CN101921828B - High-throughput multi-LDR parting kit for detecting farmland ecological environment - Google Patents
High-throughput multi-LDR parting kit for detecting farmland ecological environment Download PDFInfo
- Publication number
- CN101921828B CN101921828B CN2010101021793A CN201010102179A CN101921828B CN 101921828 B CN101921828 B CN 101921828B CN 2010101021793 A CN2010101021793 A CN 2010101021793A CN 201010102179 A CN201010102179 A CN 201010102179A CN 101921828 B CN101921828 B CN 101921828B
- Authority
- CN
- China
- Prior art keywords
- ldr
- fam
- probe
- product length
- rice
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Expired - Fee Related
Links
Images
Landscapes
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention relates to a high-throughput multi-LDR parting kit for detecting farmland ecological environment, comprising mitochondria COI gene universal primers of 16 kinds of species in the farmland, specific probe sequences of the mitochondria COI gene universal primers of the 16 kinds of species in the farmland, and a reagent for PCR (polymerase chain reaction) proliferation and LDR (light dependent resistor) detection programs, wherein the mitochondria COI gene universal primers have the upstream of 5'-GGTCAACAAATCATAAAGATATTGG-3' and the downstream of 5'-taaacttcagggtgaccaaaaaatca-3'. In the invention, the kit effectively proliferates all target species sequences for the COI gene universal primers, and ensures that each target sequence and a low-copy template can be detected; the specific probe of each target species further ensures the specificity so as to totally distinguish each target sequence to realize multi-parting fixed quantity, thus the change of a farmland predation structure is known and the farmland ecological environment is maintained.
Description
Technical field
The invention belongs to the multi-LDR parting kit field, particularly a kind of high-throughput multi-LDR parting kit that detects farmland ecological environment.
Background technology
A plurality of species in field are to farmland ecosystem and important, and it can provide guidance for which nutrition relationship is in prior status, and the detection somatotype of a plurality of species in field is extremely important for the research ecosystem function.Some detection classifying methods have been set up at present both at home and abroad to a plurality of species in field; But these method ubiquities, and flux is little, operation easier is big, loaded down with trivial details; Weakness such as quantity of information is few are provided, have hindered research institution that a plurality of species in field are carried out effective scientific research and detection.The method of a plurality of species in existing detection field mainly is divided into two kinds, and the one, traditional analyzes its enteron aisle or movement, and the one, combining the ligase enzyme detection reaction with the polymerase chain reaction is high-throughput, the split hair caccuracy of major technique, the high-sensitivity analysis method.
Collect a plurality of species from the field and its enteron aisle or movement are analyzed; Its detection means is more tended to monoclonal antibody and dna technique from the enzyme spectrum analysis of initial radio-labeling, polyclonal antibody and species, detects target and also transfers to many species discriminatings from single species.But because of Monoclonal Antibody is extremely loaded down with trivial details, and target is unique is difficult to realize high throughput testing, so its application facet is had a greatly reduced quality in detecting a plurality of species in field.And dna technique becomes the novel pattern of vertebrates and the research of no vertebra food chain gradually after at first in the sea life predator chain, showing its feasibility in 1997.Dna molecular is as the direct carrier of genetic information; Do not receive the influence of environment, biological development stage and organ-tissue; Thereby can reflect the phylogenetic relationship between each species comparatively exactly, increase but conventional PCR method need design corresponding primer to each species, and the field species are of a great variety; The plant eater insect that can't use multiple PCR technique to monitor to reach tens of kinds is so limited its application.
Universal primer PCR combines LDR (ligase detection reaction) technology to be to use universal primer that the conserved regions of many species is increased; According to species specificity mononucleotide site between planting, make up the LDR species specific probe of different lengths, the high specific that utilizes the high temperature ligase enzyme detects the sequence difference of gene inside; Thereby has a high-throughput; Split hair caccuracy, characteristics such as highly sensitive are the very strong detection schemes of a kind of portability.Therefore COI gene on the plastosome is used to analyze biological heredity variety and sibship owing to have unique hereditary property.Because probe and primer have high susceptibility and specificity, make it detect somatotype to a plurality of species.
Summary of the invention
Technical problem to be solved by this invention provides a kind of high-throughput multi-LDR parting kit that detects farmland ecological environment, to overcome the field predation rule that common now parting kit can only disclose a small amount of prey, is difficult to realize the problem of high throughput testing.
A kind of high-throughput multi-LDR parting kit that detects farmland ecological environment of the present invention comprises:
(1) pcr amplification system
(1) the mitochondrial COI gene universal primer sequence of the 16 kinds of species in farmland:
The upper reaches: 5 '-GGTCAACAAATCATAAAGATATTGG-3 ';
Downstream: 5 '-TAAACTTCAGGGTGACCAAAAAATCA-3 ';
(2) pcr amplification system reagent
Upstream primer 0.5 μ M
Downstream primer 0.5 μ M
10×Buffer 1μl
dNTP 0.2mM
Mg
2+ 2.0mM
Taq?polymerase 0.1μl(0.5Unit)
H
2O moisturizing to 10 μ l;
(2) multi-LDR detection architecture
(1) the specific probe sequence of the mitochondrial COI gene of the 16 kinds of species in farmland:
Intend the water tarantula, the LDR probe:
F：TTTTTTTTTTTTTTTTTTTTTTTTTTTGGCTCCTGACATATCTTTTCCTCGAATAAATAATC；
R：P-TTTCTTTTTGGTTATTACCACCTTCTTTATTTTTATTTTTTTTTTTTTTTTTTTTTTTT-Fam；
Intend the water tarantula, product length 121bp
White backed planthopper, the LDR probe:
F：TTGGAGCACCTGATATAGCTTTCCCCCGAATAAAC；
R：P-AATATAAGATTTTGGTTACTTCCACCCTCCTTAAT-Fam；
White backed planthopper, product length 70bp
Pink rice borer, the LDR probe:
F：TTTTTTAGGAGCTATTAATTTTATTACAACAATTATC；
R:P-AATATACGACTAAATAATTTATCTTTTGATCAAATT-Fam; Pink rice borer, product length 73bp
Rice natural pond fly, the LDR probe:
F：TTTTTTCAGCTCTTTTACTACTTTTATCATTACCTGTTCTC；
R：P-GCTGGAGCCATTACTATGCTTCTTACGGATCGAAATTTTTT-Fam；
Rice natural pond fly, product length 82bp
Cnaphalocrocis medinali(rice leaf roller), the LDR probe:
F：TTTTTTTTCTATTATAATTGGAGGATTTGGAAATTGATTAGTG；
R：P-CCTTTAATATTAGGAGCCCCTGATATAGCTTTTCCTTTTTTT-Fam；
Cnaphalocrocis medinali(rice leaf roller), product length 85bp
The Cnaphalocrocis medinali(rice leaf roller) braconid wasp, the LDR probe:
F：TTTTTTTTTTGCCTTTATTATAATTTTTTTTATAGTTATACCAG；
R：P-TAATAATTGGAGGATTTGGAAATTGATTAATTCCATTTTTTTTT-Fam；
The Cnaphalocrocis medinali(rice leaf roller) braconid wasp, product length 88bp
The bar fly, the LDR probe:
F：TTTTTTTTTTTTTTGATTATTACCTCCTTCATTAACTTTATTAATG；
R：P-GCTAGAAGTATAGTAGAAAATGGAGCTGGAACTGGTTTTTTTTTT-Fam；
The bar fly, product length 91bp
Brown paddy plant hopper, the LDR probe:
F：TTTTTTTTTTTTCAGGATTTATAGGAACCATAAGTAGTATAATTATC；
R：P-CGATCAGAATTAACTCAACCAGGATCTCTAATTAATTTTTTTTTTTT-Fam；
Brown paddy plant hopper, product length 94bp
The black porch green plant bug, the LDR probe:
F：TTTTTTTTTTTTTTTATCACATAATGGAAGATCAGTAGATTTAGCAATC；
R：P-TTCTCACTTCACTTAGCTGGTATTTCATCAATTTTTTTTTTTTTTTTT-Fam；
The black porch green plant bug, product length 97bp
Rice green leafhopper, the LDR probe:
F：TTTTTTTTTTTTTTTTACTTTTAATAAGATCTATCATTGAAATAGGAGTG；
R：P-GGAACAGGTTGAACAGTATACCCCCCCCTTTCAAGTTTTTTTTTTTTTTT-Fam；
Rice green leafhopper, product length 100bp
Small brown rice planthopper, the LDR probe:
F：TTTTTTTTTTTTTTTTTTCGCTGGAGTTAGATCTATTATAGGAGCTATCAAC；
R：P-TTCATTTCTACAATTATTAATATACGATCAAAAAATTTTTTTTTTTTTTTT-Fam；
Small brown rice planthopper, product length 103bp
Midge, the LDR probe:
F：TTTTTTTTTTTTTTTTTTCTAGAAGTATAGTAGAAAATGGAGCAGGAACAGGG；
R：P-TGAACTGTTTATCCTCCACTTTCATCTGGAATTGCTTTTTTTTTTTTTTTTTT-Fam；
Midge, product length 106bp
Thrips, the LDR probe:
F：TTTTTTTTTTTTTTTTTTTTGATCGAAATTTGAACACTTCATTTTTTGATCCAAG；
R：P-AGGAGGAGGGGATCCAGTACTTTACCAACACTTATTTTTTTTTTTTTTTTTTTT-Fam；
Thrips, product length 109bp
Ephydrid, the LDR probe:
F：TTTTTTTTTTTTTTTTTTTTTAATAAATAATATAAGATTTTGATTATTACCTCCTG；
R：P-CATTAACTTTATTATTAGTAAGCAGTATAGTTGATTTTTTTTTTTTTTTTTTTTT；
Ephydrid, product length 112bp
Aphid, the LDR probe:
F：TTTTTTTTTTTTTTTTTTTTTTTTACAATTCATGCTTTTATTATAATTTTTTTTATAA；
R：P-CTATACCAATTGTTATTGGTGGTTTTGGAAATTGATTTTTTTTTTTTTTTTTTTTTT-Fam；
Aphid, product length 115bp
Striped rice borer, the LDR probe:
F：TTTTTTTTTTTTTTTTTTTTTTTTGATCTTTAATTGGGGATGATCAAATTTATAATACC；
R：P-ATTGTTACAGCTCATGCATTTATTATAATTTTTTTTTTTTTTTTTTTTTTTTTTTTTTT-Fam；
Striped rice borer, product length 118bp;
(2) LDR detection architecture reagent
Mixed probe 0.1umol/L
10×Buffer 1μl
Pcr amplified dna template 1 μ l
Taq 0.1μl(4Unit)
H
2O moisturizing to 10 μ l.
The used concrete component of 1 * Taq dna ligase damping fluid is: 20mM Tris-HCl (pH 7.6), and 25mM KAc, 10mM Mg (Ac) 2,10mM DTT, 1mM NAD and 0.1%Triton X100, damping fluid is answered refrigerated storage.
The scheme of described mixed probe is for mixing species probe in 16 with isoconcentration.
This test kit mainly is made up of universal primer PCR and specific probe LDR two portions.In PCR, the universal primer of design amplifies the CO I gene order of selected species simultaneously, passes through ligation again, and the special LDR probe of each species reaches the purpose of somatotype.The LDR signal is detected by ABI Prism 377 type foranalysis of nucleic acids appearance, and the fluorescent value conduct that records is foundation qualitatively.
The principle of design of this test kit may further comprise the steps:
(1) acquisition of the confirming of target gene, rice field predator and prey thereof
The rice field predator who chooses is for intending the water tarantula; Prey is white backed planthopper, pink rice borer, rice natural pond fly, Cnaphalocrocis medinali(rice leaf roller), Cnaphalocrocis medinali(rice leaf roller) braconid wasp, bar fly, brown paddy plant hopper, black porch green plant bug, rice green leafhopper, small brown rice planthopper, midge, thrips, ephydrid, aphid and striped rice borer, 16 kinds altogether; CO I gene on the alternative line plastochondria carries out somatotype research as target gene, makes up the PCR system and the multi-LDR system of many species joint-detection;
(2) amplification of the universal primer PCR of plastosome CO I gene fragment and order-checking
The specific PCR primer amplification is intended the CO I gene order of water tarantula and prey thereof; The universal primer amplification PCR products is cloned in the colibacillary plasmid; And order-checking; Obtain comprising the sequence of 16 species intending the water tarantula, each species is surveyed 10 individualities as far as possible, is used to assess the SNP influence between individuality;
(3) sequence alignment and probe design
The species of order-checking are compared with DNAssist software; Find out the segmental difference between species of COI gene amplification; Species specificity mononucleotide site between searching is planted; Make up LDR species specific probe, the site of selecting must be compared through between the species individuality, gets rid of kind of an interior SNP site and is positioned on this species specificity mononucleotide site;
To species specificity nucleotide site design LDR probe, it is 70～121bp that each species linking probe connects product length, and adjacent segment is spaced apart 3bp;
(4) probe specificity detects and optimizes
The standard plasmid of each species of extracting is quantitatively to unified concentration (10pg/ μ L).At first, get single mode plate and single probe and do the probe specificity assessment, through the sequenator analysis, all probes all have prediction length to connect the product generation; Secondly, get single mode plate and multiprobe and do the probe specificity assessment, through the sequenator analysis, specificity is good.At last, the multi-template multiprobe detects, and the standard plasmid isoconcentration mixing (total concn 10pg/ μ L) with 16 species utilizes the universal primer of CO I to increase, and detects with multiple probe then, obtains multiple probe in detecting scheme.
Beneficial effect
Test kit of the present invention effectively amplifies all target species sequences to the universal primer of CO I gene, has guaranteed that each target sequence and the wherein low template that copies can be detected; The specific probe of each target species has further guaranteed specificity again, and each target sequence is distinguished fully, realizes that multiple somatotype is quantitative, thereby understands the variation of field predation structure, safeguards farmland ecological environment.
Description of drawings
Fig. 1 combines LDR to detect the synoptic diagram of a plurality of species for the universal primer PCR of CO I gene;
Wherein, (A) the standard plasmid DNA of 16 species; (B) universal primer of CO I gene on the plastosome; (C) the PCR reaction that utilizes CO I gene universal primer and DNA template to carry out; (D) to the special LDR probe of CO I gene universal primer amplification section design, (E) to the special LDR probe of the different lengths of CO I gene universal primer amplification section design, what (F) carry out is the multi-LDR reaction of being undertaken by the specific probe hybrid plan; (G) the single mode plate list fluorescence probe quantitative phenotypic analysis figure that obtains on the ABI Prism 377 type foranalysis of nucleic acids appearance, the multi-template multiprobe fluorescent quantitation phenotypic analysis figure of 16 species that (H) obtain on the ABI Prism 377 type foranalysis of nucleic acids appearance.
Embodiment
Below in conjunction with specific embodiment, further set forth the present invention.Should be understood that these embodiment only to be used to the present invention is described and be not used in the restriction scope of the present invention.Should be understood that in addition those skilled in the art can do various changes or modification to the present invention after the content of having read the present invention's instruction, these equivalent form of values fall within the application's appended claims institute restricted portion equally.
(1) universal primer of intending water tarantula DNA and prey DNA increases
(1) the standard plasmid isoconcentration with 16 species mixes, and total concn is 10pg/ μ L;
(2) universal primer
The upper reaches: 5 '-GGTCAACAAATCATAAAGATATTGG-3 ';
Downstream: 5 '-TAAACTTCAGGGTGACCAAAAAATCA-3 ';
(3) amplification system (10 μ l):
Upstream primer 0.5 μ M
Downstream primer 0.5 μ M
10×Buffer 1μl
dNTP 0.2mM
Mg
2+ 2.0mM
Taq?polymerase 0.1μl(0.5Unit)
Add water to 10 μ l;
(4) amplification program:
95℃15min
94℃30s→50℃1min→72℃2min(35cycles)
72℃7min→4℃?forever
(2) the ligase enzyme detection reaction (LDR) of plan water tarantula DNA and prey DNA
(1) the universal primer gained PCR product that increases is used for the LDR signal detection as template
(2) LDR system (10 μ l):
Mixed probe 0.1umol/L
10×Buffer 1μl
Taq?polymerase 0.1μl(4unit)
Add water to 10 μ l
Wherein, the specific probe isoconcentration of 16 species mixes;
(3) LDR response procedures:
95℃2min
94℃30s→60℃2min(35cycles)。
Claims (3)
1. high-throughput multi-LDR parting kit that detects farmland ecological environment comprises:
(1) pcr amplification system
(1) the plastosome CO I gene universal primer sequence of the 16 kinds of species in farmland:
The upper reaches: 5 '-GGTCAACAAATCATAAAGATATTGG-3 ';
Downstream: 5 '-TAAACTTCAGGGTGACCAAAAAATCA-3 ';
(2) pcr amplification system reagent
(2) multi-LDR detection architecture
(1) the specific probe sequence of the plastosome CO I gene of the 16 kinds of species in farmland:
Intend the water tarantula, the LDR probe:
F：TTTTTTTTTTTTTTTTTTTTTTTTTTTGGCTCCTGACATATCTTTTCCTCGAATAAATAATC；
R：P-TTTCTTTTTGGTTATTACCACCTTCTTTATTTTTATTTTTTTTTTTTTTTTTTTTTTTT-Fam；
Intend the water tarantula, product length 121bp
White backed planthopper, the LDR probe:
F：TTGGAGCACCTGATATAGCTTTCCCCCGAATAAAC；
R：P-AATATAAGATTTTGGTTACTTCCACCCTCCTTAAT-Fam；
White backed planthopper, product length 70bp
Pink rice borer, the LDR probe:
F：TTTTTTAGGAGCTATTAATTTTATTACAACAATTATC；
R：P-AATATACGACTAAATAATTTATCTTTTGATCAAATT-Fam；
Pink rice borer, product length 73bp
Rice natural pond fly, the LDR probe:
F：TTTTTTCAGCTCTTTTACTACTTTTATCATTACCTGTTCTC；
R：P-GCTGGAGCCATTACTATGCTTCTTACGGATCGAAATTTTTT-Fam；
Rice natural pond fly, product length 82bp
Cnaphalocrocis medinali(rice leaf roller), the LDR probe:
F：TTTTTTTTCTATTATAATTGGAGGATTTGGAAATTGATTAGTG；
R：P-CCTTTAATATTAGGAGCCCCTGATATAGCTTTTCCTTTTTTT-Fam；
Cnaphalocrocis medinali(rice leaf roller), product length 85bp
The Cnaphalocrocis medinali(rice leaf roller) braconid wasp, the LDR probe:
F：TTTTTTTTTTGCCTTTATTATAATTTTTTTTATAGTTATACCAG；
R：P-TAATAATTGGAGGATTTGGAAATTGATTAATTCCATTTTTTTTT-Fam；
The Cnaphalocrocis medinali(rice leaf roller) braconid wasp, product length 88bp
The bar fly, the LDR probe:
F：TTTTTTTTTTTTTTGATTATTACCTCCTTCATTAACTTTATTAATG；
R：P-GCTAGAAGTATAGTAGAAAATGGAGCTGGAACTGGTTTTTTTTTT-Fam；
The bar fly, product length 91bp
Brown paddy plant hopper, the LDR probe:
F：TTTTTTTTTTTTCAGGATTTATAGGAACCATAAGTAGTATAATTATC；
R：P-CGATCAGAATTAACTCAACCAGGATCTCTAATTAATTTTTTTTTTTT-Fam；
Brown paddy plant hopper, product length 94bp
The black porch green plant bug, the LDR probe:
F：TTTTTTTTTTTTTTTATCACATAATGGAAGATCAGTAGATTTAGCAATC；
R：P-TTCTCACTTCACTTAGCTGGTATTTCATCAATTTTTTTTTTTTTTTTT-Fam；
The black porch green plant bug, product length 97bp
Rice green leafhopper, the LDR probe:
F：TTTTTTTTTTTTTTTTACTTTTAATAAGATCTATCATTGAAATAGGAGTG；
R：P-GGAACAGGTTGAACAGTATACCCCCCCCTTTCAAGTTTTTTTTTTTTTTT-Fam；
Rice green leafhopper, product length 100bp
Small brown rice planthopper, the LDR probe:
F：TTTTTTTTTTTTTTTTTTCGCTGGAGTTAGATCTATTATAGGAGCTATCAAC；
R：P-TTCATTTCTACAATTATTAATATACGATCAAAAAATTTTTTTTTTTTTTTT-Fam；
Small brown rice planthopper, product length 103bp
Midge, the LDR probe:
F：TTTTTTTTTTTTTTTTTTCTAGAAGTATAGTAGAAAATGGAGCAGGAACAGGG；
R：P-TGAACTGTTTATCCTCCACTTTCATCTGGAATTGCTTTTTTTTTTTTTTTTTT-Fam；
Midge, product length 106bp
Thrips, the LDR probe:
F：TTTTTTTTTTTTTTTTTTTTGATCGAAATTTGAACACTTCATTTTTTGATCCAAG；
R：P-AGGAGGAGGGGATCCAGTACTTTACCAACACTTATTTTTTTTTTTTTTTTTT-Fam；
Thrips, product length 109bp
Ephydrid, the LDR probe:
F：TTTTTTTTTTTTTTTTTTTTTAATAAATAATATAAGATTTTGATTATTACCTCCTG；
R：P-CATTAACTTATTTTATAGTAAGCAGTATAGTTGATTTTTTTTTTTTTTTTTTTTT；
Ephydrid, product length 112bp
Aphid, the LDR probe:
F：TTTTTTTTTTTTTTTTTTTTTTTTACAATTCATGCTTTTATTATAATTTTTTTTATAA；
R：P-CTATACCAATTGTTATTGGTGGTTTTGGAAATTGATTTTTTTTTTTTTTTTTTTTTT-Fam；
Aphid, product length 115bp
Striped rice borer, the LDR probe:
F：TTTTTTTTTTTTTTTTTTTTTTTTGATCTTTAATTGGGGATGATCAAATTTATAATACC；
R：P-ATTGTTACAGCTCATGCATTTATTATAATTTTTTTTTTTTTTTTTTTTTTTTTTTTTTT-Fam；
Striped rice borer, product length 118bp;
(2) LDR detection architecture reagent
2. a kind of high-throughput multi-LDR parting kit that detects farmland ecological environment according to claim 1; It is characterized in that: the concrete component of described 1 * Taq dna ligase damping fluid is: 20mM pH 7.6Tris-HCl; 25mM KAc, 10mM Mg (Ac) 2,10mM DTT; 1mM NAD and 0.1%Triton X100, the damping fluid refrigerated storage.
3. a kind of high-throughput multi-LDR parting kit that detects farmland ecological environment according to claim 1 is characterized in that: the scheme of described mixed probe is mixed with isoconcentration for the specific probe with 16 species.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN2010101021793A CN101921828B (en) | 2010-01-28 | 2010-01-28 | High-throughput multi-LDR parting kit for detecting farmland ecological environment |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN2010101021793A CN101921828B (en) | 2010-01-28 | 2010-01-28 | High-throughput multi-LDR parting kit for detecting farmland ecological environment |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN101921828A CN101921828A (en) | 2010-12-22 |
| CN101921828B true CN101921828B (en) | 2012-11-07 |
Family
ID=43337043
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN2010101021793A Expired - Fee Related CN101921828B (en) | 2010-01-28 | 2010-01-28 | High-throughput multi-LDR parting kit for detecting farmland ecological environment |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN101921828B (en) |
Families Citing this family (6)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102690829B (en) * | 2012-05-16 | 2013-09-25 | 福建国际旅行卫生保健中心 | A DNA bar code standard gene sequence for Taiwan Lasiohelea |
| CN103255222B (en) * | 2013-05-22 | 2014-10-22 | 青岛农业大学 | Primers and method for identifying greenhouse trialeurodes vaporariorum and bemisia tabaci by utilizing mitochondria SCAR (sequence characterized amplified regions) marker |
| CN104561270B (en) * | 2014-12-01 | 2016-10-05 | 浙江省农业科学院 | The molecular biology differentiating method of two kinds of rice leaf folder larvas |
| CN104498603A (en) * | 2014-12-11 | 2015-04-08 | 中国计量学院 | Method for identifying four delphacidae insects based on DNA bar codes |
| CN105713992A (en) * | 2016-05-10 | 2016-06-29 | 华中农业大学 | DNA (deoxyribonucleic acid)-bar-code-based identification method of aquatic insects in Chironomidae two genera |
| CN106755569B (en) * | 2017-01-18 | 2019-07-09 | 江苏里下河地区农业科学研究所 | The special primer and detection method of a kind of rice leaf roller PuGV PCR detection and application |
Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN1456684A (en) * | 2003-03-26 | 2003-11-19 | 中国科学院生态环境研究中心 | Induction design plan for PCR-DGGE research on environment microorgan population |
| CN1851448A (en) * | 2005-12-08 | 2006-10-25 | 中国农业科学院作物科学研究所 | Green smut bug real-time fluorescent quantitative PCR test kit and its use |
-
2010
- 2010-01-28 CN CN2010101021793A patent/CN101921828B/en not_active Expired - Fee Related
Patent Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN1456684A (en) * | 2003-03-26 | 2003-11-19 | 中国科学院生态环境研究中心 | Induction design plan for PCR-DGGE research on environment microorgan population |
| CN1851448A (en) * | 2005-12-08 | 2006-10-25 | 中国农业科学院作物科学研究所 | Green smut bug real-time fluorescent quantitative PCR test kit and its use |
Also Published As
| Publication number | Publication date |
|---|---|
| CN101921828A (en) | 2010-12-22 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Karst et al. | Retrieval of a million high-quality, full-length microbial 16S and 18S rRNA gene sequences without primer bias | |
| Kotopka et al. | Model-driven generation of artificial yeast promoters | |
| CN101921828B (en) | High-throughput multi-LDR parting kit for detecting farmland ecological environment | |
| Dressman et al. | Transforming single DNA molecules into fluorescent magnetic particles for detection and enumeration of genetic variations | |
| Fakruddin et al. | Methods for analyzing diversity of microbial communities in natural environments | |
| Hagege et al. | Quantitative analysis of chromosome conformation capture assays (3C-qPCR) | |
| Zhang et al. | Lighting up single-nucleotide variation in situ in single cells and tissues | |
| CN109072205A (en) | The detection of nucleic acid | |
| Hessner et al. | Three color cDNA microarrays: quantitative assessment through the use of fluorescein‐labeled probes | |
| Kaur et al. | Shining a spotlight on DNA: single-molecule methods to visualise DNA | |
| Qiu et al. | A clinical role for Förster resonance energy transfer in molecular diagnostics of disease | |
| Zhou et al. | Simultaneous multiple single nucleotide polymorphism detection based on click chemistry combined with DNA-encoded probes | |
| Feriotto et al. | Quantitation of Bt-176 maize genomic sequences by surface plasmon resonance-based biospecific interaction analysis of multiplex polymerase chain reaction (PCR) | |
| Wei et al. | Deep mutational scanning: A versatile tool in systematically mapping genotypes to phenotypes | |
| Pel et al. | Rapid and highly-specific generation of targeted DNA sequencing libraries enabled by linking capture probes with universal primers | |
| Zhang et al. | Mapping DNA quantity into electrophoretic mobility through quantum dot nanotethers for high-resolution genetic and epigenetic analysis | |
| Luo et al. | Bulge-loop tuned entropy-driven catalytic reaction and tag-encoded barcodes for multiplexed mutation detection | |
| Dubey et al. | Role of next-generation sequencing (NGS) in understanding the microbial diversity | |
| Vromman et al. | CIRCprimerXL: convenient and high-throughput PCR primer design for circular RNA quantification | |
| Dong et al. | Fluorescent Polymerase Chain Reaction Nanokit for the Detection of DNA Sequence in Single Living Cells | |
| Eshaque et al. | Technology platforms for molecular diagnosis of cystic fibrosis | |
| Thies | Molecular methods for studying soil ecology | |
| Zhou et al. | Sensitive monitoring of RNA transcription levels using a graphene oxide fluorescence switch | |
| Payne et al. | Barcode aware adaptive sampling for GridION and PromethION Oxford Nanopore sequencers | |
| O'Brien et al. | Global Run-On sequencing to measure nascent transcription in Saccharomyces cerevisiae |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C14 | Grant of patent or utility model | ||
| GR01 | Patent grant | ||
| CF01 | Termination of patent right due to non-payment of annual fee |
Granted publication date: 20121107 Termination date: 20150128 |
|
| EXPY | Termination of patent right or utility model |