CN112779320A

CN112779320A - Multi-region DNA methylation detection probe design and detection method thereof

Info

Publication number: CN112779320A
Application number: CN202011411717.7A
Authority: CN
Inventors: 王君文; 胡琪; 苏锦玲; 高飞
Original assignee: Shenzhen E Gene Technology Co ltd
Current assignee: Shenzhen E Gene Technology Co ltd
Priority date: 2020-12-04
Filing date: 2020-12-04
Publication date: 2021-05-11
Anticipated expiration: 2040-12-04
Also published as: CN112779320B

Abstract

The invention relates to the technical field of gene detection, in particular to a DNA methylation detection method of multiple gene regions and a probe design application thereof, wherein the method comprises the following steps: carrying out sulfite conversion on the genomic DNA to be detected; designing primers aiming at different target detection genes and constructing capture probes; performing PCR amplification on a target region by using a specially designed probe; constructing a library of the amplified DNA of the target region and sequencing the library; and analyzing the original data obtained by sequencing, removing amplification repetition, and calculating the methylation level of the target detection site. The detection method can realize the one-time whole amplification of a plurality of genes under the same template, and greatly reduces the operation complexity and the detection period of the multi-gene methylation detection.

Description

Multi-region DNA methylation detection probe design and detection method thereof

Technical Field

The invention relates to the technical field of gene detection, in particular to a DNA methylation detection method of a polygene region and a probe design thereof.

Background

DNA methylation is the most stable modification, the most abundant content, the most active gene regulation and the most extensive modification in epigenetic research. The modification of different gene regions or sites is closely related to embryonic development, disease occurrence and development, and is also a bridge for the influence of external environment on the body.

For DNA methylation detection, a series of different methods are available, which can be applied to different sample types or detection requirements.

For example, whole genome sulfite sequencing (WGBS) directed to a second generation high throughput sequencing platform. The method can accurately detect the methylation level of each cytosine, and the technology has the advantages of widest detection range and most accurate quantitative detection. However, this technique is expensive and difficult to be applied to the detection of DNA in large genomic species such as human, and is limited to exploratory research and analysis with a small sample size.

Protein/antibody capture-based sequencing techniques, such as MeDIP or MDA sequencing, can also detect the methylation modification distribution of the whole genome, but cannot achieve the analysis of single base modification level, and the result is influenced by the methylation level of the protein and the sequence preference around the modified base. This technique is difficult to meet if the methylation molecular markers are detected against the genome fixation sites.

In order to reduce the detection cost, methylation detection technologies of the core region of the genome are published in succession, and the established simplified genome methylation detection technology (RRBS/DRRBS) can specifically detect about 70% of promoters and partial CG sites of CG islands of the genome by recycling small fragments of enzyme digestion products for sulfite treatment and sequencing through MspI and different enzyme digestion combinations. However, the detection site is relatively fixed by selecting different enzymes and the range of the enzyme digestion product fragments, so that the detection flexibility for different gene regions is insufficient. This technique has reduced the cost of a single sample to within a few thousand dollars compared to WGBS, but there is still distance from the practical application of hundred dollar cost.

Then, a liquid phase capture sulfite methylation sequencing technology (LHC-BS) is further established, the technology can be used for randomly selecting a detection gene or a genome region, fishing an original genome target sequence through a designed capture probe, and analyzing the methylation level of each site in a target gene interval through sulfite treatment sequencing. Compared with the WGBS, the technology has lower cost and is more flexible and changeable in detection area compared with the RRBS. However, for clinical detection applications of several tens to several hundreds of genes, the technology needs to be further optimized in terms of cost control, detection period, and the like.

In the process of implementing the invention, the inventor finds that the following problems exist in the related art: methylation analysis of several genes is currently detected in the laboratory by methylation-specific PCR amplification electrophoresis or qpcr (msp) analysis, or Sanger sequencing after sulfite PCR amplification of genomic DNA and product cloning. The two technologies respectively face the defects of low sensitivity, complex operation, long period and high cost.

On one hand, sulfite locked probes (BSPP) are respectively designed at the upstream and downstream of a target DNA detection site, two probes are anchored by a section of fixed DNA sequence, the probes are annealed, extended and connected to amplify the target site, and sequencing detection is carried out. Because of the presence of the anchor linker, the span of the gene region to be detected is limited, and is usually within 50 bp. And the problems of period, cost and the like exist in the practical application process.

In addition, for the detection of genetic variation, the DNA template is the original genome sequence, the base distribution of ATCG is relatively balanced, and the influence of the complexity of the primer on the amplification of the target gene is acceptable. After genome DNA is transformed by sulfite, all the C bases which are not methylated and modified are converted into U (equivalent to T) bases, the sequence unicity is increased, the amplification of a pure target gene primer is difficult, and the amplification efficiency of the primer is more limited by increasing the complexity. The primer design and detection process applied to genetic variation is directly moved to the detection of methylated polygenes, and the validity of amplification is difficult to meet.

Disclosure of Invention

In view of the above technical problems, embodiments of the present invention provide a DNA methylation detection method for multiple gene regions and a probe design thereof, and simultaneously, a rapid library construction method is constructed for amplification products, so as to reduce the use of enzyme species and simplify the reaction process, thereby solving the problems of high application cost, long time, limited effect and the like in clinical detection based on DNA methylation multiple gene amplification in the prior art.

The first aspect of the embodiments of the present invention provides a probe for DNA methylation detection, wherein the probe is modified by a PCR primer, and includes an upstream amplification capture probe and a downstream amplification capture probe, and is configured to amplify one or more DNA detection regions in a sample to be detected, so as to generate a corresponding amplification product. Wherein the length of the DNA detection interval is less than 600 bp; target detection sites in the DNA detection interval are distributed in the range of 140bp at two ends of the amplification product; the length of the probe is 18-40bp, the DNA covered by the probe does not contain a cytosine-guanine dinucleotide sequence, and the cytosine base number of the non-cytosine-guanine dinucleotide sequence in the probe is not less than 1.

The annealing temperature of the upstream amplification capture probe and the downstream amplification capture probe in different DNA detection intervals and in the same DNA detection interval is 55 +/-15 ℃; and Y pyrimidine in the DNA detection interval is continuously repeated for no more than 20 bases, and is thymine or uracil.

The downstream amplification capture probe is fused with a polymer of 6-12 random bases; the aggregate of 6-12 random bases is a molecular marker used for distinguishing the template source of the amplification product.

And the upstream amplification capture probe is used as a blocking sequence of a downstream amplification capture probe for amplifying and labeling a product, and the generated single-stranded DNA is blocked and extended to form a double-stranded amplification product.

Optionally, the aggregate of 6-12 random bases is fused to the upstream amplification capture probe;

optionally, the length of the DNA detection interval is 200-280 bp; the target detection sites are distributed in the range of 100bp of the 5' end of the amplification product.

Optionally, the length of the probe is 25-30bp, and the number of cytosine bases of the non-cytosine-guanine nucleotide sequence in the probe is 3-10.

Optionally, the annealing temperatures of the upstream amplification capture probe and the downstream amplification capture probe in different DNA detection intervals and in the same DNA detection interval are 55 ℃ +/-5 ℃, and after a certain cycle, the annealing temperature is subjected to gradient temperature increase and decrease amplification.

In a second aspect of the embodiments of the present invention, a method for detecting DNA methylation of multiple gene regions is provided, wherein the method includes: carrying out sulfite conversion on the genomic DNA to be detected; performing PCR amplification of the target region of the sulfite-converted genomic DNA using the probe as described above; constructing a library of the amplified DNA of the target region and sequencing the library; and analyzing the raw data obtained by sequencing, and calculating the methylation level of the target detection site.

During PCR amplification, the upstream amplification capture probe and the downstream amplification capture probe are mixed by molar quantity calculation, and the ratio is 4:1 to 1: 1, i.e., the upstream amplification capture probe is at a high concentration relative to the downstream amplification capture probe.

The invention further constructs a one-step library construction process for the amplified product, and reduces the experimental process and the enzyme use types. In the process of library construction, the PCR amplification product and the linker SEQ2 or SEQ6 are subjected to 5' end phosphorylation modification by using T4 polynucleotide kinase, and the linker is added to the end of the PCR amplification product under the action of T4 DNA ligase under the same system.

The technical scheme provided by the embodiment of the invention can realize the one-time whole amplification of a plurality of genes under the same template, thereby greatly reducing the operation complexity and the detection period of the multi-gene methylation detection.

Further, by specifically designing the 5' end fusion (N) of the downstream amplification capture probe_6-12And the base group solves the problem of source identification of an amplicon template in the target gene PCR amplification methylation analysis. Therefore, the method can realize that the subsequent data analysis can filter the sequencing sequences of the amplicons from the same template, and further realize that the detection result represents the in-vivo real situation.

Furthermore, in the process of amplifying the gene sulfite, the designed upstream amplification capture probe is used as a primer to amplify a target fragment, and simultaneously plays a role in closing downstream PCR amplification capture probe amplicons to assist in realizing the identification of the amplicon template source.

Further, in the library construction process, the amplification product is directly subjected to phosphorylation modification and joint connection, so that library construction is rapidly completed. The whole technical process has low cost for detecting the multi-gene methylation of a single sample, can quickly provide a detection result and provides a reliable technical support for the clinical development of methylation.

Drawings

FIG. 1 is a schematic diagram showing an embodiment of a method for detecting DNA methylation of multiple gene regions according to an embodiment of the present invention;

FIG. 2 is a schematic diagram of an embodiment of the library fragment distribution test according to an embodiment of the present invention;

FIG. 3 is a graph showing the results of methylation levels of CG sites in different regions according to the present invention.

Detailed Description

The technical solutions in the embodiments of the present invention will be clearly and completely described below with reference to the drawings in the embodiments of the present invention, and it is obvious that the described embodiments are only a part of the embodiments of the present invention, and not all of the embodiments. All other embodiments, which can be derived by a person skilled in the art from the embodiments given herein without making any creative effort, shall fall within the protection scope of the present invention.

In order to effectively amplify and accurately detect the methylation level of the corresponding site, the embodiment of the invention provides a corresponding probe and primer design principle. Based on the principle or principle of primer design disclosed in the embodiments of the present invention, those skilled in the art can adjust, replace or combine the primers according to the needs of actual situations, and the probes or PCR primers obtained by synthesis are all within the scope of protection of the present application.

The probes may be PCR primers, including an upstream amplification capture probe and a downstream amplification capture probe. By the PCR technology, one or more DNA detection intervals in a sample (namely a template) to be detected can be specifically and rapidly amplified to form corresponding amplification products for subsequent methylation detection.

Wherein, when the probe is designed, the length of the DNA detection interval amplified by the probe is required to be less than 600 bp. Preferably, the length of the DNA detection region is controlled to be between 200 and 280 bp.

Within the DNA detection interval, there are some CG sites (C is cytosine and G is guanine) that must be detected, and may also be referred to as "target detection sites" in this specification. These target detection sites are distributed in the range of 140bp at both ends of the amplification product.

In some embodiments, the target detection sites may be preferentially designed to be distributed within 140bp of the 5 'end of the amplification product, and more preferably may be distributed within 100bp of the 5' end of the amplification product.

Secondly, the range of 140bp distributed at the 3 'end of the amplification product may be selected, and more preferably, the range of 100bp distributed at the 3' end of the amplification product may be selected.

In particular, the amplification capture probe length should also be controlled within a specific acceptable range. In this example, the length of the probe is 18-40 bp. More specifically, the probe length can also be selected in the range of 20-35 bp. Preferably, the optimal length range of the probe is 25-30 bp.

In addition, for the upstream and downstream capture probes for amplifying the target gene, it is required that the genomic DNA completely covered with the probes does not contain any CG dinucleotide sequence (i.e., the DNA covered with the probes does not contain a cytosine-guanine dinucleotide sequence). Meanwhile, the number of C bases of the non-CG dinucleotide sequence in the probe is not less than 1, and preferably, 3 to 10.

In some embodiments, the annealing temperature of the amplification capture probes between the different gene compartments and upstream and downstream of the same gene compartment is 55 ℃ ± 15 ℃. Preferably, the optimal annealing temperature is 55 ℃ +/-5 ℃. And for the target detection gene interval, the Y pyrimidine (C/T, namely the Y pyrimidine represents thymine or uracil) in the interval is continuously repeated for no more than 10 bases.

In a preferred embodiment, the probe further comprises (N)_6-12Random bases. (N)_6-12Random bases are molecular markers, can distinguish the source of an amplicon template, and are used for identifying and removing amplicons obtained from the same genomic DNA template in a multi-cycle amplification process.

In this specification, (N)_6-12The random base means a polymer of 6 to 12 random bases (N means an arbitrary base). (N)_6-12Random bases may be selected to fuse with either the upstream or downstream amplified capture probes (but not both upstream and downstream).

The surprising discovery that (N)_6-12When the random base is fused with a downstream amplification capture probe, the source of an amplicon template can be better identified. Specifically, the downstream amplification capture probes function to recognize the transformed genomic DNA and label the template-derived amplicons with the corresponding molecules.

Preferably, the upstream amplification capture probe is further designed to block the amplicon generated by the downstream amplification capture probe while forming the amplification product into a double strand. Therefore, the binding of the upstream amplification capture probe and the processed genome template can be effectively avoided, and the recognition and amplification of the upstream amplification capture probe on the transformed genome template can be further inhibited.

FIG. 1 is a flow chart of the method for detecting DNA methylation of multiple gene regions according to the embodiment of the present invention. As shown in fig. 1, the method may include the steps of:

100. and performing sulfite conversion on the genomic DNA to be detected.

In the actual detection process, about 500ng of genomic DNA was used as a sample to be detected. Firstly, high ruthenate oxidizer is selected for pre-oxidation or TET enzyme is selected for biological reaction. Then, the oxidation reaction product is further reacted with 1M to 10M sulfite.

The sulfite can be prepared by itself, or can be purchased directly and used with commercial kits (such as ZYMO Research, Qiagen). And the effect of the potassium perruthenate oxidation is to further remove the interference of the hydroxymethylation signal. The working concentration of the potassium ruthenate is 0.15mM-150mM, and the optimal working concentration is 5-25 Mm.

200. The probes obtained by the design principle of the above examples are used for carrying out single-tube PCR amplification and molecular labeling on the target detection region of the genomic DNA after sulfite conversion.

In order to realize fast fishing, especially methylation information of detection sites distributed in a multi-gene interval, the probe design principle provided by the above embodiment is used in the embodiment of the invention, and an upstream amplification capture probe and a downstream amplification capture probe are respectively designed for different regions in the upstream and the downstream.

Preferably, the downstream amplification capture probe is combined with a random sequence of 6-12 bases to form a downstream PCR fishing primer. The upstream amplification capture probe is completely derived from a converted target DNA template and is used for fishing a primer for upstream PCR so as to reduce the complexity of the primer.

Before PCR fishing amplification, the upstream and downstream PCR fishing primers were as follows 4:1 to 1: 1 molar weight was mixed. Specifically, the optimal molar ratio is 1.5: 1 to 2: 1, the best amplicon can be obtained and its template source identified.

The concentration of each primer is 0.01-1uM after mixing, the total concentration of all fishing primers is 10-20uM after mixing, and the fishing primers are used as working primers for fishing and PCR amplification of each target detection site.

PCR amplification enzymes PCR polymerases without 3 'to 5' exonuclease activity, such as taq enzymes, can be used. On the basis, genome DNA converted by sulfite is taken as a template, PCR fishing primers mixed in equimolar mode are taken as working primers for PCR amplification, and the aim of fishing and enriching all target sites is fulfilled through 30-45 rounds of amplification and extension at the annealing temperature of 45-65 ℃.

Preferably, the degradation temperature is subjected to gradient temperature increase and decrease amplification after a certain cycle. The setting of the annealing temperature comprises gradually raising the temperature of each cycle gradient, and one to a plurality of different annealing temperatures can be selected according to different cycle numbers and the combination characteristics of primers in the PCR amplification process.

300. And constructing a library by using a one-step library construction technology for the amplified DNA products of the target methylation detection region, and performing high-throughput sequencing. Therefore, the cost can be reduced, and the resolution of the amplicon from the amplification product template can be improved.

The conventional second-generation sequencing comprises a plurality of operation processes of genome disruption, terminal repair, terminal A addition, joint connection and the like, and the time consumption is long.

In a preferred embodiment, the PCR amplification product is subjected to 5' phosphorylation modification directly by using T4 polynucleotide kinase, and a linker is added to the end of the PCR amplification product under the action of T4 DNA ligase, so as to complete the task of directly connecting the PCR amplification product with the linker. The direct connection joint library building method does not need the participation of other enzymes in the reaction process, only needs one-step reaction, does not need to add other reagents in the reaction process, is simple and quick, and can effectively simplify the library building process and realize clinical rapid detection.

In some embodiments, the product is linked to the linker sequences of SEQ1 and SEQ2 or SEQ5 and SEQ6 under the same system, while under the action of T4 DNA ligase; and adding a joint to the end of the PCR amplification product. The 5' end may not be modified for phosphorylation when the linker sequence SEQ2 and the linker sequence SEQ6 are synthesized.

In other embodiments, the target DNA methylation detection product linked to the linker sequences of SEQ1 and SEQ2 or SEQ5 and SEQ6 is subjected to a further secondary PCR amplification with the help of the primers of SEQ3 and SEQ4 or SEQ7 and SEQ 8; the PCR amplification outer primer SEQ8 needs phosphorylation modification during synthesis.

And further performing low-cycle PCR amplification (3-8 cycles) on the amplicon library building product under the action of PCR amplification primers and PCR enzymes of different sequencing platforms to form a sequencing library for sequencing.

400. Analyzing the original data obtained by sequencing, removing the methylation information of the repeated sequences of the amplification products from the same template source according to the molecular markers, and accurately calculating the methylation level of the target detection sites.

For example, the same or different methylation detection region data resolution of different samples can be first performed based on the base molecular markers of the outer primers SEQ4 and SEQ 6; after data splitting and quality filtering, for the sequencing data of the amplification product of the known locus detection gene, further filtering the template source amplicon through the molecular marker fused with the downstream amplification capture probe, calculating the methylation level of each locus according to the filtered data, wherein the conversion rate is not lower than 98%.

The original data result obtained by sequencing can be analyzed through corresponding data to obtain the required methylation detection result. In some embodiments, data splitting and preprocessing can be performed on different samples based on different molecular marker base sequences of the outer primers, and then raw data obtained by sequencing splitting are subjected to decontamination, joint removal and low-quality filtration respectively to obtain high-quality value filtration data.

The obtained high-quality value filtration data is further subjected to secondary filtration on each amplification gene in the sample according to the same identification sequence through a 5' end amplification template identification sequence designed in a downstream PCR fishing probe.

And intercepting 6-12 recognition base sequences from the secondary filtering data, and analyzing the consistency of the two corresponding sequencing sequences and the upstream and downstream amplification capture sequences again.

After analysis, available data are further compared, the methylation modification level of each CG locus is calculated, meanwhile, the methylation conversion efficiency in the experimental process is evaluated through the methylation calculation level of C bases in CHH loci, and the reliability of experimental data is determined.

It can be seen that the methylation level at each C site is calculated by dividing the number of detections of C at the site by the total number of detections of C and T at the site in the sequencing data, i.e. the percentage methylation at each site is equal to C/(C + T). For amplicon methylation based detection.

Because the detection (including sequencing, cloning, mass spectrometry and other different techniques) is performed on the amplicon product, the different amplicon sequences of the same gene may be mostly derived from the same genomic DNA template, i.e., all represent the methylation modification state of one cell. Therefore, when the source of the amplicon template cannot be distinguished, the detection result is biased to the methylation level of the cell with high PCR amplification efficiency, and deviates from the real in vivo methylation distribution.

According to the technical scheme provided by the invention, the template sources of different amplicons can be distinguished through specific probe design, the subsequent data analysis can be realized, the sequencing sequences of the amplicons from the same template source can be filtered, and the detection result can represent the in-vivo real situation.

Specific examples of linker sequences and PCR outer primer sequence structures constructed from the library following PCR amplification are provided below:

Illumina

SEQ1: linker 1: tacactctttccctacacgacgctcttccgatct

SEQ2: linker 2: gatcggaagagcacacgtctgaactccagtcac

SEQ3 outer primer 1: aatgatacggcgaccaccgagatctacactctttccctacacgacgctcttccgatct, respectively;

SEQ4 outer primer 2: caagcagaagcaacggcatacagagittiiiiiigtgactggagttcagacgtgttgccttccgatct

MGI/BGI

SEQ5: linker 1': ttgtcttcctaaggaacgacatggctacgatccgactt

SEQ6: linker 2': agtcggaggccaagcggttcttagggaagacaaiiiiiiiiiiiicaactccttggctcaca

SEQ7: outer primer 1': tgtgagccaaggagttg

SEQ8: outer primer 2': gaacgacatggctacga

Wherein Illumina refers to a linker and primer sequence developed based on a series sequencer of the company Illumina. And MGI/BGI refers to a joint and a primer sequence developed based on a sequencer of Huada gene MGI and BGI series. If necessary, other sequencing platforms can be used, and those skilled in the art can convert them as required by the actual situation.

The detection method provided by the embodiment of the invention can be widely applied to a series of scenes such as screening of DNA methylation molecular markers, development of scientific research/medical gene detection products, application of gene detection consumption products, embryo development, identification and detection of transplanted DNA methylation, early disease screening, medication guidance and accurate treatment, disease risk prediction and accurate diagnosis, tumor medication accompanying diagnosis and prognosis analysis and the like.

The probe design and methylation detection procedures of the embodiments of the present invention are described in detail below with reference to specific examples. In this example, DNA having 10 regions, among which a region falling on a gene and a region falling on an intergenic region of a reference genome, among which methylation information at 54 sites (which have been marked with black italics) can be detected, is used as a detection target sequence of the reference genome.

SEQ9: region 1:

SEQ10: region 2:

SEQ11: region 3:

SEQ12: region 4:

SEQ13: region 5:

SEQ14: region 6:

SEQ15: region 7:

SEQ16: region 8:

SEQ17: region 9:

SEQ18: region 10:

firstly, designing and synthesizing a probe:

the upstream amplification capture probe and the downstream amplification capture probe designed and synthesized according to the probe design principle provided by the embodiment of the invention are specifically as follows:

upstream amplification capture probe:

SEQ19 Probe 1: gtttgagttgaggaaagaggtttt

SEQ20 Probe 2: gtttgagttgaggaaagaggtttt

SEQ21 Probe 3: tataattaagaaaaggagaaatatagagag

SEQ22 Probe 4: aattttgattgatttgattaagtgt

SEQ23 Probe 5: tttgtttttggttttgtgtttagaa

SEQ24 Probe 6: tgggttaagtttgttgtaggatagg

SEQ25 Probe 7: tagggtggggtatttggatttata

SEQ26 Probe 8: ttaggttgaattatagtttatatgtgtttt

SEQ27 probe 9: ttaaattaagatttggggtaaagttg

SEQ28 probe 10: ttttttattttgtgggttaggagtt

Downstream amplification capture probe:

SEQ29 Probe 11: nnnnnnnnnnnnnnnnnnnacctacaaaacccaaaattctaat

SEQ30 Probe 12: nnnnnnnnnnnnnnnnnnnacctacaaaacccaaaattctaat

SEQ31 Probe 13: nnnnnnnnnnnnntaaaacccaatctaataaaaaaa

SEQ32 Probe 14: nnnnnnnnnnnaaaataacacactttaaaaaaaaa

SEQ33 Probe 15: nnnnnnnnnnnanaaaaatactatatatacatacataca

SEQ34 Probe 16: nnnnnnnnnnnttcccttcaactaaaatttccaaaac

SEQ35 Probe 17: nnnnnnnnnnnttcctcctctcctaaaacaaaattaa

SEQ36 Probe 18: nnnnnnnnnnnattacaaataaaacacac

SEQ37 Probe 19: nnnnnnnnnnnnntaacattaacatacacatacacacaccaccacac

SEQ38 probe 20: nnnnnnnnnnnnncaaacactactacaaaatccttaaactaacta

After synthesis, the upstream amplification capture probes were mixed equimolar, with a final concentration of 1uM for each probe, and the downstream amplification capture probes were mixed equimolar, with a final concentration of 1uM for each probe. After dilution, the mixed upstream and downstream amplification capture probes were mixed according to a 2: 1, labeled as the PCR amplification working primer.

Secondly, methylation detection process:

2.1 genomic DNA sulfite treatment:

500ng of genomic DNA was collected and used as EZ DNA Methyli on-Gold from ZYMO Research^TMKit sulfite transformation Kit, according to the Kit operation instructions to the whole genome DNA sulfite treatment and purification.

2.2 PCR simultaneously captures and amplifies the methylation information of 54 detection sites:

first, a PCR reaction solution was prepared on ice as follows:

then, PCR amplification was performed on a PCR instrument according to the procedure shown in Table 1 below, and after the amplification product was purified, the concentration of the amplicon was measured by Qubit.

Table 1

2.3 Rapid construction of library:

firstly, taking 20-50ng of purified amplification product, and preparing a reaction solution in a PCR tube according to the following system:

after the preparation is finished, reacting for 30min at 20 ℃ in a PCR instrument; after the reaction, the product was purified with 0.9 times of magnetic beads, and the DNA was eluted into 30ul of the eluate.

2.4 library PCR amplification:

first, a reaction solution was prepared in a PCR tube according to the following reaction system:

adaptor ligation amplification product 23ul

2X PCR Ready Mix 25

Outer primers 1 and 2 or outer primers 1 'and 2' (10uM) 2

Then, after the reaction system was configured, the reaction was performed in a PCR instrument according to the procedure shown in table 2 below:

table 2

Thirdly, data analysis and result display:

before the operation, the library is subjected to library fragment distribution detection through an Agilent 2100 bioanalyzer or a microfluidic capillary electrophoresis system (the result is shown in figure 2), the concentration of the library is detected by using QPCR, and the library is subjected to Illumina or MGI/BGI sequencing platform for sequencing if the library is qualified.

After data is downloaded, original data obtained by sequencing is subjected to data splitting and preprocessing on different samples based on different molecular marker base sequences of an outer primer, then original data obtained by sequencing splitting are subjected to decontamination, joint removal and low-quality filtration respectively, obtained high-quality filtration data are subjected to 5' end amplification template recognition sequences designed in a downstream PCR fishing probe, amplification genes in the samples are subjected to secondary filtration according to the same recognition sequences, 6-12 recognition base sequences are obtained by secondary filtration data interception, the consistency of the two end sequences and an upstream and downstream amplification capture sequence is analyzed, and finally, the methylation modification level of each CG locus and the conversion efficiency of C bases in all CHH loci are calculated through data comparison.

The final calculation results of the methylation modification levels (methylation modification level, coverage depth and conversion efficiency) of 54 CG sites in 10 regions are shown in FIG. 3.

The embodiment of the invention provides a genome multi-region DNA single-base methylation detection method and a probe thereof. When the probe is designed, the multiple genes are completely amplified at one time under the same template through technical optimization and primer design parameter adjustment, the operation complexity of the multiple-gene methylation detection is greatly reduced, the detection period is greatly reduced, and no matter how many genes are detected, the technology can complete an experiment within one day and start to carry out sequencing on the machine.

Moreover, the problem of identifying the source of an amplicon template in the analysis of target gene PCR amplification methylation is solved by specifically designing (N)6-12 bases fused with the 5' end of a downstream PCR fishing primer. In addition, in the process of amplifying gene sulfite, the designed upstream PCR fishing primer is used as a primer for amplifying a target fragment, and simultaneously plays a role in closing a downstream PCR fishing primer amplicon, thereby assisting in realizing the identification of the amplicon template source.

Therefore, the problems that the detection result is more biased to the methylation level of cells with high PCR amplification efficiency and deviates from the real in-vivo methylation distribution because the source of the amplicon template cannot be distinguished can be solved.

On the other hand, the detection period and the cost of the detection method provided by the embodiment of the invention are greatly saved. In addition to the multi-gene methylation one-step amplification, in the library construction process, the amplification product is directly subjected to phosphorylation modification and joint connection, and the library construction is completed within 30-60 min. The detection cost of the whole technical process for the multiple gene methylation of a single sample can be controlled within 100 yuan. The rapid detection result provides reliable technical support for the clinical development of methylation.

It should be understood that the technical solutions and concepts of the present invention may be equally replaced or changed by those skilled in the art, and all such changes or substitutions should fall within the protection scope of the appended claims.

Claims

1. A probe for DNA methylation detection is a modified PCR primer, comprises an upstream amplification capture probe and a downstream amplification capture probe, is used for amplifying one or more DNA detection intervals in a sample to be detected and generating corresponding methylation amplification products, and is characterized in that,

the sample to be detected is mammalian genome DNA;

the length of the DNA detection interval is less than 600bp, Y pyrimidine in the genome DNA detection interval is continuously repeated for no more than 20 bases, the Y pyrimidine comprises thymine or cytosine, target methylation detection sites in the DNA detection interval need to be distributed in the range of 140bp at two ends of the amplification product, and are preferentially located in the range of 140bp at the 5' end.

2. The probe of claim 1, wherein the probe is suitable for human peripheral blood, bone marrow cells, patient tissues and body fluids, and is used for DNA methylation detection of clinical samples for disease screening, medication guidance, concomitant diagnosis and prognosis.

3. The probe of claim 2, wherein the downstream amplification capture probe is engineered to amplify a complex of 6-12 random bases fused to the 5' end of the primer, SEQ 29-38; the upstream amplification capture probe is an amplification primer SEQ 19-28;

6-12 random bases of the downstream amplification capture probe are molecular markers, and the upstream amplification capture probe cannot be simultaneously marked, so that the template sources of the amplification products can be distinguished.

4. The probe of claim 3, wherein the genomic DNA covered by the amplification primers does not contain a continuous cytosine-guanine dinucleotide sequence, and the discontinuous cytosine-guanine dinucleotide sequence has no less than 1 cytosine base, the upstream primer performs cytosine-thymine conversion, and the downstream primer performs guanine-adenine conversion;

the annealing temperature of the amplification primers, different DNA detection intervals and the upstream amplification primer and the downstream amplification primer in the same DNA detection interval is 55 +/-15 ℃, and the length of the amplification primers is 18-40 bp.

5. The probe of claim 3, wherein the downstream amplification capture probe is used as a fishing primer for the target gene to amplify the methylation detection site of the target gene to obtain a single-stranded DNA and complete molecular labeling, and the high-concentration upstream amplification capture probe is used as a blocking sequence for a single-stranded DNA amplification product to block the single-stranded DNA amplification product and simultaneously extends to form a double-stranded amplification product;

the high-concentration upstream amplification capture probe is used for ensuring the accuracy of molecular marking, and the molar concentration ratio of the upstream amplification capture probe to the downstream amplification capture probe in the amplification of the target methylation site is not less than 1.

6. A method for detecting DNA methylation of multiple gene regions, comprising:

carrying out sulfite conversion on the genomic DNA to be detected;

performing single-tube PCR amplification and molecular labeling of a sulfite-converted genomic DNA target detection region using the upstream amplification capture probe and the downstream amplification capture probe of any one of claims 1-4;

constructing a library for the amplified DNA product of the target methylation detection region by using a one-step library construction technology and performing high-throughput sequencing;

analyzing the original data obtained by sequencing, removing the methylation information of the repeated sequences of the amplification products from the same template source according to the molecular markers, and accurately calculating the methylation level of the target detection sites.

7. The method for detecting DNA methylation according to claim 6, wherein when single-tube PCR amplification is performed, the upstream amplification capture probe and the downstream amplification capture probe of all designed amplification regions are mixed according to molar weight, and the ratio is 1.5: 1 to 4: 1; PCR polymerase without exonuclease activity is selected for amplification, the annealing temperature is 45-65 ℃, and after certain circulation, gradient temperature rise and fall amplification is carried out at the annealing temperature.

8. The DNA methylation detection method according to claim 6, wherein in the library construction process of constructing the library by using the one-step library construction technology, the PCR amplification product is subjected to 5' phosphorylation modification by using T4 polynucleotide kinase, and the modified product is connected with the linker sequences of SEQ1 and SEQ2 or SEQ5 and SEQ6 under the same system and the action of T4 DNA ligase;

the linker sequence SEQ2 and the linker sequence SEQ6 may be synthesized without phosphorylation at the 5' end.

9. The method for detecting DNA methylation according to claim 6, wherein when the library is constructed by using the one-step library construction technology, a secondary PCR amplification is further performed on a target DNA methylation detection product connected with the linker sequences of SEQ1 and SEQ2 or SEQ5 and SEQ6 under the action of the primers of SEQ3 and SEQ4 or SEQ7 and SEQ 8;

the PCR amplification outer primer SEQ8 needs phosphorylation modification during synthesis.

10. The DNA methylation detection method according to claim 6, wherein in the methylation data analysis, the same or different methylation detection region data of different samples are firstly resolved according to the base molecular markers of the outer primers SEQ4 and SEQ 6; after data splitting and quality filtering, for the sequencing data of the amplification product of the known locus detection gene, further filtering the template source amplicon through the molecular marker fused with the downstream amplification capture probe, calculating the methylation level of each locus according to the filtered data, wherein the conversion rate is not lower than 98%.