CN107858411B - Three-section probe amplification method based on high-throughput sequencing - Google Patents
Three-section probe amplification method based on high-throughput sequencing Download PDFInfo
- Publication number
- CN107858411B CN107858411B CN201711399629.8A CN201711399629A CN107858411B CN 107858411 B CN107858411 B CN 107858411B CN 201711399629 A CN201711399629 A CN 201711399629A CN 107858411 B CN107858411 B CN 107858411B
- Authority
- CN
- China
- Prior art keywords
- probe
- throughput sequencing
- stage
- follows
- amplifying
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6869—Methods for sequencing
Landscapes
- Life Sciences & Earth Sciences (AREA)
- Chemical & Material Sciences (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Organic Chemistry (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Health & Medical Sciences (AREA)
- Engineering & Computer Science (AREA)
- Microbiology (AREA)
- Immunology (AREA)
- Biotechnology (AREA)
- Molecular Biology (AREA)
- Biophysics (AREA)
- Analytical Chemistry (AREA)
- Physics & Mathematics (AREA)
- Biochemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention provides a three-section probe amplification method based on high-throughput sequencing, which comprises the following steps: (1) hybridization and ligation of genomic DNA; (2) performing PCR amplification reaction; (3) and (3) measuring the concentration by using the Qubit, and measuring the size of a strip by using the Qseq, and performing second-generation sequencing. The method can detect at least 200 SNP loci with 10 yuan reagent cost, the detection cost is saved, and the accuracy of the detection result is more than 98%.
Description
Technical Field
The invention relates to the technical field of biology, in particular to a three-section probe amplification method based on high-throughput sequencing.
Background
The multiplex ligation-dependent probe amplification (MLPA) was first reported by Schouten et al in 2002, and is a new technology developed in recent years for qualitative and semi-quantitative analysis of a DNA sequence to be detected. The traditional MLPA is a high-throughput effective new technology for detecting genetic disease gene deletion and repeated mutation, and can perform qualitative and semi-quantitative analysis on a DNA sequence, and the characteristic enables the technology to detect Single Nucleotide Polymorphism (SNP) and point mutation, aneuploidy change of chromosomes, and several common child genetic diseases such as mental retardation syndrome, X-linked mental retardation, pseudohypertrophic muscular dystrophy and the like. A technical scheme of an SNP detection method based on high-throughput sequencing comprises the following steps: designing a probe, pre-amplifying and labeling biotin, hybridizing, connecting, amplifying a Barcode specific primer, sequencing, and analyzing the SNP locus information of a sample according to a sequencing result. A high-throughput sequencing detection method of gene copy number and mutation based on MLPA comprises the following steps: in MLPA technology link, PCR amplification link or its front and back links are modified to make PCR product with joint sequence capable of entering high-flux sequencing and computer sequencing. The data obtained are analyzed to obtain the amplified Reads number of each probe, and then the template copy number or the gene mutation condition is calculated. The linker sequence can be placed with label sequence for distinguishing different samples, so the technology can ensure high accuracy of detecting copy number, and realize high flux of detecting site and sample. The capillary electrophoresis cannot distinguish fragments with the same or similar lengths, and the product design cannot be as long, so that only limited number of sites can be detected each time, and meanwhile, the preparation of the long probe is complex, the synthesis cost is high, and the error rate is increased. Compared with the three-section probe connection amplification technology, the traditional two-section MLPA technology has high detection accuracy and sensitivity and data reliability, and has high error rate, poor sensitivity and high cost. The traditional MLPA technology needs the step-by-step operation of hybridization and connection, and the technology completes the reaction of hybridization and connection simultaneously.
Disclosure of Invention
The invention provides a three-section probe amplification method based on high-throughput sequencing, which achieves the purpose of diagnosis based on artificial design and synthesis of a probe, hybridization of the probe and a denatured template, connection of the hybridized probe, PCR amplification and detection of the hybridized probe by a high-throughput sequencing method.
The purpose of the invention is realized by the following scheme:
a three-stage probe amplification method based on high-throughput sequencing comprises the following steps:
(1) hybridizing, connecting and purifying genome DNA;
(2) performing PCR amplification reaction;
(3) the concentration is measured by the Qubit, the size of a strip is seen by Qseq, and second-generation sequencing is carried out;
the probes hybridized in the step (1) comprise a left probe, a right probe and a middle probe; the sequences of the left probe, the right probe and the middle probe are required to be complementary with one strand of a target sequence during design, and gaps cannot be formed among the left probe, the right probe and the middle probe during design.
Preferably, the length of the left probe and the length of the right probe in the step (1) are larger than 23 oligonucleotides and smaller than 50 oligonucleotides when the universal primer sequence is not added; the middle probe is 5 oligonucleotide sequences in length.
Preferably, the 5' end of the left probe in the step (1) is preceded by a universal sequence CCTACACGACGCTCTTCCGATCT; the right probe has a universal sequence TGGAATTCTCGGGTGCCAAGGAAC added to its 3' end.
Preferably, the enzyme for the ligation reaction of step (1) includes Taq DNA Ligase, HiFi Taq DNA Ligase, 9 ℃ N of NEBTMColi DNA Ligase, and QIAGEN Taq DNA Ligase.
Preferably, the hybridization and ligation system in step (1) is:
preferably, the procedure for hybridization and ligation is:
94℃ 5min
60℃ 90min
4℃ ∞
the product is as follows: 1x magnetic bead purification.
Preferably, the PCR conditions in step (2) are as follows:
1) pre-denaturation at 98 ℃ for 30sec
2) Denaturation at 98 ℃ for 10sec
3) Annealing at 55 deg.C for 30sec
4) Extension at 72 ℃ for 15sec
2) -4) cycle number 30
5) Extension at 72 ℃ for 5min
6) Elongation at 4 ∞
The product is as follows: 1.8 magnetic bead purification.
Preferably, the PCR system is a 22 μ l system, which is as follows:
preferably, the 4 series primers:
AATGATACGGCGACCACCGAGATCTACAC[i5barcode]ACACTCTTTCCCTACACGACGCTCTTCCGATCT；
the 8 series of primers:
CAAGCAGAAGACGGCATACGAGAT[i7barcode]GTGACTGGAGTTCCTTGGCACCCGAGAATTCCA。
the method is based on the improvement of the traditional MLPA technology, and the principle is that the probe is artificially designed and synthesized, the probe is hybridized with a denatured template, the hybridized probe is connected, PCR amplification is carried out, and finally the detection is carried out by a high-throughput sequencing method to achieve the purpose of diagnosis. The traditional MLPA is designed in a two-section mode, the research uses a three-section probe connection amplification technology, and compared with the traditional two-section three-section type, the method is more accurate, the error rate of hybridization is lower, and the requirement on probe design is higher. The design of the middle probe is more flexible, and the variable space of the length is larger. The probes on the left and right sides are no more than 23 oligonucleotides in length than 50 oligonucleotides. The advantage of this study is also that hybridization and ligation can be performed simultaneously in the same reaction system. The research has the advantages of simple operation, short time consumption, low cost, high flux, multiple detection sites and the like. The high throughput is reflected in the superiority of the platform of the second-generation sequencing, hundreds of sites can be simultaneously checked in one reaction, and the real reliability of data can be greatly improved. The application fields of the three-section probe ligation amplification technology include, but are not limited to, copy number variation, SNPs, genome re-sequencing, sequencing reported species, searching for gene differences and the like.
Designing a probe: three probes are designed for each site, namely a left probe, a right probe and a middle probe, wherein a universal sequence CCTACACGACGCTCTTCCGATCT is added in front of the 5 'end of the left probe and is 23 oligonucleotides in size, and a sequence TGGAATTCTCGGGTGCCAAGGAAC is added at the 3' end of the right probe and is 24 oligonucleotides in size.
The three probe sequences are designed to be complementary with one strand of a target sequence, and gaps cannot be reserved among the three probes when the left, middle and right probes are designed. The length of the designed probes is larger than 23 oligonucleotides and smaller than 50 oligonucleotides under the condition of not adding a universal primer sequence, and the annealing temperature is larger than 60 ℃ as much as possible. The length of the intermediate probe is 5 oligonucleotide sequences, and the intermediate probes of all detection sites in the technology are the same length, namely 5 nucleotide sequences.
The universal sequences for the second round of PCR amplification were respectively
AATGATACGGCGACCACCGAGATCTACAC [ i5barcode ] ACACTCTTTCCCTACACGACGCTCTTCCGATCT Forward primer
CAAGCAGAAGACGGCATACGAGAT (i7barcode) GTGACTGGAGTTCCTTGGCACCCGAGAATTCCA reverse primer.
i5barcode and i7barcode are respectively 6 or 8 index sequences that are different in the next generation sequencing, and are used as tag sequences for distinguishing different samples. All series 4 and 8 primers differ only by i5barcode and i7barcode, which are 6 or 8 different base combination sequences, in order to distinguish different machine samples. A large number of samples can only be distinguished on a machine by different index sequences. The middle probe and the right probe at each site need to be subjected to phosphorylation modification at the 5' end during synthesis, so that a phosphodiester bond can be formed between the front probe and the rear probe. The ligase for connecting the 5 'end phosphate group and the 3' end hydroxyl group comprises Taq DNA ligase and 9 DEG NTMThe DNA ligase, the HiFi Taq DNA ligase, the T4DNA ligase and the like are not limited to the existing probes, and only when the left, middle and right sequences of a three-segment probe designed by people are correctly hybridized on a template, the DNA ligase can catalyze the formation of phosphodiester bonds, so that the 5 '-phosphate tail ends and the 3' -hydroxyl tail ends of two adjacent oligonucleotide chains hybridized with the same complementary target DNA chain are connected through the phosphodiester bonds. This ligation reaction can only occur if the two oligonucleotide strands are perfectly paired with the complementary target DNA and there is no gap between the two strands. All probe dilutions were mixed, with each probe diluted to 1 uM. 0.8ul of left and right probes are respectively taken from all the sites, 2.4ul of middle probe is finally fixed to 600ul, and a probe mix system is mixed. The enzymes selected for the second round of PCR are 2XQ5mix, KAPA, Gold, etc. but are not limited to the current species. The purified product magnetic beads used in the experiment were Novonoprazan magnetic beads.
Drawings
FIG. 1 is a schematic diagram of the MLPA technique of the present invention;
5 'P represents the middle probe and the 5' end of the right probe is modified with a phosphate group
General sequence 1: CCTACACGACGCTCTTCCGATCT
General sequence 2: TGGAATTCTCGGGTGCCAAGGAAC are provided.
Detailed Description
The present invention will be explained in detail below with reference to the accompanying drawings.
Example 1
1. Simultaneous hybridization and ligation reactions
The procedure is as follows: 94 ℃ for 5min
60℃ 90min
4℃ ∞
The product is as follows: 1x magnetic bead purification.
2. PCR amplification reaction
PCR reaction procedure:
1) pre-denaturation at 98 ℃ for 30sec
2) Denaturation at 98 ℃ for 10sec
3) Annealing at 55 deg.C for 30sec
4) Extension at 72 ℃ for 15sec
2) -4) cycle number 30
5) Extension at 72 ℃ for 5min
6) Elongation at 4 ∞
The product is as follows: 1.8 magnetic bead purification
3. And (3) measuring the concentration by using the Qubit, and measuring the size of a strip by using the Qseq, and performing second-generation sequencing.
Example 2
Three different DNA samples are selected and respectively subjected to three independent repeated experiments, the second generation sequencing and typing result is shown in the table below, and each site is respectively subjected to three independent repeated experiments.
From the above table, it can be seen that the genotyping ratio of the heterozygote is stable in each case, and in order to verify the accuracy of this method, the above sample DNA was also verified by the first-generation sequencing and multiplex PCR methods, and the results are consistent with the genotype in this method, thus proving that this technique can be used for correct SNP genotyping.
Compared with the conventional method, the method has the advantages that:
the links of DNA breaking, sorting and library building are omitted, and the cost is greatly saved;
the probe dosage is very little;
at least 200 mutation sites can be detected in the same reaction system, and CNV (copy number variation), base insertion and deletion can be detected besides SNP.
At least 200 sites are detected by using a three-stage probe connection amplification technology at the cost of 10 yuan of reagent, so that the accuracy of the detection sites is improved, and a large amount of cost can be saved. The method has the advantages of low cost and multi-site detection. The key technical points are as follows: when each detection site is found, and the length of the middle probe is designed to be 5 oligonucleotide sequences, the hybridization and ligation efficiency is the best, the reads for sequencing are the most, and the accuracy is the highest. The multiplex ligation probe amplification technology is not limited to the current two-segment and three-segment probes, and can be four-segment, five-segment or even infinite probe sequences according to experimental requirements, which can be respectively hybridized, ligated, PCR amplified, sequenced and analyzed. Of course, the efficiency of the connection may be reduced when the number of probes is increased, the difficulty of the success of the experiment is increased, the cost is increased, and the accuracy of the detection is increased.
The above description is only for the preferred embodiment of the present invention, but the scope of the present invention is not limited thereto, and any changes or substitutions that can be easily conceived by those skilled in the art within the technical scope of the present invention disclosed herein should be covered within the scope of the present invention. Therefore, the protection scope of the present invention shall be subject to the protection scope of the claims.
<110> Mei Nei health technology (Beijing) Ltd
<120> three-stage probe amplification method based on high-throughput sequencing
<130>
<160> 6
<170> Oligo 7.0
<210> 1
<211> 27
<212> DNA
<213> Artificial sequence
<400> 1
cctacacgacgctcttccgatct
<210> 2
<211> 23
<212> DNA
<213> Artificial sequence
<400> 2
tggaattctcgggtgccaaggaac
<210> 3
<211> 20
<212> DNA
<213> Artificial sequence
<400> 3
aatgatacggcgaccaccgagatctacac[i5barcode]acactctttccctacacgacgctcttccgatct
<210> 4
<211> 20
<212> DNA
<213> Artificial sequence
<400> 4
caagcagaagacggcatacgagat[i7barcode]gtgactggagttccttggcacccgagaattcca
Claims (7)
1. A three-stage probe amplification method based on high-throughput sequencing is characterized by comprising the following steps:
(1) hybridizing, connecting and purifying genome DNA;
(2) performing PCR amplification reaction;
(3) the concentration is measured by the Qubit, the size of a strip is seen by Qseq, and second-generation sequencing is carried out;
the probes hybridized in the step (1) comprise a left probe, a right probe and a middle probe; the sequences of the left probe, the right probe and the middle probe are required to be complementary with one strand of a target sequence during design, and gaps cannot be reserved among the left probe, the right probe and the middle probe during design;
the length of the left probe and the right probe in the step (1) is more than 23 oligonucleotides and less than 50 oligonucleotides when the universal primer sequence is not added; the length of the middle probe is 5 oligonucleotide sequences;
the probe mixing system of the PCR amplification reaction in the step (2) contains 0.8ul of left probe, 0.8ul of right probe and 2.4ul of middle probe.
2. The method for amplifying the three-stage probe based on the high-throughput sequencing, according to claim 1, wherein the 5' end of the left probe in the step (1) is preceded by a universal sequence CCTACACGACGCTCTTCCGATCT; the right probe has a universal sequence TGGAATTCTCGGGTGCCAAGGAAC added to its 3' end.
3. The method for amplifying the three-stage probe based on high throughput sequencing according to claim 1, wherein the enzyme of the ligation reaction in step (1) comprises Taq DNA Ligase, HiFi Taq DNA Ligase, 9 ° N from NEBTMColi DNA Ligase, and QIAGEN Taq DNA Ligase.
4. The method for amplifying the three-stage probe based on the high-throughput sequencing according to claim 1, wherein the hybridization and ligation system in the step (1) is as follows:
5. the method for three-stage probe amplification based on high-throughput sequencing according to claim 4, wherein the hybridization and ligation procedures are as follows:
94℃5min
60℃90min
4℃∞
the product is as follows: 1x magnetic bead purification.
6. The method for amplifying the three-stage probe based on the high-throughput sequencing according to claim 1, wherein the PCR conditions in the step (2) are as follows:
1) pre-denaturation at 98 ℃ for 30sec
2) Denaturation at 98 ℃ for 10sec
3) Annealing at 55 deg.C for 30sec
4) Extension at 72 ℃ for 15sec
2) -4) cycle number 30
5) Extension at 72 ℃ for 5min
6) Elongation at 4 ∞
The product is as follows: 1.8 magnetic bead purification.
7. The method for amplifying the three-stage probe based on the high-throughput sequencing according to claim 6, wherein the PCR system is a 22 μ l system, and specifically comprises the following steps:
the 4 series of primers:
AATGATACGGCGACCACCGAGATCTACAC[i5barcode]ACACTCTTTCCCTACACGACGCTCTTCCGATCT；
the 8 series of primers:
CAAGCAGAAGACGGCATACGAGAT[i7barcode]GTGACTGGAGTTCCTTGGCACCCGAGAATTCCA。
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201711399629.8A CN107858411B (en) | 2017-12-22 | 2017-12-22 | Three-section probe amplification method based on high-throughput sequencing |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201711399629.8A CN107858411B (en) | 2017-12-22 | 2017-12-22 | Three-section probe amplification method based on high-throughput sequencing |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN107858411A CN107858411A (en) | 2018-03-30 |
| CN107858411B true CN107858411B (en) | 2021-07-13 |
Family
ID=61707007
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201711399629.8A Active CN107858411B (en) | 2017-12-22 | 2017-12-22 | Three-section probe amplification method based on high-throughput sequencing |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN107858411B (en) |
Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN103555846A (en) * | 2013-11-07 | 2014-02-05 | 中国海洋大学 | High-throughput low-cost SNP (single nucleotide polymorphism) genotyping method based on liquid molecular hybridization principle |
| CN103898199A (en) * | 2012-12-27 | 2014-07-02 | 上海天昊生物科技有限公司 | High-flux nucleic acid analysis method and application thereof |
| CN105969843A (en) * | 2016-04-16 | 2016-09-28 | 杨永臣 | High-throughput sequencing detection method for gene copy number and gene mutation based on MLPA |
| CN106520917A (en) * | 2016-09-20 | 2017-03-22 | 美因健康科技（北京）有限公司 | Gene large fragment deletion/duplication detection method |
-
2017
- 2017-12-22 CN CN201711399629.8A patent/CN107858411B/en active Active
Patent Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN103898199A (en) * | 2012-12-27 | 2014-07-02 | 上海天昊生物科技有限公司 | High-flux nucleic acid analysis method and application thereof |
| CN103555846A (en) * | 2013-11-07 | 2014-02-05 | 中国海洋大学 | High-throughput low-cost SNP (single nucleotide polymorphism) genotyping method based on liquid molecular hybridization principle |
| CN105969843A (en) * | 2016-04-16 | 2016-09-28 | 杨永臣 | High-throughput sequencing detection method for gene copy number and gene mutation based on MLPA |
| CN106520917A (en) * | 2016-09-20 | 2017-03-22 | 美因健康科技（北京）有限公司 | Gene large fragment deletion/duplication detection method |
Also Published As
| Publication number | Publication date |
|---|---|
| CN107858411A (en) | 2018-03-30 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN111032881B (en) | Accurate and large-scale parallel quantification of nucleic acids | |
| US9394567B2 (en) | Detection and quantification of sample contamination in immune repertoire analysis | |
| CN105658812B (en) | Large-scale biomolecular analysis with sequence tags | |
| AU2013246050B2 (en) | Detection and quantitation of sample contamination in immune repertoire analysis | |
| EP0931166B2 (en) | Methods for determining sequence information in polynucleotides using mass spectrometry | |
| EP2201143B2 (en) | Tools and methods for genetic tests using next generation sequencing | |
| US10704092B2 (en) | Detection methods based on sequencing | |
| US20130236895A1 (en) | Method of sequence determination using sequence tags | |
| JP2015519081A (en) | Sequencing using sequence tags | |
| EP3612641A1 (en) | Compositions and methods for library construction and sequence analysis | |
| US7867714B2 (en) | Target-specific compomers and methods of use | |
| TW202012638A (en) | Compositions and methods for cancer or neoplasia assessment | |
| CN106520917A (en) | Gene large fragment deletion/duplication detection method | |
| WO2017193044A1 (en) | Noninvasive prenatal diagnostic | |
| CN106834428B (en) | High-throughput multi-site human short fragment tandem repeat sequence detection kit and preparation and application thereof | |
| US20210087613A1 (en) | Methods and compositions for identifying ligands on arrays using indexes and barcodes | |
| CN106319079B (en) | Method for detecting 22q11.2 copy number loss | |
| CN107858411B (en) | Three-section probe amplification method based on high-throughput sequencing | |
| CN107119122B (en) | Kit for detecting single nucleotide polymorphism and detection method | |
| KR102486630B1 (en) | Method of detecting of target point mutations based on polymerase chain reaction | |
| Geistlinger et al. | Large‐scale detection of genetic variation: the key to personalized medicine | |
| WO2023225515A1 (en) | Compositions and methods for oncology assays | |
| CN118215744A (en) | Target enrichment and quantification using isothermal linear amplification probes |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |