTTTGCTCATT（NO7） | 23 | 72.0 | 47.8 |
| R1 | TCGGGAGATTGGATCCGT（NO8） | 18 | 70.4 | 55.6 |
| S1 | TTGATCTCATCCCCG（NO9） | 15 | 53.2 | 53.3 |
(3) supply the test agent pre-treatment
From seed packet, get size evenly, 30 of full seeds, per 3 seeds together with the 2mL centrifuge tube in, totally 10 duplicate samples are used pulverizing sample biological crusher low temperature under, extract 10 parts of dna samples.
The DNA extraction method is undertaken by the commercial reagent box.
(4) supplying examination cross-fertilize seed SNP site gene frequency to measure converts
To being used for the SNP site that color glutinous 918 purity of scape are identified, design pcr amplification primer and tetra-sodium sequencing primer; Get above-mentioned 10 parts of dna samples, through pcr amplification reaction and tetra-sodium sequencing reaction (Qiagen company), sequencing result is analyzed through gene frequency (AQ) pattern, obtains 10 increments gene frequency originally, and the result is:
A%?50.0 48.4 50.7 49.0 53.4 54.4 50.0 48.4 50.7 49.0
Calculate the quantity of cross-fertilize seed in 3 seeds through Fig. 1 data model:
Y=-15.427X+111.44; Being suitable for SNP site gene frequency converts
Wherein the Y value is a gene frequency percentage ratio, and the X value is a cross-fertilize seed proportion in the test sample book.The result is:
F1 F1 F1 F1 F1 F1 F1 F1 F1 F1
The result shows, cross-fertilize seed nothing but in 30 seeds is so the purity of this experimental cultivar is 100%.
SEQUENCE?LISTING
< 110>Centralab Tianjin Academy of Agriculture Science
< 120>a kind of method that improves cross-fertilize seed seed purity evaluation efficient
<160> 9
<170> PatentIn?version?3.5
<210> 1
<211> 24
<212> DNA
< 213>gene order
<400> 1
actatcattc?tttatcccca?tcat 24
<210> 2
<211> 16
<212> DNA
< 213>gene order
<400> 2
atacaaaaat?gcacat 16
<210> 3
<211> 24
<212> DNA
< 213>gene order
<400> 3
actatcattc?tttatcccca?tcat 24
<210> 4
<211> 23
<212> DNA
< 213>gold and silver sequence
<400> 4
gggaggatat?caatgggagc?tac 23
<210> 5
<211> 21
<212> DNA
< 213>gene order
<400> 5
gcacataccg?cagaaaccag?a 21
<210> 6
<211> 19
<212> DNA
< 213>gene order
<400> 6
gcatgaagta?ttgatcagc 19
<210> 7
<211> 23
<212> DNA
< 213>gene order
<400> 7
gacctgacca?tctttgctca?ttg 23
<210> 8
<211> 18
<212> DNA
< 213>gene order
<400> 8
tcgggagatt?ggatccgt 18
<210> 9
<211> 15
<212> DNA
< 213>gene order
<400> 9
ttgatctcat?ccccg 15
Claims (2)
1. one kind is improved the method that the cross-fertilize seed seed purity is identified efficient; It is characterized in that 3 even, full seed or other tissue samples of size are carried out DNA extraction, be used for the gene frequency analysis that the order-checking of pcr amplification and tetra-sodium detects the SNP/InDel site; Wherein the method for calculation of gene frequency and test sample book moderate purity conversion data model are following:
SNP site gene frequency converts: Y=-15.427X+111.44, as shown in Figure 1;
InDel site gene frequency converts: Y=-15.141X+109.33, as shown in Figure 2;
Wherein the Y value is a gene frequency percentage ratio, and the X value is a cross-fertilize seed proportion in the test sample book.
2. the described method of claim 1 is characterized in that being undertaken by following step:
(1) sample pre-treatment: if be the seed sample, get 3 seeds that size is even, full, be ground to pulverizing, fully mixing is got 100-200mg and is carried out DNA extraction; If be the leaf tissue sample, get 3 strain same area blades, stack is placed, and uses the punch tool that is fit to size to beat and gets 3 blade-sections that wait size, and the homogenate mixing carries out DNA extraction;
(2) SNP/InDel site gene frequency is measured and is converted: carry out pcr amplification to crop SNP/InDel site, increase required primer shown in sequence table NO1-NO8; The tetra-sodium order-checking detects, and under the AQ pattern, obtains the gene frequency of this SNP/InDel site different genotype; Judge the cross-fertilize seed quantity in the 3 strain test sample books, and then be converted into seed purity.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN2011103521524A CN102358911A (en) | 2011-11-09 | 2011-11-09 | Method for improving purity identification efficiency of hybrid seeds |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN2011103521524A CN102358911A (en) | 2011-11-09 | 2011-11-09 | Method for improving purity identification efficiency of hybrid seeds |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN102358911A true CN102358911A (en) | 2012-02-22 |
Family
ID=45584287
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN2011103521524A Pending CN102358911A (en) | 2011-11-09 | 2011-11-09 | Method for improving purity identification efficiency of hybrid seeds |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN102358911A (en) |
Cited By (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN111549173A (en) * | 2020-06-16 | 2020-08-18 | 江苏绿港现代农业发展有限公司 | Indel marker and method for purity identification of cucumber hybrid seeds |
| CN113408945A (en) * | 2021-07-15 | 2021-09-17 | 广西中烟工业有限责任公司 | Method and device for detecting purity of flue-cured tobacco, electronic equipment and storage medium |
| CN117737296A (en) * | 2024-02-21 | 2024-03-22 | 北京康普森生物技术有限公司 | SNP marker for identifying purity of Qingzao 510 maize hybrid and application thereof |
-
2011
- 2011-11-09 CN CN2011103521524A patent/CN102358911A/en active Pending
Cited By (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN111549173A (en) * | 2020-06-16 | 2020-08-18 | 江苏绿港现代农业发展有限公司 | Indel marker and method for purity identification of cucumber hybrid seeds |
| CN111549173B (en) * | 2020-06-16 | 2022-03-15 | 江苏绿港现代农业发展股份有限公司 | Indel labeled primer pair and method for identifying purity of cucumber Lumei No.1 hybrid seeds |
| CN113408945A (en) * | 2021-07-15 | 2021-09-17 | 广西中烟工业有限责任公司 | Method and device for detecting purity of flue-cured tobacco, electronic equipment and storage medium |
| CN117737296A (en) * | 2024-02-21 | 2024-03-22 | 北京康普森生物技术有限公司 | SNP marker for identifying purity of Qingzao 510 maize hybrid and application thereof |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN109554503B (en) | Molecular marker for early sex identification of actinidia arguta seedlings and application of molecular marker | |
| KR101331740B1 (en) | SSR primer derived from Paeonia lactiflora and use thereof | |
| CN109609686B (en) | Molecular marker for early sex identification of actinidia arguta seedlings and application of molecular marker | |
| CN103710455A (en) | Method for obtaining oligonucleotide probe | |
| CN113584216B (en) | Development and application of KASP marker of wheat grain weight gene TaCYP78A16 | |
| CN102417924B (en) | Method for identifying purity of cucumber hybrids based on high-resolution melting curve | |
| KR101642702B1 (en) | A method for identifying pear varieties using microsatellites markers | |
| CN101928766B (en) | Method for fast appraising purity of cucumber hybrid seed | |
| CN103882147A (en) | Genome random amplified fragment SNP and methylation method | |
| CN103146831B (en) | Method for identifying rice and dry rice | |
| CN102358911A (en) | Method for improving purity identification efficiency of hybrid seeds | |
| CN110878376B (en) | SSR molecular marker primer for identifying dendrobium huoshanense and application thereof | |
| CN102312015B (en) | Real-time fluorescent quantitative PCR method for detecting parasitic Xanthomonas albilineans in sugarcane | |
| CN112725510B (en) | SNP (Single nucleotide polymorphism) marker, primer set, kit and application for rice variety indica-japonica identification | |
| CN108165652A (en) | For the specific molecular marker TGMI001 of Chinese torreya seedling stage sex identification | |
| KR102335806B1 (en) | Molecular marker based on chloroplast genome sequence for discriminating Zizyphus jujuba 'SanJo' cultivar and uses thereof | |
| CN103589797A (en) | SNP (single nucleotide polymorphism) genotyping method and application thereof | |
| CN104830857A (en) | Primer, probe and method for specific quantitative PCR accurate detection of genetically modified corn MON88017 strain | |
| KR102380784B1 (en) | Molecular marker for discriminating genetic resources of Peucedanum japonicum and uses thereof | |
| KR20160146034A (en) | A method for identifying blueberry varieties using microsatellites markers | |
| CN110923355A (en) | Linkage KASP molecular marker for rice high temperature resistance character and application thereof | |
| KR102451456B1 (en) | Primer set for discriminating genetic polymorphism of Codonopsis lanceolata and uses thereof | |
| KR20150117326A (en) | SSR primer derived from apple and use thereof | |
| KR100991219B1 (en) | Marker for discrimination of Panax ginseng and Panax quinquefolius, primer for amplifying the marker, and uses thereof | |
| CN108130378A (en) | A kind of and the relevant SNP marker of Peach fruits sweet tea acid flavor character and its application |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C02 | Deemed withdrawal of patent application after publication (patent law 2001) | ||
| WD01 | Invention patent application deemed withdrawn after publication |
Application publication date: 20120222 |