CN106755515A - A kind of method of Rapid identification Roscoea intermedia and Holothuria scabra - Google Patents
A kind of method of Rapid identification Roscoea intermedia and Holothuria scabra Download PDFInfo
- Publication number
- CN106755515A CN106755515A CN201710072796.5A CN201710072796A CN106755515A CN 106755515 A CN106755515 A CN 106755515A CN 201710072796 A CN201710072796 A CN 201710072796A CN 106755515 A CN106755515 A CN 106755515A
- Authority
- CN
- China
- Prior art keywords
- dna
- roscoea
- intermedia
- bar code
- sequence
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6869—Methods for sequencing
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Organic Chemistry (AREA)
- Zoology (AREA)
- Analytical Chemistry (AREA)
- Wood Science & Technology (AREA)
- Health & Medical Sciences (AREA)
- Engineering & Computer Science (AREA)
- Microbiology (AREA)
- Immunology (AREA)
- Molecular Biology (AREA)
- Biotechnology (AREA)
- Biophysics (AREA)
- Physics & Mathematics (AREA)
- Biochemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention discloses the DNA bar code method for identifying molecules and its CO I sequence of two kinds of sea cucumbers (Roscoea intermedia Holothuria fuscopunctata and Holothuria scabra Holothuria scabra), enter performing PCR using the method and amplify sea cucumber CO I genes, PCR primer is after agarose gel is verified, it is sequenced, sequencing result is compared with open sequence, if with the homology of gene order SEQ ID NO.1 more than 99%, you can judge that described test serum is Roscoea intermedia source；If with the homology of gene order SEQ ID NO.2 more than 99%, you can judge that described test serum is Holothuria scabra.The present invention uses reliable DNA molecular identification technology, has fast and accurately distinguished Roscoea intermedia and Holothuria scabra kind, enhances accuracy and reliability, it is ensured that the security that sea cucumber is used as medicine as medicinal material.
Description
Technical field
The present invention relates to species identification field, and in particular to 2 kinds of DNA bar code molecules of sea cucumber (Roscoea intermedia, Holothuria scabra)
Authentication method.
Background technology
Sea cucumber is the general name of Echinodermata (Echinodermata) Holothuroidea (Holothrioider) animal, is tradition
Extra large sample food and drug resource, with antitumor, reducing blood lipid, promote hematopoiesis function, enhance immunity, various lifes such as anticoagulation
Thing effect.Different sea cucumber kind price variances are larger, but many sea cucumber economic specieses lack during trade and clearly plant
Class is identified.Roscoea intermedia (Holothuria fuscopunctata) generally grows 6~30cm, and 0.8~10cm wide, all surfaces are greyish white
Or yellow-white, shrinkage or tool band, the horizontal shrinkage having is in yellow or sepia compared with plutonic groove-like, at ditch.Back of the body middle part color and luster
Relatively deep, both sides are shallower, and the outside of belly then gradually becomes white；Often there is an obvious longitudinal furrow along outside of belly Central Line, the outside of belly has crowd
Many grey black point-like parapodums.Its osteocomma is generally button, separately there is a small amount of table-like body, perforated plate and rhabodoid etc..Holothuria scabra
(Holothuria scabra) body 30-40cm long, 8-10cm wide.Mouth is small, relatively the outside of belly, has small shape tentacle 20.Anus end
, around there are 5 groups of thin warts position.Back side parapodum is small, and number is few；Outside of belly pipe is in enough parapodum shape, less and sparse.The back side and the outside of belly
Intersection often has a line edge veutro wart.Often there is an obvious longitudinal furrow along outside of belly Central Line, after processing, this bar ditch is still very bright
It is aobvious.Body wall is thick, and osteocomma enriches, including table and button.At present, traditional Morphological Identification method is highly susceptible to thing
Plant the influence of this factors such as environment, heredity in growth course；And form is seriously damaged during Processing methods
Or feature disappears.Therefore, identify that sea cucumber kind becomes extremely difficult with traditional morphological method, urgent need sets up other rows
Effective method Rapid identification is carried out to market sea cucumber kind.
DNA bar code technology (DNA Barcoding) refer to can be represented in organism the species, standard, have foot
It is enough variations, easy to expand and relatively short DNA fragmentation.No. 1 gene (COI) of Mitochondrial cytochrome c oxidase is mitochondria
The encoding gene of the preceding paragraph protein, because its variability is big, easily amplification is animal DNA Barcoding the most frequently used at present.Grind
Study carefully the classification and identification for showing that DNA bar code can be widely applied to biology, be a kind of easy, efficient, accurate species identification
Technology, can not only make up the defect of conventional identification method, also because it is more objective, accurate, break through the dependence to previous experiences, can
Identification species, discovery novel species and hidden kind, reconstruction species etc..With DNA bar code technology, can be very good to enter the kind of sea cucumber
Row is fast and effectively identified.
A kind of method that the present invention provides Rapid identification Roscoea intermedia and Holothuria scabra, is advantageously implemented Roscoea intermedia with Holothuria scabra
Quick and precisely identify, shorten qualification time.
The content of the invention
The present invention overcomes the defect for existing in Morphological Identification sea cucumber method at present, improves Roscoea intermedia and identifies knot with Holothuria scabra
The degree of accuracy of fruit, is a kind of easily operated, sensitivity authentication method high.Technical scheme is as follows：
STb gene is extracted from the various sea cucumbers of collection first, entering performing PCR using pair of primers expands one section of COI genetic fragment,
Amplified production is sequenced, sequence analysis comparison is then carried out, the sequence criteria database of various sea cucumbers is set up, in relatively database
It is quick so as to reach by the product result of analysis PCR under given conditions on the basis of DNA, accurately
Identify the purpose of Roscoea intermedia.Sea cucumber sample to needing identification, extracts its STb gene, under given conditions, special with what is designed
Primer enters performing PCR amplification, and pcr amplification product result is determined by agarose gel electrophoresis, is then sequenced, can according to sequence alignment
To identify Roscoea intermedia and Holothuria scabra.The method for identifying molecules for differentiating Roscoea intermedia and Holothuria scabra of present invention design, uses
Following steps：
1st, extract sea cucumber STb gene carries out DNA extractions by marine animal DNA extraction kit, and with the deionized water for sterilizing
The DNA concentration of sample is diluted to 50ng/ μ l.
2nd, amplification of DNA fragments, carries out PCR, i.e., expanded with special primer, and primer pair sequence is
COIef2：5’-ATGATAGGAGCCCCAGAC-3’；
COIer2：5’-TGGTTTACGCAATGGTAG-3’；
Amplification program is 94 DEG C of 94 DEG C of predegeneration 2 minute predegenerations 30 seconds, and 48 DEG C are annealed 35 seconds, and 72 DEG C extend 45 seconds, 35
Individual circulation；72 DEG C extend 7 minutes.
3rd, PCR primer is entered into row agarose gel electrophoresis analysis, PCR fragment size is detected using DNA marker.
4th, the judgement of qualification result：If there is the band of obvious clearly 580bp sizes, and without miscellaneous band, then can send biology
Company is sequenced.
5th, sequencing result is carried out into manual check and correction, sequence assembly, if with the gene order SEQ ID NO.1 homologys
More than 99%, you can judge that described test serum is Roscoea intermedia；If same with the gene order SEQ ID NO.2
Source property is more than 99%, you can judge that described test serum is Holothuria scabra.
Wherein, described sea cucumber DNA bar code method for identifying molecules uses Tiangeng marine animal DNA extracts reagents
Box.
The primer：
Forward primer is COIef2：5’-ATGATAGGAGCCCCAGAC-3’；
Reverse primer is COIer2：5’-TGGTTTACGCAATGGTAG-3’
The archaeal dna polymerase for being used is TAKARA Taq enzymes.
Described electrophoresis is the agarose gel electrophoresis of 1%-2%.
Described stripe size needs to be detected with DNA maker.
Described DNA sequence dna splicing software includes CodonCode Aligner, Sequencher, Genious, DNA
The softwares such as star.
Compared with traditional Morphological Identification method, the gene order that the present invention is obtained is advantageously implemented Roscoea intermedia with rough sea
The Molecular Identification of ginseng.
Brief description of the drawings
Fig. 1 agarose gel electrophoresis, is the electrophoresis detection collection of illustrative plates that sea cucumber is expanded with COI primers, and wherein swimming lane M is DNA
Marker, swimming lane N1 are negative control, and swimming lane M1~M3 is to be followed successively by sample M1, M2, M3.
Specific embodiment
With reference to specific embodiment, the present invention will be further described：
Embodiment 1：
1st, the collection of sea cucumber sample：M1- Roscoea intermedia dry products；M2- Holothuria scabra dry products；M3- Stochastic Markets collect sea cucumber sample
2nd, the pre-treatment of test specimen：The first step, sea cucumber alcohol is first preserved alcohol displacement and the dried sea-cucumber sample in sample
Product leaching hair, PBS (137mmol/L NaCl, 2.7mmol/L KCl, 10mmol/L Na2HPO4,2mmol/L are using solution
KH2PO4, pH 7.2) second step, the sample that 50-80mg is processed through upper step is taken, in 800-1000 μ l high-salt buffers
Cut in (200mmol/L Tris-HCl, 50mmol/L EDTA, 500mmol/L NaCl, 0.2% beta -mercaptoethanol, pH 8.0)
Broken sample, 10000-12000g/min centrifugation 1-2min, abandons supernatant；Repeat 2 times.65 DEG C of Proteinase K warm bath 1 hour,
It is completely dissolved to tissue.Add isometric chloroform：Isoamyl alcohol (24: 1) is mixed, and 15,000 × g room temperatures are centrifuged 10 minutes, careful to inhale
In taking supernatant to new 1.5mL EP pipes.
3rd, prepared by DNA profiling：DNA extractions are carried out using the marine animal DNA extraction kit of Tiangeng biotech firm, is used in combination
The DNA concentration of sample is diluted to 50ng/ μ l by the deionized water of sterilizing.
4th, primer synthesis：The present embodiment the primer is as follows：
Forward primer COIef2：5’-ATGATAGGAGCCCCAGAC-3’；
Reverse primer COIer2：5’-TGGTTTACGCAATGGTAG-3’
5th, PCR expand the present embodiment PCR reaction systems it is as follows
PCR reaction systems are 50 μ l：
DdH2O 37.6uL, 10 × PCR Buffer 5uL, dNTP 4uL, Taq enzyme 0.4uL, forward primer/reverse primer
(10uM) each 1uL, DNA profiling 1uL (50ng)
Amplification program：It is 94 DEG C of 94 DEG C of predegeneration 2 minute predegenerations 30 seconds, 48 DEG C are annealed 35 seconds, 72 DEG C extend 45 seconds, 35
Individual circulation；72 DEG C extend 7 minutes.
6th, agarose electrophoresis checking PCR results agarose electrophoresis display M1, M2, M3 sample amplification is good, the clear nothing of band
Impurity, can directly send sequencing company to be sequenced.
7th, sequence is imported sequencing result sequence assembly sequencing result CodonCode Aligner biosoftwares, will
Primer shearing after by sequence assembling, then compare with SEQ ID NO.1, M1 with SEQ ID NO.1 homologies 100%,
It is Roscoea intermedia.M2 with SEQ ID NO.2 homologies 100%, be Holothuria scabra；M3 sequences and SEQ ID NO.1 and SEQ ID
The equal significant differences of NO.2, (network address https is carried out with NCBI websites：//www.ncbi.nlm.nih.gov/) it is spur ginseng.
Embodiment set forth in the present invention is not limitation of the invention, described in above-described embodiment and specification only
Be preference of the invention, any those skilled in the art according to conventional meanses it is contemplated that or fine setting changes and improvements,
Each fall within protection scope of the present invention.
Claims (10)
1. a kind of method of Rapid identification Roscoea intermedia and Holothuria scabra, it is characterised in that：
(1) identification Roscoea intermedia (Holothuria fuscopunctata) and Holothuria scabra (Holothuria scabra)；
(2) DNA bar code method for identifying molecules is used.
2. method according to claim 1 is DNA bar code method for identifying molecules, and its step mainly includes：
(1) the separation and Extraction STb gene from sea cucumber tissue to be measured；
(2) it is a pair of specific primers of template with the DNA, sea cucumber COI genes is gone out by PCR amplification；
(3) and then take the COI gene outcomes agarose electrophoresis that the PCR amplification of appropriate step (2) goes out and separate mirror
Determine amplified production size, product is sequenced；
(4) according to sequencing result, comparison is analyzed, if with the homology of gene order SEQ ID NO.1 more than 99%,
Can determine whether described test serum as Roscoea intermedia source；If with the homology of gene order SEQ ID NO.2 99%
More than, you can judge that described test serum is Holothuria scabra source.
3. DNA bar code method for identifying molecules according to claim 2, it is characterised in that the sequence of primed DNA is：
COIef2：5’-ATGATAGGAGCCCCAGAC-3’；
COIer2：5’-TGGTTTACGCAATGGTAG-3’.
4. DNA bar code method for identifying molecules according to claim 2, it is characterised in that the PCR
Amplification condition is 94 DEG C of 94 DEG C of predegeneration 2 minute predegenerations 30 seconds, and 48 DEG C are annealed 35 seconds, and 72 DEG C extend 45 seconds, 35 circulations；72
DEG C extend 7 minutes.
5. DNA bar code method for identifying molecules according to claim 2, it is characterised in that the amplified fragments of amplified production are
580bp, is detected with 1%-2% agarose electrophoresis.
6. DNA bar code method for identifying molecules according to claim 2, it is characterised in that the DNA bars of described sea cucumber
Shape code standard detection gene order is CO I genes, with gene order SEQ ID NO.1 as described below：
ATGATAGGAGCCCCAGACATGGCCTTCCCCCGGATGAAAAAAATGAGTTTCTGACTAGTTCCCCCTTCATTCA
TTCTTCTCCTAGCCTCAGCAGGCGTAGAAAGAGGAGCAGGCACAGGATGAACCATATACCCACCATTATCCAGAAAC
ATTGCCCATGCTGGAGGGTCTGTTGACTTAGCTATTTTCTCTCTACACTTAGCCGGAGCCTCATCCATTCTAGCTTC
TATAAACTTTATTACCACAATTATAAACATGCGGGCCCCAGGAATAACATTCGACCGTCTTCCTTTATTCGTATGAT
CAGTTTTCATCACAGCCTTCCTTCTCCTACTTAGGCTACCAGTTCTAGCAGGAGCCATAACAATGCTGCTAACAGAC
CGGAACATAAAAACAACATTTTTCGACCCCGCAGGAGGAGGAGACCCAATTCTATTCCAACATCTATTCTGATTCTT
TGGCCATCCAGAAGTTTACATCCTAATCCTCCCAGGATTCGGAATGATATCACATGTAATAGCTCACTACAGAGGCA
AGCAAGAGCCCTTTGGATATCTCGGAATGGTTTACGCAATGGTAG。
7. DNA bar code method for identifying molecules according to claim 2, it is characterised in that the DNA bars of described sea cucumber
Shape code standard detection gene order is CO I genes, with gene order SEQ ID NO.2 as described below：
ATGATAGGAGCCCCAGACATGGCCTTCCCACGCATGAAAAAAATGAGTTTCTGATTAGTCCCTCCCTCTTTTA
TTTTACTTCTTGCCTCAGCCGGAGTAGAAAGCGGTGTAGGAACAGGCTGAACAATCTATCCTCCCCTCTCCAGAAAC
ATAGCCCATGCAGGAGGTTCCGTTGACCTAGCCATTTTTTCACTTCACCTAGCAGGAGCTTCCTCAATCCTAGCCTC
CATAAATTTTATAACTACCATTATAAACATGCGAACCCCAGGAGTAACATTTGACCGTCTTCCACTATTTGTCTGAT
CCGTATTTATAACAGCCTTTCTTCTTTTGTTAAGACTTCCAGTATTAGCCGGAGCTATAACTATGCTATTAACAGAC
CGTAACATAAAAACAACGTTTTTTGACCCAGCAGGAGGAGGAGACCCTATTCTTTTTCAACACCTGTTCTGATTCTT
CGGACACCCAGAAGTTTATATCCTAATTCTTCCAGGATTCGGCATGATATCTCATGTAATTGCTCACTATAGAGGAA
AGCAAGAGCCTTTTGGGTATCTCGGAATGGTGTATGCCATGGTAG。
8. a kind of Roscoea intermedia DNA bar code standard detection sequence, it is characterised in that its sequence is CO I genes, sequence such as SEQ
Shown in ID NO.1：
ATGATAGGAGCCCCAGACATGGCCTTCCCCCGGATGAAAAAAATGAGTTTCTGACTAGTTCCCCCTTCATTCA
TTCTTCTCCTAGCCTCAGCAGGCGTAGAAAGAGGAGCAGGCACAGGATGAACCATATACCCACCATTATCCAGAAAC
ATTGCCCATGCTGGAGGGTCTGTTGACTTAGCTATTTTCTCTCTACACTTAGCCGGAGCCTCATCCATTCTAGCTTC
TATAAACTTTATTACCACAATTATAAACATGCGGGCCCCAGGAATAACATTCGACCGTCTTCCTTTATTCGTATGAT
CAGTTTTCATCACAGCCTTCCTTCTCCTACTTAGGCTACCAGTTCTAGCAGGAGCCATAACAATGCTGCTAACAGAC
CGGAACATAAAAACAACATTTTTCGACCCCGCAGGAGGAGGAGACCCAATTCTATTCCAACATCTATTCTGATTCTT
TGGCCATCCAGAAGTTTACATCCTAATCCTCCCAGGATTCGGAATGATATCACATGTAATAGCTCACTACAGAGGCA
AGCAAGAGCCCTTTGGATATCTCGGAATGGTTTACGCAATGGTAG。
9. a kind of Holothuria scabra DNA bar code standard detection sequence, it is characterised in that its sequence is CO I genes, sequence such as SEQ
Shown in ID NO.2：
ATGATAGGAGCCCCAGACATGGCCTTCCCACGCATGAAAAAAATGAGTTTCTGATTAGTCCCTCCCTCTTTTA
TTTTACTTCTTGCCTCAGCCGGAGTAGAAAGCGGTGTAGGAACAGGCTGAACAATCTATCCTCCCCTCTCCAGAAAC
ATAGCCCATGCAGGAGGTTCCGTTGACCTAGCCATTTTTTCACTTCACCTAGCAGGAGCTTCCTCAATCCTAGCCTC
CATAAATTTTATAACTACCATTATAAACATGCGAACCCCAGGAGTAACATTTGACCGTCTTCCACTATTTGTCTGAT
CCGTATTTATAACAGCCTTTCTTCTTTTGTTAAGACTTCCAGTATTAGCC
GGAGCTATAACTATGCTATTAACAGACCGTAACATAAAAACAACGTTTTTTGACCCAGCAGGAGGAGGAGACCCTAT
TCTTTTTCAACACCTGTTCTGATTCTTCGGACACCCAGAAGTTTATATCCTAATTCTTCCAGGATTCGGCATGATAT
CTCATGTAATTGCTCACTATAGAGGAAAGCAAGAGCCTTTTGGGTATCTCGGAATGGTGTATGCCATGGTAG。
10. Roscoea intermedia as claimed in claim 8 or the Holothuria scabra DNA bar code standard detection sequence described in claim 9 exist
Application in identification.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201710072796.5A CN106755515B (en) | 2017-02-10 | 2017-02-10 | Method for rapidly identifying ivory-involved holothuria scabra |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201710072796.5A CN106755515B (en) | 2017-02-10 | 2017-02-10 | Method for rapidly identifying ivory-involved holothuria scabra |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN106755515A true CN106755515A (en) | 2017-05-31 |
| CN106755515B CN106755515B (en) | 2020-06-19 |
Family
ID=58956830
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201710072796.5A Active CN106755515B (en) | 2017-02-10 | 2017-02-10 | Method for rapidly identifying ivory-involved holothuria scabra |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN106755515B (en) |
Cited By (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN107858407A (en) * | 2017-12-22 | 2018-03-30 | 大连深蓝肽科技研发有限公司 | A kind of PCR primer and its discrimination method for differentiating oligopeptide albumen |
| CN108018360A (en) * | 2017-12-15 | 2018-05-11 | 中国检验检疫科学研究院 | A kind of beche-de-mer species identification method based on DNA micro bar code technologies |
| CN111758562A (en) * | 2020-08-02 | 2020-10-13 | 西南林业大学 | Artificial pollination method for ivory plants |
| CN115029448A (en) * | 2022-06-10 | 2022-09-09 | 华南农业大学 | Holothuria scabra SSR marker and amplification primer, detection method and application thereof |
Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102912015A (en) * | 2012-09-25 | 2013-02-06 | 宁波大学 | Molecular marker and method for identifying excellent stichopus japonicus selenka variety |
-
2017
- 2017-02-10 CN CN201710072796.5A patent/CN106755515B/en active Active
Patent Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102912015A (en) * | 2012-09-25 | 2013-02-06 | 宁波大学 | Molecular marker and method for identifying excellent stichopus japonicus selenka variety |
Non-Patent Citations (1)
| Title |
|---|
| 陈丽梅等: "4种海参16S rRNA和COI基因片段序列比较及系统学研究", 《中国水产科学》 * |
Cited By (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN108018360A (en) * | 2017-12-15 | 2018-05-11 | 中国检验检疫科学研究院 | A kind of beche-de-mer species identification method based on DNA micro bar code technologies |
| CN107858407A (en) * | 2017-12-22 | 2018-03-30 | 大连深蓝肽科技研发有限公司 | A kind of PCR primer and its discrimination method for differentiating oligopeptide albumen |
| CN111758562A (en) * | 2020-08-02 | 2020-10-13 | 西南林业大学 | Artificial pollination method for ivory plants |
| CN115029448A (en) * | 2022-06-10 | 2022-09-09 | 华南农业大学 | Holothuria scabra SSR marker and amplification primer, detection method and application thereof |
Also Published As
| Publication number | Publication date |
|---|---|
| CN106755515B (en) | 2020-06-19 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN103898235B (en) | A kind of DNA bar code method for identifying molecules of Hirudo | |
| CN106755515A (en) | A kind of method of Rapid identification Roscoea intermedia and Holothuria scabra | |
| CN106086167B (en) | The primer sequence and method of a kind of Rapid identification Larimichthys crocea, little yellow croaker and Collichthys lucidus | |
| CN106636397B (en) | Primer combination for identifying three medicinal snakes and application thereof | |
| CN105385767B (en) | Primer and its identification method used in a kind of identification Eriocheir sinensis difference family | |
| CN105695620A (en) | Method for rapidly detecting Chinese caterpillar fungus | |
| CN106701989A (en) | DNA (Deoxyribonucleic Acid) barcode molecular identification method of holothuria fuscopunctata | |
| CN105177138B (en) | A kind of primer for detecting rubber tree powdery mildew, method and application | |
| CN109486978A (en) | Buta-buta, Yunnan agalloch eaglewood, Aguilaria malaccensis Lamk SNP marker and its application | |
| KR102283638B1 (en) | Random Amplified Polymorphic DNA primer for discrimination of tobacco cultivars | |
| CN105925676A (en) | Method for identifying salmon variety in salmon can | |
| CN106755520A (en) | A kind of red ganoderma identification of strains method | |
| KR101948389B1 (en) | Discriminating method of Codonopsis lanceolata and Adenophora triphylla using SSR marker | |
| CN104561270B (en) | The molecular biology differentiating method of two kinds of rice leaf folder larvas | |
| CN104962656A (en) | TaqMan probe primer mixture, kit and fluorescent quantitative PCR detection method for quickly identifying bungarus multicinctus blyth | |
| CN106811507A (en) | A kind of Phellinus rapid identification method | |
| CN105950776B (en) | A kind of flat mushroom strain mirror method for distinguishing and special DNA bar shaped chip segment | |
| CN107988395A (en) | For distinguishing primer pair, primer sets, kit and the method for yak and ox | |
| CN105969891B (en) | A kind of pleurotus eryngii quel strains mirror method for distinguishing and special DNA bar shaped chip segment | |
| KR102174274B1 (en) | Molecular marker for discriminating Zizyphus jujuba 'Boeun' and 'Chuseok' cultivar and uses thereof | |
| Stelate et al. | Resolving the phylogenetic relationship between Parmotrema crinitum and Parmotrema perlatum populations | |
| CN112795662A (en) | Identification method of barbel grahami and application thereof | |
| CN108018360B (en) | Edible sea cucumber species identification method based on DNA micro-bar code technology | |
| CN105838788A (en) | Real-time fluorescence PCR specific detection system and applications of Micromesistius poutassou | |
| KR101481723B1 (en) | Primer set for selecting korean ginseng k-1 and method for selecting k-1 using the same |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |