CN105969843A

CN105969843A - High-throughput sequencing detection method for gene copy number and gene mutation based on MLPA

Info

Publication number: CN105969843A
Application number: CN201610093346.XA
Authority: CN
Inventors: 杨永臣
Original assignee: Individual
Current assignee: Individual
Priority date: 2016-04-16
Filing date: 2016-04-16
Publication date: 2016-09-28

Abstract

The invention discloses high-throughput sequencing detection technology for gene copy number variation and gene mutation based on an MLPA technical principle, and belongs to the technical field of gene detection. In an MLPA technical link, a PCR amplification link or a link before or after the PCR amplification link is reconstructed to provide a PCR product with a contact sequence capable of entering high-throughput sequencing for sequencing on a machine. Obtained data are analyzed to get a Reads number of amplification of each probe, and the copy number of a template or a gene mutation situation is calculated. According to the technology, fragments with different lengths can be distinguished without capillary electrophoresis, and the products are designed to have almost same lengths, so that the limit that MLPA can only detect more than 50 loci at one time is greatly broken and complex steps for probe preparation are avoided. The contact sequence can be embedded for distinguishing tag sequences for different samples, and therefore it is ensured that detection of the copy number is of high accuracy, and the high-throughput property of detected loci and detected samples is achieved.

Description

A kind of gene copy number based on MLPA and the high-flux sequence detection method of sudden change

Technical field

This patent disclosure relates generally to the nucleic acid analysis in biological specimen, in particular with based on the method reconnected more and High-throughout method detection hereditary variation, belongs to technical field of gene detection.

Background technology

1 copy number variation general introduction [1]

The discovery of 1.1 copy numbers variation (CNV)

Copy number variation (copy number variations, CNVs) refers to compared with reference sequences, occurs on genome The micro structure that causes due to reasons such as repetitions, disappearances of the length DNA fragment more than 1 kb make a variation [2].

1936, Bridge found to exist in Bar gene fragment polyisomenism when studying drosophila compound eye character, thus shadow Ring the formation of drosophila compound eye.In some difficult disease genes of the mankind, then the most in succession it is found that " the weight of similar Bar gene Multiple " (Buckland PR. Polymorphically duplicated genes:their relevance to Phenotypic variation in humans. Ann Med. 2003,35:308-315).But large scale system ground is right CNV conducts a research and starts from Iafrate and Sebat in 2004 etc. and be published in respectively on Nature and Science Achievement in research.Iafrate etc. detect 255 repetition/deletion segments [3] in healthy individuals genome.And Sebat Research team in the genome of healthy individuals, be then found that 221 copy number variant sites [4].These researchs show, Not only can find in the genome of patient groups that copy number makes a variation, it has also been found that gene copy number variation is universal in healthy population Exist, and the phenotype of some normal individuals may be produced impact.

Redon etc. utilize microarray comparative genomic hybridization hybrid (array-based Comparative Genome Hybridzation, aCGH) 270 individualities deriving from different geographical difference ethnic group carry out by chip in full-length genome level Detection, identifies 1447 copy number variable region (Copy Number Variation Region, CNVR), whole district altogether Territory covers the human genomic sequence of about 12%, relates to nearly 2900 of gene.Meanwhile, first mankind CNV figure is disclosed Spectrum.This research shows that CNV is widely distributed in genome, and for carrying out large-scale CNV afterwards in the range of full-length genome Research provides the foundation [5].

The Forming Mechanism of 1.2 CNV

The main Types of CNV is that the DNA of large fragment repeats and disappearance, and CNV Forming Mechanism mainly has following four: (1) is non- Allele homologous recombination (Non-Allelic Homologous Recombination, NAHR)；(2) nonhomologous end is even Meet (Non-Homologous End-Joining, NHEJ)；(3) replication fork postpones and template switch model (Fork Stalling and Template Switching, FoSTeS)；(4) L1 element retrotransposition (L1 element Retrotransposition).

The mechanism of action of 1.3 CNV

The main mechanism that copy number variation produces impact to gene and phenotype is: the dosage effect of (1) gene, such as expresses increase Or reduce；(2) position effect, by changing the expression of controlling element and the distance change gene of genes of interest, or directly reduces Controlling element affects gene expression；(3) fusion of gene, merges two neighboring gene and results in new transcript or meritorious The gene of energy；(4) gene disruption, exons structure variation causes gene inactivation with city；(5) the potential effect that contracts, passes through base Because the pairing between seat affects the expression of gene, this is the main mechanism of trans regulation；(6) recessive site or functional polymorphic position The exposure of point.

1.4 full-length genome scope CNV detection methods

At present, microarray comparative genomic hybridization hybrid technology is mainly included for the detection method of CNV in the range of full-length genome (array-based comparative genomic hybridization, aCGH), SNP chip technology and second filial generation order-checking Technology (Next-Generation Sequencing, NGS) etc..

(1) aCGH analytical technology

Microarray comparative genomic hybridization hybrid technology (aCGH) is Comparative genomic hybridization based on microarray technology, at one On chip, the sample (test sample and check sample) of labelling difference fluorescein is hybridized, by DNA probe trace point simultaneously Sample or fabricated in situ, to each position on chip, make the flux of detection increase substantially [6].Along with the development of biotechnology, ACGH method is more and more efficient to the repetition in detection genome and disappearance, becomes the main of full-length genome CNV detection in early days Method.

(2) SNP chip analysis technology

The product that the SNP gel typing method that SNP chip is traditional combines with biochip technology.Process in detection In, DNA molecule to be measured through enzyme action and by fluorochrome label after hybridize with the probe sequence on chip, then utilize Laser scanning imaging, analyzes the degree of hybridization of DNA molecule to be measured and probe according to the power of fluorescence signal in image, thus Identify the variation that whether there is repetition or disappearance in sequence to be measured.Generally, continuous print probe whether is had to occur according to SNP chip Hybridization signal increases or signal deletion differentiates whether CNV exists.The limitation of SNP chip is, covering gene group time Time is generally biased towards known SNP [7].

(3) high throughput sequencing technologies

High-flux sequence is also second filial generation sequencing technologies (NGS), develops on the basis of Sanger checks order.It is adopted Use high flux microarray technology, the DNA fragment (reads) of a large amount of sample can be analyzed simultaneously.During analyzing, to be measured DNA fragment constantly extends under the catalytic action of ligase or polymerase, and the order-checking of synthesis limit, limit is its feature, is surveyed by collection The fluorescence signal or the hydrion signal that produce in sequence circulation obtain sequencing result.

Second filial generation sequencing technologies is come with canonical sequence reads coverage in the same area by relatively sequence to be measured Measure CNV.Detecting step substantially can be divided into 5 steps: (a) preparation is with reference to DNA sample and DNA sample to be measured；B () is right DNA sample checks order: DNA sample interrupts the fragment into regular length, fragment two ends jointing sequence, profit at random With adapter-primer, DNA fragment (reads) is synthesized and order-checking；C () calculates corresponding fragmentation sequence in template Level of coverage；(d) relatively sequence to be measured and canonical sequence reads coverage in the same area, thus infer this district In territory, whether DNA exists CNVs；The output [8] of (e) testing result.The method using high-flux sequence, such as the order-checking degree of depth relatively Deeply, then cost is the highest；As relatively low in the degree of depth that checks order, then the power of test of relatively short-movie section copy number variation is reduced.Therefore this is one Plant less economic technical scheme.

The 1.5 known CNV detection methods in local

Compared with full-length genome detection method, the detection method of the most known CNV be broadly divided into PCR-based technology and based on Hybridization technique two class.

The detection method of PCR-based technology mainly has three kinds:

(1) fluorescence real-time quantitative PCR (Real-time quantitative PCR, qPCR)

QPCR method is to improve in Standard PCR technology, add in reaction system SYBR Green fluorescent dye or The fluorescently-labeled probe of TaqMan, by monitor fluorescence in real time signal, can obtain amplification cycles number (Ct value)-glimmering through calculating The functional image of light value, then the image of the image of testing gene with crt gene is compared, DNA to be measured can be calculated Original template amount.The theoretical basis utilizing qPCR technology for detection CNV is then that the genes of interest to sample to be tested is (containing copy Number polymorphic) and reference gene (2 copies, polymorphic without copy number) employing relative quantitative assay method be analyzed [9].The party Method can only detect one or a few site every time.

(2) multiple join dependency formula probe amplification technology (multiplex ligation-dependent probe Amplification, MLPA)

The ultimate principle of MLPA is the corresponding upstream hybridization probe of the sequential design for target gene and hybridized downstream probe (inserting universal primer in probe), hybridizes position adjacent on DNA respectively.When hybridization probe is abundant with genomic DNA After hybridization, upstream probe and downstream probe can be connected by the coupled reaction of ligase and form a complete hybridization spy Pin.Owing to all MLPA probes of being combined on same DNA chain have a consensus at two ends, thus available general draw Thing expands, and these fragments have close amplification efficiency.Amplified production judges target gene through capillary electrophoresis analysis Copy number [10].MLPA is a kind of gene copy number variation detection method quick, reliable, can detect multiple site, simultaneously It is widely used in the detection of clinical gene copy number variation.

(3) short-movie section multiple quantitative technology (Quantitative multiplex PCR of short Fluorescent, QMPSF)

The method carries out fluorescent labeling to primer, and carries out the PCR amplification of limited cycle for copy number variant sites, by profit With capillary electrophoresis, then judge the copy number of testing gene according to the relative peak height ratio of products different on electrophoresis pattern.Should Method can carry out multiplex PCR simultaneously, therefore increases on detection flux.Phase according to product peaks different on electrophoresis pattern Ratio of peak judges the copy number of target gene, and the copy number i.e. inferred is all the relative value compared with certain benchmark, So for copy number increase a lot of in the case of it is impossible to confirm that the absolute value of copy number.

CNV detection method based on hybridization technique mainly has two kinds:

(1) Southern hybridization (Southern blotting)

Southern hybridization refers to that DNA fragmentation is transferred on solid phase carrier after restriction enzyme digestion and electrophoresis, and by sides such as ultraviolet light irradiations Formula is fixed, and is then hybridized with the DNA sample being fixed on solid phase carrier by the nucleic probe of labelling, it is judged that treat Survey in DNA sample and whether contain and the fragment of probe homology.The operation of this technology is more loaded down with trivial details, time-consuming.

(2) fluorescence in situ hybridization (Fluorescence in situ hybridization, FISH)

The ultimate principle of FISH is by the special nucleic acid molecule labelling of DNA probe, then by probe direct cross to dye On colour solid or DNA fibre section more specific binding with probe molecule by the monoclonal antibody of fluorescein molecule coupling, from And specific DNA sequence is carried out on chromosome or DNA fibre section qualitative, location and relative quantitative assay.FISH Have safe, quick, highly sensitive, probe can preserve for a long time, can show the advantages such as multiple color simultaneously, not only can show mid-term Split coil method, moreover it is possible to display interphase nucleus.But FISH cost is high, technology requires that height, flux are little, and the time is long, repeats for ortho position CNV can not accurate quantification, and need suitable cell sample.

2 single nucleotide polymorphism (single nucleotide polymorphism, SNP) are summarized

2.1 single nucleotide polymorphism (single nucleotide polymorphism, SNP) are by list in genomic level The DNA sequence polymorphism that individual nucleotide diversity causes, including replacing, overturn, lack and inserting.SNP detection is examined at clinical molecular The fields such as disconnected, forensic identification, new drug development play the most important effect.Common SNP detection method includes DNA chip Hybridization, restricted length polymorphism (restriction fragment length polymorphism, RFLP) and equipotential base Because of specific PCR (allele specific PCR, AS-PCR) etc., but these methods all cannot meet high flux, height simultaneously Accuracy and cheap requirement.

2.2MLPA detects single nucleotide polymorphism

Multiple join dependency probe amplification (multiplex ligation dependent probe amplification, MLPA) technology is in addition to the copy number that can simultaneously detect 50 a plurality of target sequences changes, and the MLPA technology after improvement also can be examined Survey RNA, SNP site and methylated change, be used widely in fields such as antenatal, hereditary and lesion detection.MLPA is anti- Probe coupled reaction in Ying is only when probe and the pairing of target sequence target DNA, and particularly connection site and close position is necessary Match completely, and be only possible under conditions of there is no space between two probes occur.When mispairing occurring between base, generally connect Connect and can not occur.MLPA detection SNP i.e. employs this principle.

The deriving technology of 3 MLPA technology

3.1 MLPA-microarray technologies (Array-MLPA)

MLPA is detected in several genes sudden change or a gene in same test tube by MLPA-microarray technology (Array-MLPA) The high flux property of advantage and micro-array chip (Array) of multiple site mutations, specificity etc. combine, make MLPA have There is high throughput testing ability [11].But the method to a certain degree affects the susceptiveness of MLPA detection, seldom it is applied to facing of reality In bed detection.

3.2 CNVplex high-throughput multi gene copy numbers detection [12]

CNVplex uses ligase high specific coupled reaction that purpose region is hybridized, connected, and is connecting spy by technology The purpose probe of the sequence label acquisition variable lengths that pin latter end introduces different length connects product, utilizes fluorescently-labeled general Primer carries out PCR amplification to connecting product, by fluorescent capillary electrophoresis tube, amplified production is carried out electrophoretic separation detection, finally leads to Cross and electrophoresis pattern is analyzed the peak height obtaining each site, and then be analyzed determining to the copy number in sample purpose region. Being with MLPA difference, this technology uses multipair universal primer in primary first-order equation, and different universal primers is with difference Fluorescence.Therefore, different fragment lengths, plus different fluorescence, considerably increases detectable bit number of points, improves inspection Survey flux.But the method too increases the complexity of detection and the complexity of analysis.

List of references:

[1] Wang Yanan: 9 China and foreign countries' pig variety full-length genome select region and copy number analysis of variance, Hua Zhong Agriculture University doctor Academic dissertation, 2015.6)

[2] Redon R, Ishikawa S, Fitch KR, Feuk L, Perry GH, Andrews TD, Fiegler H, Shapero MH, Carson AR, Chen W, Cho EK, Dallaire S, Freeman JL, Gonzalez JR, Gratacos M, Huang J, Kalaitzopoulos D, Komura D, MacDonald JR, Marshall CR, et al. Global variation in copy number in the human genome. Nature. 2006a, 444: 444-454

[3] Iafrate AJ, Feuk L, Rivera MN, Listewnik ML, Donahoe PK, Qi Y, Scherer SW, Lee C. Detection of large-scale variation in the human genome. Nat Genet. 2004, 36: 949-951

[4] Sebat J, Lakshmi B, Troge J, Alexander J, Young J, Lundin P, Maner S, Massa H, Walker M, Chi M, Navin N, Lucito R, Healy J, Hicks J, Ye K, Reiner A, Gilliam TC, Trask B, Patterson N, Zetterberg A, et al. Large-scale copy number polymorphism in the human genome. Science. 2004, 305: 525-528

[5] Redon R, Ishikawa S, Fitch KR, Feuk L, Perry GH, Andrews TD, Fiegler H, Shapero MH, Carson AR, Chen W, Cho EK, Dallaire S, Freeman JL, Gonzalez JR, Gratacos M, Huang J, Kalaitzopoulos D, Komura D, MacDonald JR, Marshall CR, et al. Global variation in copy number in the human genome. Nature. 2006b, 444: 444-454

[6] Solinas-Toldo S, Lampel S, Stilgenbauer S, Nickolenko J, Benner A, Dohner H, Cremer T, Lichter P. Matrix-based comparative genomic hybridization: biochips to screen for genomic imbalances. Genes, chromosomes & cancer. 1997, 20: 399-407

[7] Winchester L, Yau C, Ragoussis J. Comparing CNV detection methods for SNP arrays. Briefings in functional genomics & proteomics. 2009, 8: 353-366

[8] Dear PH. Copy-number variation: the end of the human genome? Trends in biotechnology. 2009, 27: 448-454

[9] Livak KJ, Schmittgen TD. Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) Method. Methods. 2001, 25: 402-408

[10] Schouten JP, McElgunn CJ, Waaijer R, Zwijnenburg D, Diepvens F, Pals G. Relative quantification of 40 nucleic acid sequences by multiplex ligation-dependent probe amplification. Nucleic Acids Res. 2002, 30: e57

[11]Berry IR, Delaney CA, Taylor GR. Detecting ligated fragments on oligonucleotide microarrays: optimizing chip design, array multiplex ligation-dependent probe amplification modification, and hybridization parameters. Methods Mol Biol, 2007, 381: 247−265.

[12] Zhang X, Xu Y, Liu D, Geng J, Chen S, Jiang Z, Fu Q, Sun K. A modified multiplex ligation-dependent probe amplification method for the detection of 22q11.2 copy number variations in patients with congenital heart disease. BMC Genomics. 2015 May 8;16:364. doi: 10.1186/s12864-015-1590-5.

Summary of the invention

It is an object of the invention to: propose a kind of gene copy number variation based on MLPA principle and the high flux of gene mutation Detection method.Classical MLPA technology can detect 60 by the way of probe hybridization, connection, multiplexed PCR amplification the most simultaneously The site of individual left and right, amplified production is distinguished with capillary electrophoresis because of length difference.The present invention changes length detection into sequence Detection itself, by transforming the link of MLPA, is allowed to can directly carry out high-flux sequence, by detecting each site amplified fragments Reads quantity judge the copy number of target gene.This invention product design can be close to the longest, can quantum jump MLPA greatly each Can only detect the restriction in more than 50 site, and avoid complex steps prepared by long probe.Joint sequence can be inserted for distinguishing The sequence label of different samples, thus this technology is while guaranteeing the high precision of detection copy number, it is achieved that detection site High flux property and detection sample high flux property.

Technical scheme

In order to realize the purpose of invention, the present invention proposes three feasible schemes.Introduce joint before being respectively PCR, PCR introduces Joint, introduces joint after PCR.PCR herein refers to the multiplexed PCR amplification in MLPA.Joint refers to measure for high pass herein The necessary sequence of machine in sequence, including the sequence combined with flow cell (flow cell), carry out high-flux sequence time and sequencing primer Binding sequence, and possible sequence label.

Scheme one, introduces joint before PCR

Comprising many Species specific probes in the reaction tube of classical MLPA technology, each probe includes two oligonucleotide fragments； Each oligonucleotide fragment includes one section of target nucleotide specific sequence and one section of general primer sequence.By universal primer sequence Row change or increase to high-flux sequence joint sequence [joint includes the sequence combined with flow cell (flow cell), It is connected to the DNA fragmentation of joint and carries out the primer binding sequence needed for PCR amplification, high-flux sequence primer binding sequence, including Or do not include label (the indexing or barcoding) sequence etc. for distinguishing different sample.Illumina company provides Typical joint sequence be: TruSeq Universal Adapter:5 '- AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCT -3’；TruSeq Indexed Adapter:5 '-GATCGGAAGAGCACACGTCTGAACTCCAGTCAC NNNNNN ATCTCGTATGCCGTCTTCTGCTTG -3 '], being prepared as joint after these two probe Hybrid Heating annealing, joint and determined nucleic acid target sequence hybridize, coupled reaction completes After, LM-PCR (the Ligation Mediated PCR) reaction for building storehouse can be carried out, this PCR also plays in MLPA simultaneously The effect of pair of primers multiplex amplification；High-flux sequence after high flux primer binding sequence then can be used for upper machine in joint sequence. The flow chart of the program is shown in Figure 12.In flow charts, the fall-back sequence section in probe plays the effect of regulation length.If it is long Spending the shortest, end product is the most accurate, then can not want.P5 and the P7 universal primer sequence as amplification is employed when amplification. This sequence can proper extension and shortening on the premise of comprising end sequence.Its object is to the effect of optimized expansion.The party In case, due to probe synthesis costly, if sequence label to be introduced in probe, in order to distinguish different samples, the most entirely The downstream probe sequence in portion all with this label, and must have how many labels, is necessary for the downstream probe of how many set.Cause And the program is defective in terms of the motility that label is arranged.If but without the concern for the high flux of pattern detection, mark The setting signed is the most unnecessary, can use the program.

Scheme two, introduces joint in PCR

Include one section of target nucleotide specific sequence and the oligonucleotide fragment of one section of universal primer sequence, in hybridization and connection Enzyme is connected to after the coupled reaction of two parts probe completes, and enters universal primer amplification link.The universal primer used, structure On in addition to containing the part that can be combined with universal sequence in oligonucleotide fragment, its 5 ' end is additionally containing the survey of promising high flux The preface and table of contents joint sequence, be referred to as lengthening universal primer.With lengthening after universal primer expanded, amplified production is with can be with Flow cell combines and carries out the sequence checked order.The lengthening universal primer used, also can comprise or not comprise for distinguishing The sequence label of different samples.The flow chart of the program is shown in Figure 11.In flow charts, the forward primer sequence of probe and reversely drawing Thing sequence is separately provided, it may be considered that use the sequence of all or part of Rd1 SP and Rd2 SP to replace current forward Primer sequence and reverse primer sequences.The length of final amplified production can be shortened after replacement.Whether replace with amplification homogeneity, Depending on the optimal conditions such as amplification efficiency.In this scenario, the universal primer of the lengthening of use introduces under sequence label, every Trip lengthen universal primer with a different label, it is possible to use this lengthening universal primer amplification whole fragments all with Same label.So, the expensive cost of synthesis many sets downstream probe in scheme one is avoided.Therefore, this programme in theory Compare saving.After amplification, purified and quantitative, can directly go up machine order-checking.Therefore the program is also the easiest.

Scheme three, introduces joint after PCR

Include one section of target nucleotide specific sequence and the oligonucleotide fragment of one section of general primer sequence, in hybridization, even Connect, after general common primer amplification completes, purified, increase a link adding joint.Added joint is that high-flux sequence is built The joint in storehouse.This joint can comprise or not comprise the sequence label for distinguishing different sample.After adding top connection, pass through Other step such as LM-PCR before the order-checking of upper machine, carries out upper machine order-checking after purification, quantitative, fragment detection etc..The flow process of the program Figure is shown in Figure 13.The detailed description of the invention of the present invention, uses this programme.If MLPA's is that Holland MRC-Holland is public The test kit that department produces, then the PCR primer that the experiment of this test kit obtains, both can be analyzed with capillary electrophoresis, it is possible to warp Add joint after simple transformation, carry out the analysis of high-flux sequence, it is simple to compare two kinds of consistent degree of method.If not in order to compare Purpose, oneself design probe time, the padding sequence in probe can be removed completely, thus obtain amplification efficiency, purification imitate Rate, the library that Reads reading efficiency is consistent, be conducive to detection.The program is compared with scheme two, owing to adding what joint connected Link and comparatively laborious.

Accompanying drawing explanation

Fig. 1, being embodied as of invention, the PCR primer of MLPA is purified, to purified product after amplification again The position carrying out agarose gel electrophoresis observation amplified band is the most correct.

Fig. 2, being embodied as of invention, NC sample adds adapter PCR and after purification, use Agilent 2100 (HS Chip) library is carried out fragmentation detection.

Fig. 3, being embodied as of invention, PC sample adds adapter PCR and after purification, use Agilent 2100 (HS Chip) library is carried out fragmentation detection.

Fig. 4, being embodied as of invention, NC sample is through complete MLPA experiment, collection of illustrative plates after capillary electrophoresis.

Fig. 5, being embodied as of invention, PC sample is through complete MLPA experiment, collection of illustrative plates after capillary electrophoresis.

Fig. 6, being embodied as of invention, PC sample is through complete MLPA experiment, with NC sample as reference, warp The collection of illustrative plates of Coffalyser.Net software analysis.

Fig. 7, at being embodied as of invention, PC sample and NC sample through Coffalyser.Net software analysis, extracts every The area at individual peak, PC peak area processes through homogenization, and two samples carry out peak area ratio relatively.

Data, being embodied as of invention, after high-flux sequence, are carried out the assay surface of software analysis by Fig. 8.

Fig. 9, being embodied as of invention, PC sample and NC sample are after high-flux sequence, it is thus achieved that each fragment Reads number, the Reads at PC peak processes through homogenization, and two samples carry out Reads number and compare.

Figure 10, in being embodied as of invention, PC sample and the MLPA peak area ratio of each fragment of NC sample and high pass Measure the comparison of sequence Reads number ratio.

Figure 11, the flow chart of the present invention program 2

Figure 12, the flow chart of the present invention program 1

Figure 13, the flow chart of the present invention program 3

Detailed description of the invention

The process implemented in detail below, uses the scheme three in above " summary of the invention ".

It should be understood that specific implementation process have employed the thinking that scheme three provides, do not indicate that scheme three is to reach the object of the invention Preferred plan.Implementer should be according to concrete condition, purpose, fund, personnel's experience etc., the experiment side of reasonable arrangement oneself Case.

Even if it should be understood that present invention the solution of the present invention three is also not limited to specific method described herein, scheme And reagent.Terms used herein only describes particular implementation, is not intended to limit the scope of the present invention.

Additionally, as understood by those skilled in the art, can by use various different in the way of complete following reaction.Following preferably Embodiment in, the component of reaction can simultaneously, continuously or add with different order.Additionally, reaction can include various not With, can be with other reagent in the detection.These include reagent such as salt, buffer, neutral protein matter (such as albumin), Detergents etc., these reagent may be used for promoting optimal hybridization and detection, and/or reduce non-specific or background phase interaction With.Preparation method according to sample and the purity of target, be also with improving other reagent of detection efficiency, as protease suppresses Agent, nucleic acid inhibitor, antibacterial etc..

Although disclosing the present invention with reference to detailed description of the invention, but described embodiment may be made various modification, replacement and Change the full breadth without deviating from the present invention described in specification and claims of enclosing.Based on detailed description, accompanying drawing, enforcement Example and claim, it can be appreciated that other features, purpose and the advantage of disclosed theme.May utilize and those bases described herein In basis, the similar or method of equivalent and material are implemented or test theme disclosed by the invention.

1. main agents and instrument

Primer is synthesized by Sangon Biotech (Shanghai) Co., Ltd., and HS Taq enzyme is purchased from Dalian treasured biotech firm, fragment Analyser is 3500 DX from American AB I company, and PCR instrument is American AB I 9700.

MLPA test kit: test kit P064-C1 is purchased from MRC-Holland company of Holland, containing for following dyeing position Point and the specific probe of disease.

Gene loci	Disease English name	Disease Chinese
			1p36	deletion syndrome	1p36 deletion syndrome
4p16	Wolf-Hirschhorn syndrome	Wolf He Saihaoen syndrome
			5p15	Cri du Chat syndrome	Cri du chat syndrome
5q35	Sotos syndrome	Sotos' syndrome
			7p21	Saethre/Chotzen syndrome	Saethre/Chotzen syndrome
7q11	Williams-Beuren syndrome	Williams-Bo Yilun syndrome
			8q24	Langer-Giedion syndrome	Lange Ji Diweng syndrome
11p13	WAGR syndrome	WAGR syndrome
			15q11	Prader-Willi / Angelman syndrome	Pula moral-Willie/angel's syndrome
16p13	Rubinstein-Taybi syndrome	Robinstein-Tai Bi syndrome
			17p11	Smith-Magenis syndrome	Smith-Ma Gai Nice syndrome
17p13	Miller-Dieker syndrome	Miller-Dieker syndrome
			20p12	Alagille syndrome	Alagille syndrome
22q11	DiGeorge syndrome	DiGeorge's syndrome
			22q13	Phelan-McDermid syndrome	Fei Lun-McDermid syndrome

It should be noted that the disease name in this form is as the criterion with English name, some diseases there is no the Chinese of standard.

Experimental subject is two samples: NC sample is a normal women DNA sample, and PC sample is from DiGeorge Syndrome(diGeorge's syndrome) DNA sample of male patient, show as the disappearance in Chromosome 22q11 region.DNA is With QIAamp DNA Blood Mini Kit (Qiagen) according to description instruct extracting.

2. MLPA reaction: the degeneration of (1) DNA and probe hybridization: DNA 3uL (concentration 200ng/u I), puts PCR thermal cycler In 98 DEG C of degeneration 10 min, add 1.5uL probe mixed liquor when being cooled to 25 DEG C (by 0.75uL probemix+0.75 u L SALSA MLPA Buffer configuration mixes) the most carefully mix, then hatch 1 min, 60 DEG C of hybridization at 95 DEG C 16 hours-20 hours.(2) coupled reaction: treat that PCR instrument is down to 54 DEG C, add 16uL oneself prepare containing ligase-65 ligase Mixed liquor (Ligase Buffer A 1.5 u L+Ligase Buffler B 1.5u L+SALSA Ligase-65 0.5 UL+H2O 12.5 u L), after mixing, hatch 20 min, then 98 DEG C of heating 5 min for 54 DEG C.(3) amplification: treat that PCR instrument drops Temperature, to 4 DEG C, adds 5 uL PCR reactant liquors (SALSA PCR buffer i.e. SALSA PCR buffer 1 uL+H2O 3.75 UL+SALSA Polymerase 0.25 uL) mixed hook after, start PCR reaction: 95 DEG C of 30s, 60 DEG C of 30s, 72 DEG C of 1min, 34 After individual circulation, hatch 10 min again for 72 DEG C.(4) product analysis: carry out capillary electrophoresis with ABI 3500 Dx accounting analysis instrument and divide From.

3. MLPA data analysis: the data obtained after electrophoretic separation are by Coffalyser.Net software analysis MLPA collection of illustrative plates number According to, generate MLPA collection of illustrative plates.With the NC sample of normal person for comparison, compare MLPA probe signals peak height between PC sample and NC sample Degree, the situations such as the gene point of analysis probe position lacks, repeat.After amplification, probe signals intensity is compared with normal person's signal Ratio is judged to more than 1.4 repeat, and is judged to disappearance less than 0.6.In order to, compared with the data of high-flux sequence, use Coffalyser.Net software is extracted the peak area at each peak.For peak area, analyze for the ease of comparing, be similar to The process of homogenization (Normalization Method).Briefly, by all for NC fragment peak area sums and all of PC Section peak area sum compare, gained ratio is multiplied with each peak area of PC, make the PC peak-to-peak area after adjustment the most respectively with The peak-to-peak Area comparison of NC.After homogenization processes, the peak area of the band corresponding with NC sample to PC sample compares.

4. owing to containing fluorophor in the PCR primer of MLPA, it is impossible to be directly connected to the joint for high-flux sequence.For Carry out high-flux sequence test, MLPA product expanded again.The primer sequence is: MLPA-F primer: 5 '- GGGTTCCCTAAGGGTTGGA-3’；MLPA-R primer:5 '-GCGCCAGCAAGATCCAATCTAGA-3 '.50uL's is anti- Answer in system and comprise: the MLPA PCR product of 2 μ l, 10 × HS Taq buffer of 5 μ l, the dNTP (2.5 of 4 μ l MM), the MLPA-R primer (20 pM) of the MLPA-F primer (20 pM) of 1 μ l, 1 μ l, the HS of 2 units Taq enzyme (TaKaRa, DaLian, China produces), is subsequently adding the water of respective volume.The program of amplified reaction is with as before.

5. couple sample NC, PC is purified.Sample concentration such as table below is detected before purification with Qubit DNA HS Kit.

Sample for PCR primer does DNA purification process.

Sample names	Concentration (ng/ul)	Taken amount (ul)	Total amount (ng)	Moisturizing (ul)	Cumulative volume (ul)
						NC	89.7	44	3947	6	50
PC	92.2	43	3964	7	50

Above 50ul system is used Agencourt Ampure XP Beads(PN A63880; Beckman Coulter, Brea, CA) purification, purification step is as follows: add 90 μ l Agencourt AMPure in 50 μ l reactant liquors XP magnetic bead (half an hour is from 4 DEG C of taking-ups in advance)；Piping and druming mixes for several times, and room temperature stands 5 minutes；Reaction tube is placed in magnetic frame On, stand 3 minutes；After liquid is clarified, carefully abandon supernatant；Reservation reaction tube, on magnetic frame, adds 200 μ l and joined the same day The ethanol of 80% put；Room temperature is placed more than 30 seconds, and careful shifting abandons liquid；Again adding the ethanol of 200 μ l 80%, room temperature is put Putting more than 30 seconds, careful shifting abandons liquid；Allow magnetic bead at room temperature air-dry 3min, make all ethanol evaporation；Take off reaction tube, add 22ul ddH₂O, with pipettor pressure-vaccum several times with mixing；After room temperature stands 2 minutes, put into and stand 1 minute on magnetic frame；Supernatant After clarification, in transferase 12 0ul supernatant to new 200ul PCR reaction tube.

The position carrying out agarose gel electrophoresis observation amplified band after purification is the most correct.See Fig. 1.Electrophoresis method is: The Agarose glue of configuration 2%；4ul Loading Dye is added in 5 ulDNA；Respectively by 100bp DNA Ladder, NC, 50bp DNA Ladder, PC, 100bp DNA Ladder adds glue hole, and 120V runs glue 2 hours；Take out glue, expose under ultraviolet Light, takes pictures.

6. end reparation and add A(and take from Suzhou bass derivatives Science and Technology Ltd.)

According to the form below adds reagent and mixes:

Sample names	Reaction total amount (ng)	Take volume (ul)	Moisturizing (ul)	EA1(ul)	EA2(ul)
						NC	337.6	3.8	12.2	7.25	1.75
PC	337.6	3.7	12.3	7.25	1.75

Insert in PCR instrument, be carried out as follows reaction:

Reaction condition	Response time
		12℃	15 minutes
37℃	15 minutes
		72℃	20 minutes
4℃	hold

7. jointing (Adapter)

After reaction terminates, being taken out by pipe from PCR instrument, according to the form below adds reagent and mixes:

Sample names	10 × T4 Ligase Buffer(ul)	Index(ul)	T4 DNA Ligase	DdH2O(ul)	Index
						NC	1	1	3	5	11#
PC	1	1	3	5	12#

It is placed in PCR instrument 22 DEG C and hatches 1 hour.

8. the purification of connection product:

(1). connect to 35ul and product adds 15ul H₂It is 50ul that O mends to volume, adds 50ul Ampure XP Beads After (volume ratio 1:1), fully mixing, room temperature stands 5min；(2). place on magnetic frame supreme limpid clearly, inhale abandon supernatant；(3). By 80% washing with alcohol 2 times of fresh configuration；(4). drying at room temperature 3min, take off from magnetic frame, add 52ul H₂O, fully After mixing, room temperature stands 2min；(5). place on magnetic frame supreme limpid clearly, 50ul supernatant sucking-off is transferred to new 200ul In PCR pipe；(6). add 50ul Ampure XP Beads(volume ratio 1:1), fully after mixing, room temperature stands 5min； (7). place on magnetic frame supreme limpid clearly, inhale abandon supernatant；(8). by 80% washing with alcohol 2 times of fresh configuration；(9). room Temperature is dried 3min, takes off from magnetic frame, adds 13ul H₂After O, fully mixing, room temperature stands 2min；(10). on magnetic frame Place supreme limpid clearly, 11ul supernatant sucking-off is transferred in new 200ul PCR pipe.

9.PCR expands

A. by following amount addition reagent in 0.2 centrifuge tube clean for ml PCR:

	NC	PC
			Ligase product(ul)	11	11
KAPA HiFi Hotstart ReadyMix (2 ×) (ul)	12.5	12.5
			Primer (12.5uM) (ul)	1.5	1.5

Add bonnet upper tube cap to flick tube wall immediately and fully mix.

B. centrifuge tube is transferred in PCR instrument, operation following procedure:

C. the purification of PCR primer

(1). in 25ul PCR primer, add 25ul H₂It is 50ul that O mends to volume, adds 50ul Ampure XP Beads After (volume ratio 1:1), fully mixing, room temperature stands 5min；(2). place on magnetic frame supreme limpid clearly, inhale abandon supernatant；(3). By 80% washing with alcohol 2 times of fresh configuration；(4). drying at room temperature 3min, take off from magnetic frame, add 22ul H₂O, fully After mixing, room temperature stands 2min；(5). place on magnetic frame supreme limpid clearly, 20 ul supernatant sucking-offs are transferred to new In 1.5ml EP pipe.

10. library quality inspection

Using Qubit DNA HS Kit quantitative to library, quantitative result is as follows:

Sample names	Library concentration (ng/ul)	Library volume (ul)	Library total amount (ng)
				NC	20.6	20	412
PC	26.4	20	528

Using Agilent 2100 (HS chip) that library carries out fragmentation detection, NC testing result is shown in Fig. 2；PC testing result See Fig. 3.

Testing result meets target, can above machine.

Machine order-checking on 11.

Check order to using Hiseq2500 high-flux sequence platform through the library of quality inspection.

12. high-flux sequence data analysiss

For secondary sequencing result, after having checked order, utilize fastqc software to check all fastq file data quality, utilize BWA software is shown in that gained sequence is compared with reference to genome (hg19) with the mankind, utilizes GATK computed in software target area Reads number, wherein comparison must be divided into 5.For the ease of comparing, carry out similar homogenization (Normalization Method) process.Briefly, compared with all with PC for all for NC fragment Reads sums fragment Reads sums, by gained Ratio is multiplied with each peak area of PC, makes the PC peak Reads number after adjustment compare with the peak Reads number of NC the most respectively.

After homogenization processes, the Reads of the band corresponding with NC sample to PC sample compares.

13. MLPA results

With NC sample as reference, through Coffalyser.Net software analysis, No. 22 chromosomes of PC sample 7 are by examining site for singly to copy Shellfish.In sequence, numbering is respectively 5,14,15,33,39,49,51, is i.e. positioned at CLTCL1, the CDC45 of 22q11 position, GNB1L, DGCR8, ZNF74, MED15 and SNAP29 gene,.

Fig. 4 is shown in by the collection of illustrative plates of the direct capillary electrophoresis of NC sample.Fig. 5 is shown in by the collection of illustrative plates of the direct capillary electrophoresis of PC sample.With NC Sample is comparison, and PC is shown in Fig. 6 through Coffalyser.Net software analysis, result. it can be seen that numbered 5 from figure, and 14, The fragment of 15,33,39,49,51, is i.e. positioned at CLTCL1, CDC45, GNB1L, DGCR8, the ZNF74 of 22q11 position, MED15 and SNAP29 gene, for single copy.

Data have been carried out similar homogeneous by the comparison of two sample MLPA capillary electrophoresis peak areas: for the ease of comparing Change the process of (Normalization Method).Briefly, by all for NC fragment area sums and PC all fragments area Sum is compared, and is multiplied with each peak area of PC by gained ratio, make the PC peak area after adjustment the most respectively with the peak area of NC Relatively.Result is shown in Fig. 7. from the figure it may be seen that the numbered fragment of 5,14,15,33,39,49,51, PC sample and NC sample Peak area compare, be a half left and right, it is judged that the ratio range meeting disappearance sets, meet the thing that these fragments are single copy Real, also consistent with the result of Coffalyser.Net software direct analysis.

14. high-flux sequence results

After high-flux sequence, being analyzed fragment data, during analysis, Fig. 8 is seen at the interface of all softwares.Add up every bar segment Reads number.PC Reads number after original NC Reads number that the Reads number of every bar segment see table and homogenization.With homogenization Rear PC Reads number, than upper original NC Reads, obtains Reads ratio.This table gives peak area warp in MLPA simultaneously PC peak area after the value obtained after Coffalyser.Net software analysis, the original NC peak area that see table and homogenization.With all After one change, original NC peak area on PC peak area ratio, obtains area ratio.

Two sample high-flux sequence Reads numbers compare: for the ease of comparing, data have been carried out similar homogenization The process of (Normalization Method).Briefly, by all for NC fragment Reads sums and all fragments Reads of PC Sum is compared, and is multiplied with each Reads of PC by gained ratio, make the PC peak Reads after adjustment the most respectively with the peak Reads of NC Relatively.Result is shown in Fig. 9. from the figure it may be seen that the numbered fragment of 5,14,15,33,39,49,51, PC sample and NC sample Reads compare, be a half left and right, the fact that meet these fragments for single copy, also with directly carry out MLPA peak area and divide Result obtained by analysis is consistent.

The comparison of 15.MLPA result high-flux sequence result

By ratio and every couple of peak (PC of high-flux sequence of the peak area at the every pair of peak (PC sample and NC sample) obtained by MLPA Sample and NC sample) the ratio of Reads compare, result is shown in Figure 10.The two ratio visible is consistent.Numbered 5, The peak area ratio of 14,15,33,39,49,51 with numbered 5,14,15,33,39,49,51 Reads Value is all about 0.5, and other ratio is all more than 0.8, and less than 1.4.As can be seen here, introduce in the link of MLPA experiment Joint sequence needed for high-flux sequence, and then detect the quantity of each fragment with high-flux sequence, with the copy number of judge templet Variation, is feasible, and its result is completely the same with the capillary electrophoresis result of MLPA.And this technology can be rejected in MLPA and fill out Fill the technological transformation of sequence, be then the disposable high flux gene copy number variation detection far above 60 detection site and gene Abrupt climatic change opens attainable huge space.

Claims

1. the invention discloses a kind of gene copy number variation based on MLPA know-why and the high-flux sequence of gene mutation Detection technique；Comprising the technical scheme of three below key element, the claim by the claims is covered: key element one, skill Art scheme has been used the principle of MLPA technology；Key element two, does one or several link in classical MLPA technical scheme It is adapted to the technological transformation of high-flux sequence requirement；Key element three, employs high throughput sequencing technologies.

2. according to the key element one described in claim 1, it is characterised in that technical scheme has been used the core ring of MLPA technology Joint；The whole link of MLPA includes: link 1, comprises many Species specific probes in MLPA reaction tube, and each probe includes two widows Nucleotide fragments, can be described as upstream probe and downstream probe, and these oligonucleotide fragments can be with chemosynthesis, it is also possible to by M13 Prepared by phage-derived method, it is also possible to obtained by other method；Three or the oligonucleotide of more than three have been used in some detection Fragment collectively forms the component of a probe, also should be regarded as MLPA technology, the most identical；Link 2, the oligonucleotide of each probe Fragment all includes one section of target nucleotide specific sequence and one section of general primer sequence；Link 3, in MLPA reacts, one Two oligonucleotide fragments of probe hybridize position adjacent on DNA respectively, and ligase connects two oligonucleotide fragments； Link 4, after coupled reaction completes, re-uses a pair universal primer and the complete probe connected is carried out multiplex amplification；Link 5, the quantity of the final amplified production of the probe connected, can reflect quantity or the genovariation situation of target sequence；Link 6 is right In final amplified production, detected by certain detection technique means, then use computing formula or software quantitatively or half Derive the quantity of target sequence quantitatively；In the most whole link, link 1, to the core link that link 4 is MLPA technology, is this Technology is different from the key of other technology；Use the link 1 technical scheme to the step of link 4, be i.e. considered as having used MLPA Know-why.

3. according to the key element two described in claim 1, it is characterised in that so-called classical MLPA technical scheme, including with Holland-MRC company is the technical scheme of hundreds of MLPA test kits of company's exploitation of representative, is also included within this technology The deriving technology scheme of upper exploitation, as added three or the universal primer of more than three, in order to make in each reaction tube simultaneously By fluorescent labelinies more than 2 kinds or 2 clocks, and other to have " core link of MLPA technology " in claim 2 equally described The technical scheme of feature；These classical MLPA technical schemes are carried out with secondary order-checking be the technological transformation guided include but not Being limited to following link: link one, comprise many Species specific probes in the reaction tube of classical MLPA technology, each probe includes Two oligonucleotide fragments；Each oligonucleotide fragment includes one section of target nucleotide specific sequence and one section of general primer Sequence；By universal primer sequence change or increase to high-flux sequence joint sequence [joint include with flow cell (flow Cell) sequence combined, the DNA fragmentation being connected to joint carries out the primer binding sequence needed for PCR amplification, and high-flux sequence draws Thing binding sequence, including or do not include label (the indexing or barcoding) sequence etc. for distinguishing different sample； The typical joint sequence that Illumina company provides is: TruSeq Universal Adapter:5 '- AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCT -3’；TruSeq Indexed Adapter:5 '-GATCGGAAGAGCACACGTCTGAACTCCAGTCAC NNNNNN ATCTCGTATGCCGTCTTCTGCTTG -3 '] so that after completing with the hybridization of determined nucleic acid target sequence, coupled reaction, the LM-PCR (Ligation for building storehouse can be carried out Mediated PCR) reaction, this PCR also plays the effect of pair of primers multiplex amplification in MLPA simultaneously；Height in joint sequence Flux primer binding sequence then can be used for high-flux sequence after upper machine；Link two: include one section of target nucleotide specific sequence With the oligonucleotide fragment of one section of universal primer sequence, the coupled reaction being connected to two parts probe in hybridization and ligase completes After, enter universal primer amplification link；The universal primer used, except containing leading in oligonucleotide fragment in structure Outside part with sequence combination, its 5 ' end additionally contains the joint sequence of promising high-flux sequence purpose, is referred to as lengthening general drawing Thing；After having expanded with lengthening universal primer, amplified production is with being combined with flow cell and carry out the sequence checked order；Institute The lengthening universal primer used, also can comprise or not comprise the sequence label for distinguishing different sample；Link three, includes One section of target nucleotide specific sequence and the oligonucleotide fragment of one section of general primer sequence, at hybridization, connection, general common After primer amplification completes, purified, increase a link adding joint；Added joint is the joint that high-flux sequence builds storehouse； This joint can comprise or not comprise the sequence label for distinguishing different sample；After adding top connection, before upper machine checks order Other step such as LM-PCR, purification etc. carries out upper machine order-checking；Every any one link employed in three above link Technological transformation, or the United Technologies transformation of multiple link, or other the technology met for the purpose of high-flux sequence Transformation, is all considered as having done one or several link in classical MLPA technical scheme being adapted to the technology that high-flux sequence requires Transformation.

4. according to the key element three described in claim 1, it is characterised in that so-called high throughput sequencing technologies (High- Throughput sequencing), also known as " of future generation " sequencing technologies (" Next-generation " sequencing Technology), once parallel hundreds of thousands to millions of even more DNA molecular can be carried out sequencing for mark Will, the degree of depth that is otherwise known as order-checking (deep sequencing)；From order-checking platform in terms of, high throughput sequencing technologies platform include but not It is limited to: (1) Roche/454 checks order platform；(2) Illumina/Solexa order-checking platform；(3) ABI SOLiD order-checking platform；(4) Ion Torrent checks order platform；(5) CG (Complete Genomics) order-checking platform；Every employing is put down based on above five The sequencing reagent that platform develops and order-checking instrument, or other the sequencing reagent having high-flux sequence feature and sequenator Device, is all considered as employing high throughput sequencing technologies.

Method the most according to claim 2, it is characterised in that use the technical scheme of MLPA know-why, including but not It is limited to following field: field one, numerical abnormalities of chromosomes；Field two, genetic diseases gene delection repeats；Field three, SNP examines Survey；Field four, genetic diseases genovariation (base substitution, disappearance, insert, disappearance/insert, inversion etc.) detection；Field five, base Because of DNA methylation assay；Field six, antioncogene diagnoses；Field seven, mRNA copy number is analyzed；Field eight, microRNA copy number Analyze.

Method the most according to claim 2, it is characterised in that every MLPA technology or its deriving technology are (such as MS- MLPA, RT-MLPA, CNVplex etc.) carry out detecting, i.e. it is considered as having used the know-why of MLPA.

Method the most according to claim 2, it is characterised in that described determined nucleic acid can from but be not limited to following animal (bag Include people) in sample extracting and come: blood, blood plasma, serum, urine, expectorant, spinal fluid, cerebrospinal fluid, hydrothorax, nipple aspirate fluid, pouring Bar liquid, it is derived from the liquid of breathing, intestinal or genitourinary system, tear, saliva, breast milk, is derived from lymphoid liquid, essence Liquid, cerebrospinal fluid, organ built-in system liquid, ascites, tumor capsule liquid, amniotic fluid, biopsy, paraffin-embedded tissue or their group Close.

Method the most according to claim 2, it is characterised in that described determined nucleic acid is derived from including virus and antibacterial Pathogen.

Method the most according to claim 2, it is characterised in that described determined nucleic acid is derived from genetically modified organism, described in turn base Because biology includes that transgenic plant and transgenic animal, described transgenic plant include but not limited to: transgenic corns, transgenic Oryza sativa L., genetically engineered soybean and transgene cotton, described transgenic animal include but not limited to: transgenic cow, transgenic pig, turn base Because of sheep and transgenic Canis familiaris L..