CN109593828A - A kind of construction method and its kit in the genetic test library of heredity arrhythmia cordis - Google Patents

A kind of construction method and its kit in the genetic test library of heredity arrhythmia cordis Download PDF

Info

Publication number
CN109593828A
CN109593828A CN201811493198.6A CN201811493198A CN109593828A CN 109593828 A CN109593828 A CN 109593828A CN 201811493198 A CN201811493198 A CN 201811493198A CN 109593828 A CN109593828 A CN 109593828A
Authority
CN
China
Prior art keywords
dna
sequence
library
artifial
artificial sequence
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Pending
Application number
CN201811493198.6A
Other languages
Chinese (zh)
Inventor
扶媛媛
周洋
曹彦东
马懿
王苏
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Beijing Anzhiyin Biotechnology Co Ltd
Original Assignee
Beijing Anzhiyin Biotechnology Co Ltd
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Beijing Anzhiyin Biotechnology Co Ltd filed Critical Beijing Anzhiyin Biotechnology Co Ltd
Priority to CN201811493198.6A priority Critical patent/CN109593828A/en
Publication of CN109593828A publication Critical patent/CN109593828A/en
Pending legal-status Critical Current

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6806—Preparing nucleic acids for analysis, e.g. for polymerase chain reaction [PCR] assay
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/10—Processes for the isolation, preparation or purification of DNA or RNA
    • C12N15/1034—Isolating an individual clone by screening libraries
    • C12N15/1093—General methods of preparing gene libraries, not provided for in other subgroups
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
    • C12Q1/6883—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
    • C—CHEMISTRY; METALLURGY
    • C40—COMBINATORIAL TECHNOLOGY
    • C40B—COMBINATORIAL CHEMISTRY; LIBRARIES, e.g. CHEMICAL LIBRARIES
    • C40B50/00—Methods of creating libraries, e.g. combinatorial synthesis
    • C40B50/06—Biochemical methods, e.g. using enzymes or whole viable microorganisms
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00—Oligonucleotides characterized by their use
    • C12Q2600/106—Pharmacogenomics, i.e. genetic variability in individual responses to drugs and drug metabolism
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00—Oligonucleotides characterized by their use
    • C12Q2600/156—Polymorphic or mutational markers

Landscapes

  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Health & Medical Sciences (AREA)
  • Organic Chemistry (AREA)
  • Genetics & Genomics (AREA)
  • Engineering & Computer Science (AREA)
  • Wood Science & Technology (AREA)
  • Zoology (AREA)
  • Biochemistry (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Molecular Biology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Analytical Chemistry (AREA)
  • General Engineering & Computer Science (AREA)
  • Microbiology (AREA)
  • Biotechnology (AREA)
  • Physics & Mathematics (AREA)
  • Biophysics (AREA)
  • General Health & Medical Sciences (AREA)
  • Immunology (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Biomedical Technology (AREA)
  • Pathology (AREA)
  • Medicinal Chemistry (AREA)
  • General Chemical & Material Sciences (AREA)
  • Bioinformatics & Computational Biology (AREA)
  • Crystallography & Structural Chemistry (AREA)
  • Plant Pathology (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)

Abstract

The invention discloses a kind of construction of gene library method of heredity arrhythmia cordis and its kits, it is related to the mutation of KCNH2, KCNQ1, SCN5A, RYR2, CASQ2, TRDN, CALM1 gene, target area is the exon region and each 20 base zone of exon upstream and downstream of the coding amino acid of above 7 gene, to guarantee that target area all covers, behind preparation library, the method of hybridization probe capture obtains target area library, library is then expanded using LMPCR method, library after purification, obtains sequencing sample library.The banking process step is simple and quick, effectively reduces the cost of library construction, and covers the related gene of arrhythmia cordis, in conjunction with illumina high-flux sequence instrument, can quick and precisely obtain related genes variants, significant to heredity arrhythmia cordis.

Description

A kind of construction method and its kit in the genetic test library of heredity arrhythmia cordis
Technical field
The present invention relates to technical field of gene detection more particularly to a kind of genetic test libraries of heredity arrhythmia cordis Construction method and kit.
Background technique
Heredity arrhythmia cordis (Inherited Arrhythmia, DCM), which is one group, has potential malignant arrhythmia to lead to syncope It faints or dies suddenly the genetic disease of risk, most of ion channel gene mutation by participating in regulation heart action potential causes 's.Main classification of diseases includes long QT syndrome (Long QT Syndrome, LQTS), Brugada syndrome (Brugada Syndrome, BrS), catecholamine sensibility Ventricular Tachycardia (Catecholaminergic Polymorphic Ventricular Tachycardia, CPVT), Short QT syndiome (Short QT Syndrome, SQTS), idiopathic ventricle quivers Dynamic (Idiopathic Ventricular Fibrillation, IVF) and progressive conducting system of heart disease (Progressive Cardiac Conduction Disease,PCCD).The cardiac structure of these Diseases is mostly normal, There is the high risk of sudden death again, significantly increase its diagnosis and treatment difficulty.In this case, genetic test is just shown incomparable Advantage, can just clarify a diagnosis before patient symptom shows completely, and clinical guidance to a certain extent can be provided.
In heredity arrhythmia cordis, relatively conventional for LQTS, disease incidence is about 1/2000.The LQTS of about 80%-90 Patient can find specific pathogenic mutation, be concentrated mainly on the gene of coding potassium ion and sodium-ion channel.The master of LQTS Wanting clinical symptoms includes that generation is fainted, Ventricular Tachycardia causes sudden cardiac death, typical torsades de pointes etc..Different genes are prominent Different types of LQTS caused by becoming has different breaking-out characteristics: LQT1 caused by being mutated by KCNQ1 usually in body or It breaks out under stress, LQT2 caused by being mutated by KCNH2 usually breaks out in the case where rest or burst noise, by SCN5A LQT3 caused by being mutated usually breaks out in rest or sleep.In addition, pathogenic mutation can also instruct the medicine of different type LQTS Object treatment.Such as at present for fatal arrhythmia breaking-out and most effective drug --- beta-blocker of dying suddenly, for The protective effect of LQT1, LQT2 and LQT3 patient successively weaken；And sodium-ion channel antagonist has obvious effect to LQT3 patient, And it is best for the effect of LQT1 and LQT2 patient to mend potassium treatment.
KCNQ1 (potassium voltage-gated channel subfamily Q member 1) gene coding One gene of potassium-channel door.The albumen can form different aggressiveness with other two kinds of potassium channel proteins KCNE1 and KCNE3.The base The mutation of cause is related with heredity long QT syndrome 1, Jervell and Lange-Nielsen syndrome and familial atrial fibrillation.
KCNH2 (potassium voltage-gated channel subfamily H member 2) gene coding The voltage of one eag family activates potassium-channel GAP-associated protein GAP.The gene mutation can lead to 2 type of long QT syndrome (LQT2).
SCN5A (sodium voltage-gated channel alpha subunit 5) negative gene responsible editor's code sodium channel The ɑ subunit (Nav1.5) of albumen, Nav1.5 regulate and control the sodium influx of cardiac muscle cell.Nav1.5 is removed and is influenced sodium influx and cell Outside depolarization, also connected each other with many cardiac muscle cell's skelemins, sarcomeric protein, thus, caused by SCN5A gene mutation The exception of Nav1.5 structure can not only cause the exception of cardiac rhythm, can also result in the exception of cardiac structure.The defect of the gene One of the reason of being 3 type of long QT syndrome (LQT3), this is a kind of autosomal dominant heart disease.
RYR2 (ryanodine receptor 2) gene ryanodine for being found in Sarcoplasmic reticulum of coding by Body.Encoding albumen is one of component part of calcium channel, by the tetramer and FK506 binding protein of ryanodine receptor protein The tetramer of 1B albumen forms, their Cardiomyocytes provide calcium.The mutation of the gene and stress induced polymorphism room property mistake aroused in interest Speed is related with arrhythmogenic right ventricular dysplasia.
The albumen of CASQ2 (calsequestrin 2) gene coding is the myocardium family member of calcium flavones family.Calcium is yellow Element is positioned at the sarcoplasmic reticulum of heart and slow Skeletal Muscle Cell.This protein is a kind of calbindin, and storage calcium is used for flesh Meat function.The mutation of the gene leads to stress induced polymorphism Ventricular Tachycardia, also referred to as catecholamine polymorphism room property Tachycardia 2 (CPVT2) is a kind of disease characterized by two-way Ventricular Tachycardia, may cause sudden cardiac arrest.
TRDN (triadin) gene coding includes the integral membrane proteins of single transmembrane domain.Due to similar albumen It plays a role in the skeletal muscle Excitation-contraction coupling of rabbit, as a part of calcium release compound, with ryanodine receptor It is related.In addition, the montage transcript variants thereof for encoding a variety of hypotypes, the single nucleotide polymorphism in the gene is also found in the gene It may be the marker of IgA ephritis.
The member of CALM1 (calmodulin 1) gene coding EF-hand calbindin family.It is that coding is identical One of three genes of calbindin, calbindin is one of four subunits of phosphorylase kinase.In No. 7 chromosomes With two pseudogenes are had found on x chromosome, and have found coding different subtype multiple transcript variants thereofs.CALM1 gene is compiled Code cam kinase, studies have found that a kind of arrhythmia cordis mediated with catecholamine that is mutated isolates.
Traditional Sanger sequencing technologies detection KCNH2, KCNQ1, SCN5A, RYR2, CASQ2, TRDN, CALM1 gene There are significant limitations for the exon region for encoding amino acid and the neighbouring gene mutation for including subregion, and show: detection is logical Amount is restricted, and this method is only applicable to the detection of a few explicit mutantional hotspot, and for more than candidate gene quantity and be candidate It is difficult to realize when whole coding sections of gene.It needs to consume the plenty of time, and disappears for the genomic DNA of sample to be detected Consume huge, same sample is difficult to obtain the enough DNA for meeting detection demand in practice.Thus it is difficult to use in everyday practice The detection demand of Sanger method progress polygenes whole coding section.
Using the base of high-throughput gene sequencing technology detection KCNH2, KCNQ1, SCN5A, RYR2, CASQ2, TRDN, CALM1 Because of mutation, the preparation in sample library before being sequenced.It is carried out such as in the preparation process of sample library using multiple PCR method Target area amplification can have amplification skewed popularity, cause target area amplification uneven, and generate skewed popularity to subsequent sequencing data It influences.
Therefore, it is necessary to which the method for finding a kind of gene mutation of new detection heredity arrhythmia cordis, it is quasi- to improve diagnosis True rate, reduces cost and labor intensity.
Summary of the invention
In order to solve the above-mentioned technical problem, the purpose of the present invention is to provide a kind of genetic tests of heredity arrhythmia cordis The construction method in library, this method build library step simplicity quickly, and variation type is comprehensively, object to be measured region overlay is complete, is sequenced Data without skewed popularity, can to carry out detection flux to multiple samples simultaneously high.
It is a further object of the present invention to provide the genetic test libraries for the heredity arrhythmia cordis that this method obtains.
It is a further object of the present invention to provide the gene detecting kits of the heredity arrhythmia cordis of library preparation.
To achieve the above object, the present invention provides a kind of genetic test library of heredity arrhythmia cordis, it is related to The gene mutation of KCNH2, KCNQ1, SCN5A, RYR2, CASQ2, TRDN, CALM1.To guarantee that target area all covers, preparation Target area library is obtained using the method for hybridization probe capture behind library, library is then expanded using LMPCR method, then carry out Library purifies to obtain sequencing genetic test library.
A kind of construction method in the genetic test library of heredity arrhythmia cordis of the invention, includes the following steps:
(1) DNA quality standard: the genomic DNA of subject's sample is provided, after nucleic acid extraction, quality inspection, it is desirable that DNA Meet certain quality control standard；
(2) prepared by library: genomic DNA is complied with standard by above-mentioned, ultrasound is interrupted to 180bp-220bp short-movie section at random, Then it carries out end-filling and adds A, jointing, and reach by PCR amplification the DNA library of certain total amount, library satisfaction The dedicated sequencing requirement of illumina microarray dataset；
(3) hybrid capture: the DNA library that step 2 is obtained carries out specific hybrid with disease associated custom probe, catches The library containing destination region is obtained, then the DNA library containing destination region is left to get target area text by magnetic bead crawl, enrichment Library；
(4) LMPCR is expanded: the target area library that step 3 is obtained, and as LMPCR template, is added and sequence measuring joints The primer and corresponding reagent matched, are expanded；Magnetic beads for purifying is added after amplification to get purified library；
(5) library Quality Control: the purified library that step 4 is obtained carries out Quality Control, and Qubit 3.0 is selected to carry out quantitative detection, Agilent2100 or Agilent 4200 carries out qualitative detection, checks whether library fragments distribution meets the requirements.
The genetic test library constructing method of the above-mentioned heredity arrhythmia cordis of the present invention, the target area include following The full coding area of gene and variable sheer area (exon to introne extension 20bp): KCNH2, KCNQ1, SCN5A, RYR2, CASQ2、TRDN、CALM1。
The sample type of nucleic acid extraction described in above-mentioned steps (1) includes but is not limited to peripheral blood, histoorgan sample It is fresh peripheral blood Deng, preferred nucleic acid sample.
DNA quality control standard described in above-mentioned steps (1) is that DNA integrality is preferable, no protein rna pollution, DNA concentration ≥20ng/μL；DNA purity: OD260/280 1.8-2.0, OD260/230 > 2.0；The total initial amount of DNA: 0.1ug-1ug.
Method for extracting nucleic acid described in above-mentioned steps (1), DNA quality control method according to the operating instruction of the prior art into Row.
Standard compliant genomic DNA is carried out ultrasound in above-mentioned steps (2) to interrupt at random, the reaction system that ultrasound interrupts And reaction condition is shown in Table 1.
The reaction system and reaction condition that 1 ultrasound of table interrupts
End-filling described in above-mentioned steps (2) adds the reaction of A to refer to that DNA random fragmentation to 180-220bp, passes through 5' → 3' polymerase and the circumscribed enzyme effect of 3' → 5' carry out end-filling, while the end 5' carries out phosphorylation, and secondly 3' adds A, so as to It is attached with sequence measuring joints.Reaction system and reaction condition are shown in Table 2.
2 end-filling of table adds the reaction system and reaction condition of A
The reaction of jointing described in above-mentioned steps (2) includes jointing reaction, digestion reaction and purifying reaction.Into One step explanation, the connector refer to that in DNA fragmentation both ends connection universal connector, structure is hairpin loop connector, is mentioned with this High connector joint efficiency.
Digestion enzyme reaction is added after referring to jointing reaction in the digestion reaction.
The purifying reaction refers to that AMpureXP purifying magnetic bead is added in postdigestive DNA library carries out Piece Selection, first Supernatant is left and taken after the absorption of part magnetic bead is added, magnetic bead adsorbs large fragment and abandons, adds part magnetic bead and normally purify elution, i.e., It can.
The reaction system and reaction condition part table 3 of the jointing of the step (2)
The reaction system and reaction condition of 3 jointing of table
Sequence measuring joints sequence: 5 ' -/5Phos/GAT CGG AAG AGC ACA CGT CTG AAC TCC AGT C/ index/A CAC TCT TTC CCT ACA CGA CGC TCT TCC GAT C*T-3′
Pcr amplification reaction described in above-mentioned steps (2) includes pcr amplification reaction and magnetic beads for purifying, the DNA piece after modification Section by particular sequence primer by after purification, being expanded, and introduce sample label.Sample label is 6bp base composition, can Unique identification as sample.The DNA library finally obtained contains the particular sequence combined with illumina microarray dataset chip P5, P7 and sequencing primer sequence, wherein sample label is contained at the end P7, length 6bp, and sequencing template specific structure is as follows:
P5+Read1 sequencing primer+insertion DNA+Read2 sequencing primer+Index (6bp)+P7
Particular sequence one end are as follows: AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCC GATCT
Another terminal sequence are as follows: ATCGGAAGAGCACACGTCTGAACTCCAGTCAC*NNNNNN* ATCTCGTATGCCGTCTTCTGCTTG, wherein NNNNNN represents 6bp base sample label.Specific reaction system and reaction condition It is shown in Table 4
The reaction system and reaction condition of table 4PCR amplification
Universal primer sequence: 5 '-AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTC CGATC*T-3′
Primer containing sample label: 5 '-CAAGCAGAAGACGGCATACGAGATTGXXXXXXGTGACTGGAGTTCAGACG TGTGCTCTTCCGATC-s-T-3′
(XXXXXX indicates sample label, there is 6 base random combines, table specific as follows；- s- indicates thiophosphoric acid modification) It is shown in Table 5
5 sample label primer sequence of table
Probe used in above-mentioned steps (3) of the present invention is the crucial place of the present invention, and probe is according to target relevant to disease What region specifically customized, can complete coverage goal region (exon region and each 20 base zone of exon upstream and downstream), from And the efficiency of capture target fragment is improved, achieve the purpose that detect related disease mutational site.Pass through a series of enclosure methods, example Such as repetitive sequence in genome is closed using COT DNA, using specific primer sequence closed joint sequence etc., is prepared optimal Hybridization reaction condition reacts 16h-20h, further increases the specificity of capture target area, improves capture rate.Customize probe There is biotin modification, after hybridizing, passes through the enrichment with magnetic bead library of marked by streptavidin.
(exon is to introne extension in the full coding area and variable sheer area that the target area includes following gene 20bp): KCNH2, KCNQ1, SCN5A, RYR2, CASQ2, TRDN, CALM1.
Further preferably, the DNA library that step (3) of the present invention obtains step 2 carries out library sample mixing (sample≤6), always It measures at least 1-1.5 μ g (preferably 1.25 μ g).By the library mixed in equal amounts of different sample labels, the corresponding closing of sample label is added Primer kit closes DNA, and concentration is dried to dry powder, adds hybridization buffer (Tris, EDTA, NaCl), blending incubation, then Customization probe reaction is added, after reaction, pretreated specific magnetic beads for purifying is added, is enriched with the destination region captured DNA fragmentation, reaction system and reaction condition are shown in Table 5.Different sample label samples are carried out sample mixing hybrid capture by the step, one Determine to save cost in degree.
After present invention hybridization reaction described above (probe is in conjunction with the fragments specific of target area), selection has chain The specific magnetic bead of mould Avidin label specific can grab the probe for having biotin labeling, purifying cleaning be carried out, to be enriched with mesh Mark region segments.
5 hybridization reaction system component of table and reaction condition
The closing primer kit is AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCT TCCGATCT
Label closes primer kit: CAAGCAGAAGACGGCATACGAGATNNNNNNGTGACTGGAGTTCAGACGTGT GCTCTTCCGATCT, NNNNNN are matched in sample label index base reverse complemental.
6 probe sequence of table
The destination region segment of capture is subjected to PCR amplification so that library total amount energy using LMPCR in step (4) of the present invention Enough to meet upper machine sequencing requirement, reaction system and condition are shown in Table 6: carrying out magnetic beads for purifying after reaction and obtain final upper machine Library.
The magnetic beads for purifying method: purifying magnetic bead is added in DNA library, is placed on magnetic frame, after solution clarification Supernatant is discarded, cleans magnetic bead using ethyl alcohol, centrifugation exhausts residual liquid, and it is dry, TRIS-EDTA buffer is added, pressure-vaccum is mixed It is even, it is placed at room temperature for, up to purified library after clarification；
Table 7LMPCR amplification reaction system
The P5 primer sequence: 5'-AATGATACGGCGACCACCGA
The P7 primer sequence: 5'-CAAGCAGAAGACGGCATACGA
Above-mentioned steps (5) the library Quality Control, first carry out quantitative detection, and Qubit3.0 instrument may be selected, obtain library Secondly concentration total amount >=0.5ug carries out qualitative Quality Control, Agilent2100/4200 instrument may be selected, it is desirable that segment ranges exist Between 150-500bp；It is quantitative that real-time fluorescence quantitative PCR progress library can be carried out before upper machine sequencing, expanded with P5, P7 primer specific Increase and meet the library that sequencing requires, draws standard curve, determine machine concentration on suitable library.Specific reaction system and reaction item Part is according to the following table 8 (necessary instrument ABI 7500/7300standard).
8 P5, P7 primer amplification system of table and condition
Upstream primer sequence 5'-AATGATACGGCGACCACCGA
Downstream primer sequence 5'-CAAGCAGAAGACGGCATACGA
Construction method of the invention further includes upper machine sequencing procedure and data analysis process.
One embodiment of the present invention, a kind of construction method in the genetic test library of heredity arrhythmia cordis are special Include the following steps:
(1) nucleic acid extraction and quality inspection: peripheral blood sample is after nucleic acid extraction, quality inspection, it is desirable that it meets certain Quality Control mark Quasi-: DNA integrality is preferable, no protein rna pollution, DNA concentration >=20ng/ μ L；DNA purity: OD260/280 1.8-2.0, OD260/230>2.0；The total initial amount of DNA: 0.1 μ g-1 μ g；
(2) prepared by library: utilizing above-mentioned DNA, is mended with TRIS-EDTA to 52.5 μ l after sampling, in root on covaris instrument According to relevant parameter, carries out ultrasound and interrupt, genomic DNA is interrupted at random to 180-220bp short-movie section；Then end-filling is carried out Add A, reaction system are as follows: the diluted 50 μ l of DNA of Tris-EDTA, end-filling add 7 μ l of A reaction buffer, and end-filling adds A enzyme 3 μ l of mixed liquor adds up to 60 μ l, reaction condition are as follows: 20 DEG C of holdings 30min, 65 DEG C of holding 30min finally keep 4 DEG C；It carries out again Connector connection, reaction system are the DNA60 μ l of end-filling, connect reaction buffer and ligase 30 μ l, 2.5 μ of sequence measuring joints 1 μ l of l, high concentration Mg2+ buffer adds up to 93.5 μ l, reaction condition: 20 DEG C of holding 15min, and is kept for 20 DEG C；Reaction terminates Afterwards, 3 μ l USER digestive ferments, 37 DEG C of holding 15min are added；After reaction, AMpureXP purifying magnetic bead is added and carries out segment choosing It selects, leaves and takes supernatant after the absorption of 45 μ l magnetic beads is first added, magnetic bead adsorbs large fragment and abandons, and adds 15 μ l magnetic beads and normally purifies and washes It is de-；Finally using the DNA of purifying as template carry out PCR amplification, reaction system are as follows: 20 μ l, 2XPCR amplified reaction enzyme of DNA profiling and 25 μ l of buffer, 2.5 μ l of universal primer, the .5 μ l of primer 2 containing sample label add up to 50 μ l, reaction condition are as follows: 98 DEG C of holding 30s, Then 4 circulations are carried out, each circulation is 98 DEG C of holding 10s, and 65 DEG C of holding 75s, then 65 DEG C of holding 5min, are finally maintained at 10℃；After 90 μ l magnetic beads be added purified；
(3) hybrid capture: carrying out library sample mixing, will have the library of different sample labels, equivalent, which is mixed, (to be no more than 6 samples), total amount needs to reach 1.25ug；1ug is sampled after mixing, and the corresponding 2 μ l of closing primer kit of sample label is added, DNA5ug is closed, vacuum concentration 60 DEG C of concentrations of instrument are dried to dry powder；Add 7.5 μ l of 2x hybridization buffer, 3 μ of hybridizing reagent A L mixes 95 DEG C of incubation 10min, and customization 4.5 μ l of probe is then added, and 57 DEG C of hot lid after mixing reacts 47 DEG C of incubation 16h-20h； After reaction, the pretreated specific magnetic bead of 100 μ l is added, is enriched with the destination region DNA fragmentation captured；
(4) LMPCR is expanded: the DNA for the hybrid capture enrichment that step (3) are obtained prepares reaction system: mould as template 5 μ l of 20 μ l, 2Xpcr reaction enzymes of plate and 25 μ l, P5P7 primer of buffer, reaction condition: then 98 DEG C of holding 45s carry out 14 Circulation, each circulation is 98 DEG C of holding 15s, and 60 DEG C of holding 30s, 72 DEG C of holding 30s, then 72 DEG C of holding 1min, finally keep At 4 DEG C；90 μ l magnetic beads for purifying are added after reaction to obtain finally going up machine sequencing library；
(5) final library obtained in step (4) is carried out Quality Control in accordance with the following methods: 1 μ l of sampling uses Qubit HS DsDNA kit quantification, obtains library concentration；It is rationally diluted according to quantitative concentrations, in Agilent2100 or 4200 instrument Device selects suitable reagent to be detected, and verifies library fragments distribution；Before upper machine, carried out using fluorescence quantifying PCR method Effective template is quantitative, and gradient dilution standard items are 20pM, 2pM, 0.2pM, 0.002pM, 0.0002pM, 0.00002pM respectively；It will Sample library is diluted to 2-10pM, according to following reagent preparations: 2 × SybrGreen Master Mix, 25 μ L, P5P7 primer 2 μ L, 4 μ l of nuclease-free water, 4 μ L of sample canonical product；Reaction condition (ABI7500): 95 DEG C of holding 5min, then 35 recycle, often A circulation 95 DEG C of holdings 30sec, 60 DEG C of holding 45s, melting curve 95 DEG C of holdings 15s, 60 DEG C of holdings 60s, 95 DEG C of 15s；
(6) machine is sequenced on: according to quantitative concentrations, machine ultimate density in determinations, and in going up machine on Nextseq550AR sequenator, It is sequenced according to instrumentation regulation, uses NextSeq 500/550Mid Output Kit v2 (300cycles)；Then By data upload server, obtained data are analyzed and interpreted by genetic counselling teacher.
Another technical solution of the invention is the genetic test library for the heredity arrhythmia cordis that this method obtains.
Another technical solution of the invention is the gene detecting kit of the heredity arrhythmia cordis of the library preparation, Including library construction reagent, hybridization probe sequence, primer sequence.
Framework reagents of the present invention include: that Tris-EDTA dilution, end-filling add A reaction buffer, end to mend Flat plus A enzyme mixation, connection reaction buffer and ligase, high concentration Mg2+Buffer, pcr amplification reaction enzyme and buffer, envelope Close primer kit, hybridization buffer, hybridizing reagent A.
The hybridization probe sequence includes SEQ ID No 1 to SEQ ID No 255.
Compared with prior art, the invention has the following beneficial effects:
1, library of the invention using high-flux sequence probe hybrid capture method detection KCNH2, KCNQ1, SCN5A, The gene mutation of RYR2, CASQ2, TRDN, CALM1, probe are customized for target area, fully consider covering for target area Lid ratio guarantees effective capture of mutation, and it is comprehensive to be allowed to variation type, and accuracy rate is high, high sensitivity.It can choose one simultaneously to catch Multiple samples, save cost.
2, the library covers the related gene of arrhythmia cordis, can be quick and precisely in conjunction with illumina high-flux sequence instrument Related genes variants are obtained, it is significant to heredity arrhythmia cordis.
3, probe used is the crucial place of the present invention, and probe is specifically customized according to target area relevant to disease, Can complete coverage goal region (exon region and each 20 base zone of exon upstream and downstream), to improve capture target patch The efficiency of section achievees the purpose that detect related disease mutational site.By a series of enclosure methods, such as will using COT DNA Repetitive sequence is closed in genome, using specific primer sequence closed joint sequence etc., prepares optimal hybridization reaction condition, instead 16h-20h is answered, the specificity of capture target area is further increased, improves capture rate.Customization probe has biotin modification, to After hybridization, pass through the enrichment with magnetic bead library of marked by streptavidin.
4, library of the invention avoids Multiplex PCR amplification target area, avoids the base mispairing of PCR introducing, simultaneously It is common to different complex DNA samples.
5, library of the invention relies on illumina high-flux sequence platform, and detection flux greatly improves.
Detailed description of the invention
Fig. 1 is the 2100 biological analyser testing result of peripheral blood DNA library constructed according to the method for the present invention.
Fig. 2 is library construction according to the present invention and measurement flow chart.
Specific embodiment
With reference to the accompanying drawing, specific embodiments of the present invention will be described in detail, it is to be understood that guarantor of the invention Shield range is not limited by the specific implementation.
Unless otherwise explicitly stated, otherwise in entire disclosure and claims, term " includes " or its change Changing such as "comprising" or " including " etc. will be understood to comprise stated element or component, and not exclude other members Part or other component parts.
Embodiment 1
Carry out library constructions using 4 peripheral blood sample samples, using comprising KCNH2, KCNQ1, SCN5A, RYR2, (exon is used as target area to introne extension 20bp) for the full coding area of CASQ2, TRDN, CALM1 gene and variable sheer area The primer pond in domain carries out multiple reaction PCR, and high-flux sequence platform Miseq is combined to carry out DNA sequencing, then detects point mutation (SNP), small fragment insertion and deletion (InDel).Concrete operations process is as follows:
(1) nucleic acid extraction and quality inspection: peripheral blood sample is after nucleic acid extraction, quality inspection, it is desirable that it meets certain Quality Control mark Quasi-: DNA integrality is preferable, no protein rna pollution, DNA concentration >=20ng/ μ L；DNA purity: OD260/280 1.8-2.0, OD260/230>2.0；The total initial amount of DNA: 0.1 μ g-1 μ g.
(2) prepared by library: utilizing above-mentioned DNA, is mended with TRIS-EDTA to 52.5 μ l after sampling, in root on covaris instrument According to relevant parameter, carries out ultrasound and interrupt, genomic DNA is interrupted at random to 180-220bp short-movie section.Then end-filling is carried out Add A, reaction system are as follows: the diluted 50 μ l of DNA of Tris-EDTA, end-filling add 7 μ l of A reaction buffer, and end-filling adds A enzyme 3 μ l of mixed liquor adds up to 60 μ l, reaction condition are as follows: 20 DEG C of holdings 30min, 65 DEG C of holding 30min finally keep 4 DEG C；It carries out again Connector connection, reaction system are the DNA60 μ l of end-filling, connect reaction buffer and ligase 30 μ l, 2.5 μ of sequence measuring joints 1 μ l of l, high concentration Mg2+ buffer adds up to 93.5 μ l, reaction condition: 20 DEG C of holding 15min, and is kept for 20 DEG C；Reaction terminates Afterwards, 3 μ l USER digestive ferments, 37 DEG C of holding 15min are added；After reaction, AMpureXP purifying magnetic bead is added and carries out segment choosing It selects, leaves and takes supernatant (magnetic bead adsorb large fragment abandon) after the absorption of 45 μ l magnetic beads is first added, add 15 μ l magnetic beads and normally purify and wash It is de-.Finally using the DNA of purifying as template carry out PCR amplification, reaction system are as follows: 20 μ l, 2XPCR amplified reaction enzyme of DNA profiling and 25 μ l of buffer, 2.5 μ l of universal primer, the .5 μ l of primer 2 containing sample label add up to 50 μ l.Reaction condition are as follows: 98 DEG C of holding 30s； Then 4 circulations are carried out, each circulation is 98 DEG C of holdings 10s, 65 DEG C of holding 75s；Then 65 DEG C of holding 5min；Finally it is maintained at 10℃.After 90 μ l magnetic beads be added purified.
(3) hybrid capture: carrying out library sample mixing, will have the library of different sample labels, equivalent, which is mixed, (to be no more than 6 samples), total amount needs to reach 1.25ug.1ug is sampled after mixing, and the corresponding 2 μ l of closing primer kit of sample label is added, DNA5ug is closed, vacuum concentration 60 DEG C of concentrations of instrument are dried to dry powder.Add 7.5 μ l of 2x hybridization buffer, 3 μ of hybridizing reagent A L mixes 95 DEG C of incubation 10min, and customization 4.5 μ l of probe is then added, and 57 DEG C of hot lid after mixing reacts 47 DEG C of incubation 16h-20h. After reaction, the pretreated specific magnetic bead of 100 μ l is added, is enriched with the destination region DNA fragmentation captured.
(4) LMPCR is expanded: the DNA for the hybrid capture enrichment that step (3) are obtained prepares reaction system: mould as template 5 μ l of 20 μ l, 2Xpcr reaction enzymes of plate and 25 μ l, P5P7 primer of buffer.Reaction condition: 98 DEG C of holding 45s；Then 14 are carried out Circulation, each circulation are 98 DEG C of holdings 15s, 60 DEG C of holdings 30s, 72 DEG C of holding 30s；Then 72 DEG C of holding 1min；Finally keep At 4 DEG C.90 μ l magnetic beads for purifying are added after reaction to obtain finally going up machine sequencing library.
(5) final library obtained in step (4) is carried out Quality Control in accordance with the following methods: 1 μ l of sampling uses Qubit HS DsDNA kit quantification, obtains library concentration.It is rationally diluted according to quantitative concentrations, in Agilent2100 or 4200 instrument Device selects suitable reagent to be detected, and verifies library fragments distribution.Before upper machine, carried out using fluorescence quantifying PCR method Effective template is quantitative, and gradient dilution standard items are 20pM, 2pM, 0.2pM, 0.002pM, 0.0002pM, 0.00002pM respectively.It will Sample library is diluted to 2-10pM, according to following reagent preparations: 2 × SybrGreen Master Mix, 25 μ L, P5P7 primer 2 μ L, 4 μ l of nuclease-free water, 4 μ L of sample (standard items).Reaction condition (ABI7500):
95 DEG C of holding 5min；Then 35 circulations, each circulation 95 DEG C of holdings 30sec, 60 DEG C of holding 45s；Melting curve 95 DEG C of holdings 15s, 60 DEG C of holdings 60s, 95 DEG C of 15s.
(6) machine is sequenced on: according to quantitative concentrations, machine ultimate density in determinations, in going up machine on Miseq sequenator, according to instrument Device operating instruction is sequenced, and MiSeq Reagent Micro Kit (300cycles) is used.Then by data upload service Device is analyzed and is interpreted to obtained data by genetic counselling teacher.Data see the table below 9.
The sequencing result and known results 100% of 94 samples of table are consistent
Embodiment 2
Carry out library constructions using 16 buccal swab samples, using comprising KCNH2, KCNQ1, SCN5A, RYR2, (exon is used as target area to introne extension 20bp) for the full coding area of CASQ2, TRDN, CALM1 gene and variable sheer area The primer pond in domain carries out multiple reaction PCR, and high-flux sequence platform Nextseq550AR is combined to carry out DNA sequencing, then examines Measuring point is mutated (SNP), small fragment insertion and deletion (InDel).Concrete operations process is as follows:
(1) nucleic acid extraction and quality inspection: peripheral blood sample is after nucleic acid extraction, quality inspection, it is desirable that it meets certain Quality Control mark Quasi-: DNA integrality is preferable, no protein rna pollution, DNA concentration >=20ng/ μ L；DNA purity: OD260/280 1.8-2.0, OD260/230>2.0；The total initial amount of DNA: 0.1 μ g-1 μ g.
(2) prepared by library: utilizing above-mentioned DNA, is mended with TRIS-EDTA to 52.5 μ l after sampling, in root on covaris instrument According to relevant parameter, carries out ultrasound and interrupt, genomic DNA is interrupted at random to 180-220bp short-movie section.Then end-filling is carried out Add A, reaction system are as follows: the diluted 50 μ l of DNA of Tris-EDTA, end-filling add 7 μ l of A reaction buffer, and end-filling adds A enzyme 3 μ l of mixed liquor adds up to 60 μ l, reaction condition are as follows: 20 DEG C of holdings 30min, 65 DEG C of holding 30min finally keep 4 DEG C；It carries out again Connector connection, reaction system are the DNA60 μ l of end-filling, connect reaction buffer and ligase 30 μ l, 2.5 μ of sequence measuring joints 1 μ l of l, high concentration Mg2+ buffer adds up to 93.5 μ l, reaction condition: 20 DEG C of holding 15min, and is kept for 20 DEG C；Reaction terminates Afterwards, 3 μ l USER digestive ferments, 37 DEG C of holding 15min are added；After reaction, AMpureXP purifying magnetic bead is added and carries out segment choosing It selects, leaves and takes supernatant (magnetic bead adsorb large fragment abandon) after the absorption of 45 μ l magnetic beads is first added, add 15 μ l magnetic beads and normally purify and wash It is de-.Finally using the DNA of purifying as template carry out PCR amplification, reaction system are as follows: 20 μ l, 2XPCR amplified reaction enzyme of DNA profiling and 25 μ l of buffer, 2.5 μ l of universal primer, the .5 μ l of primer 2 containing sample label add up to 50 μ l.Reaction condition are as follows: 98 DEG C of holding 30s； Then 4 circulations are carried out, each circulation is 98 DEG C of holdings 10s, 65 DEG C of holding 75s；Then 65 DEG C of holding 5min；Finally it is maintained at 10℃.After 90 μ l magnetic beads be added purified.
(3) hybrid capture: carrying out library sample mixing, will have the library of different sample labels, equivalent, which is mixed, (to be no more than 6 samples), total amount needs to reach 1.25ug.1ug is sampled after mixing, and the corresponding 2 μ l of closing primer kit of sample label is added, DNA5ug is closed, vacuum concentration 60 DEG C of concentrations of instrument are dried to dry powder.Add 7.5 μ l of 2x hybridization buffer, 3 μ of hybridizing reagent A L mixes 95 DEG C of incubation 10min, and customization 4.5 μ l of probe is then added, and 57 DEG C of hot lid after mixing reacts 47 DEG C of incubation 16h-20h. After reaction, the pretreated specific magnetic bead of 100 μ l is added, is enriched with the destination region DNA fragmentation captured.
(4) LMPCR is expanded: the DNA for the hybrid capture enrichment that step (3) are obtained prepares reaction system: mould as template 5 μ l of 20 μ l, 2Xpcr reaction enzymes of plate and 25 μ l, P5P7 primer of buffer.Reaction condition: 98 DEG C of holding 45s；Then 14 are carried out Circulation, each circulation are 98 DEG C of holdings 15s, 60 DEG C of holdings 30s, 72 DEG C of holding 30s；Then 72 DEG C of holding 1min；Finally keep At 4 DEG C.90 μ l magnetic beads for purifying are added after reaction to obtain finally going up machine sequencing library.
(5) final library obtained in step (4) is carried out Quality Control in accordance with the following methods: 1 μ l of sampling uses Qubit HS DsDNA kit quantification, obtains library concentration.It is rationally diluted according to quantitative concentrations, in Agilent2100 or 4200 instrument Device selects suitable reagent to be detected, and verifies library fragments distribution.Before upper machine, carried out using fluorescence quantifying PCR method Effective template is quantitative, and gradient dilution standard items are 20pM, 2pM, 0.2pM, 0.002pM, 0.0002pM, 0.00002pM respectively.It will Sample library is diluted to 2-10pM, according to following reagent preparations: 2 × SybrGreen Master Mix, 25 μ L, P5P7 primer 2 μ L, 4 μ l of nuclease-free water, 4 μ L of sample (standard items).Reaction condition (ABI7500):
95 DEG C of holding 5min；Then 35 circulations, each circulation 95 DEG C of holdings 30sec, 60 DEG C of holding 45s；Melting curve 95 DEG C of holdings 15s, 60 DEG C of holdings 60s, 95 DEG C of 15s.
(6) machine is sequenced on: according to quantitative concentrations, machine ultimate density in determinations, and in going up machine on Nextseq550AR sequenator, It is sequenced according to instrumentation regulation, uses NextSeq 500/550Mid Output Kit v2 (300cycles).Then By data upload server, obtained data are analyzed and interpreted by genetic counselling teacher.Data see the table below 10.
The sequencing result and known results 100% of 10 16 samples of table are consistent
The aforementioned description to specific exemplary embodiment of the invention is in order to illustrate and illustration purpose.These descriptions It is not wishing to limit the invention to disclosed precise forms, and it will be apparent that according to the above instruction, can much be changed And variation.The purpose of selecting and describing the exemplary embodiment is that explaining specific principle of the invention and its actually answering With so that those skilled in the art can be realized and utilize a variety of different exemplary implementation schemes of the invention and Various chooses and changes.The scope of the present invention is intended to be limited by claims and its equivalents.
Sequence table
<110>intelligence is pacified because of Bioisystech Co., Ltd in Beijing
<120>a kind of construction method and its kit in the genetic test library of heredity arrhythmia cordis
<160> 255
<170> SIPOSequenceListing 1.0
<210> 1
<211> 55
<212> DNA
<213>artificial sequence (Artifial Sequence)
<400> 1
acgagagtgc aaagttctgt gaaacgctcc agtggttaca cgccccgggg tttca 55
<210> 2
<211> 90
<212> DNA
<213>artificial sequence (Artifial Sequence)
<400> 2
aatttttaat gtttacagat tcaagaaatt aagcatacgg tcacgagagt gcaaagttct 60
gtgaaacgct ccagtggtta cacgccccgg 90
<210> 3
<211> 56
<212> DNA
<213>artificial sequence (Artifial Sequence)
<400> 3
ataaccaccc tgtacatcgg cttcctgggc ctcatcttct cctcgtactt tgtgta 56
<210> 4
<211> 60
<212> DNA
<213>artificial sequence (Artifial Sequence)
<400> 4
agctgataac caccctgtac atcggcttcc tgggcctcat cttctcctcg tactttgtgt 60
<210> 5
<211> 55
<212> DNA
<213>artificial sequence (Artifial Sequence)
<400> 5
attcaggtgc ggtgcctgca aggccctggt cactgtcatt ttggtcactg ttatt 55
<210> 6
<211> 61
<212> DNA
<213>artificial sequence (Artifial Sequence)
<400> 6
tcactcattc aggtgcggtg cctgcaaggc cctggtcact gtcattttgg tcactgttat 60
t 61
<210> 7
<211> 59
<212> DNA
<213>artificial sequence (Artifial Sequence)
<400> 7
aaagttcaag ctggacaaag acaatggggt gactcctgga gagaagatgc tcacagtcc 59
<210> 8
<211> 57
<212> DNA
<213>artificial sequence (Artifial Sequence)
<400> 8
tggaccactt ctctgtcgac ggctatgaca gttctggtga gaacccctca ggcagtt 57
<210> 9
<211> 59
<212> DNA
<213>artificial sequence (Artifial Sequence)
<400> 9
agactctgct gacacccatc acccacatct cacagtgagt gcctacatgt gcgtgaagg 59
<210> 10
<211> 63
<212> DNA
<213>artificial sequence (Artifial Sequence)
<400> 10
accattaagg tcattcgacg catgcagtac tttgtggcca agaagaaatt ccaggtaagc 60
cct 63
<210> 11
<211> 64
<212> DNA
<213>artificial sequence (Artifial Sequence)
<400> 11
tcgacgcatg cagtactttg tggccaagaa gaaattccag gtaagccctg tgctgagcct 60
tcct 64
<210> 12
<211> 56
<212> DNA
<213>artificial sequence (Artifial Sequence)
<400> 12
attgggaagc cctcactgtt catctccgtc tcaggtgggt ttctgtgtca gttact 56
<210> 13
<211> 63
<212> DNA
<213>artificial sequence (Artifial Sequence)
<400> 13
agtccattgg gaagccctca ctgttcatct ccgtctcagg tgggtttctg tgtcagttac 60
tct 63
<210> 14
<211> 58
<212> DNA
<213>artificial sequence (Artifial Sequence)
<400> 14
cttggccctg atttgggtgt tttatccccc atagaaaaga gcaaggatcg cggcagca 58
<210> 15
<211> 58
<212> DNA
<213>artificial sequence (Artifial Sequence)
<400> 15
caggttcagt ggagaccaaa taatgcaggt gaattacctt cgtggccatt actgcctc 58
<210> 16
<211> 70
<212> DNA
<213>artificial sequence (Artifial Sequence)
<400> 16
aggcacaggt tcagtggaga ccaaataatg caggtgaatt accttcgtgg ccattactgc 60
ctcsaacgaa 70
<210> 17
<211> 77
<212> DNA
<213>artificial sequence (Artifial Sequence)
<400> 17
tgtcgtggac tgaatgataa ccttttcttt cttcatatag gctgatcagc tgaccgaaga 60
acagattgct ggtaagt 77
<210> 18
<211> 74
<212> DNA
<213>artificial sequence (Artifial Sequence)
<400> 18
tctccctatt tgataaagat ggcgatggca ccatcacaac aaaggaactt ggaactgtca 60
tgaggtcact gggt 74
<210> 19
<211> 84
<212> DNA
<213>artificial sequence (Artifial Sequence)
<400> 19
caccatcaca acaaaggaac ttggaactgt catgaggtca ctgggtcaga acccaacaga 60
agctgaattg caggatatga tcaa 84
<210> 20
<211> 89
<212> DNA
<213>artificial sequence (Artifial Sequence)
<400> 20
tttgactatg atggctagaa aaatgaaaga tacagatagt gaagaagaaa tccgtgaggc 60
attccgagtc tttgacaagg taatccagc 89
<210> 21
<211> 92
<212> DNA
<213>artificial sequence (Artifial Sequence)
<400> 21
ataacaattg ctgaatgttc acaggatggc aatggttata tcagtgcagc agaactacgt 60
cacgtcatga caaacttagg agaaaaacta ac 92
<210> 22
<211> 94
<212> DNA
<213>artificial sequence (Artifial Sequence)
<400> 22
catcattagc aataacaatt gctgaatgtt cacaggatgg caatggttat atcagtgcag 60
cagaactacg tcacgtcatg acaaacttag gaga 94
<210> 23
<211> 93
<212> DNA
<213>artificial sequence (Artifial Sequence)
<400> 23
agaattatca tcatcatcat catcttcatc atcatcttca gtgtttatct ttccagaaag 60
cacatcctca atccagtcct ccagctcctc agc 93
<210> 24
<211> 59
<212> DNA
<213>artificial sequence (Artifial Sequence)
<400> 24
ccagacactg tcagcctgca gtgagggaca aaatgaatga gtgggtaaat gcatgaggg 59
<210> 25
<211> 77
<212> DNA
<213>artificial sequence (Artifial Sequence)
<400> 25
atcatctgga atctccatcc agacactgtc agcctgcagt gagggacaaa atgaatgagt 60
gggtaaatgc atgaggg 77
<210> 26
<211> 61
<212> DNA
<213>artificial sequence (Artifial Sequence)
<400> 26
aggggatact cacatctgtg acattcacca ccccaatctg tggcctgaat aggtcaatct 60
t 61
<210> 27
<211> 56
<212> DNA
<213>artificial sequence (Artifial Sequence)
<400> 27
cagtattgtc ccgggcaacc tgtttcagga tctccaggaa ttcgtagcca tctgaa 56
<210> 28
<211> 67
<212> DNA
<213>artificial sequence (Artifial Sequence)
<400> 28
ctccaggaat tcgtagccat ctgaaacagg attcaagaga gttgagtaac ccctgcacat 60
acacagc 67
<210> 29
<211> 66
<212> DNA
<213>artificial sequence (Artifial Sequence)
<400> 29
ctagagctgt aaaagagcag gttgaaggtt tcctacctgg atcactcttc tctgcaaagg 60
ccacaa 66
<210> 30
<211> 62
<212> DNA
<213>artificial sequence (Artifial Sequence)
<400> 30
tgcctctttc ttacccatgt ttcaaacatt tcttctgggc gcaggcgacg tagagtgggt 60
ct 62
<210> 31
<211> 75
<212> DNA
<213>artificial sequence (Artifial Sequence)
<400> 31
ctatactcat ctctacaagg caaagagagt ttgcctcttt cttacccatg tttcaaacat 60
ttcttctggg cgcag 75
<210> 32
<211> 69
<212> DNA
<213>artificial sequence (Artifial Sequence)
<400> 32
ctcttctgtg taaggtttgt tggggatggc aatgggctca tccataaatg gctcatagaa 60
gtcaacctc 69
<210> 33
<211> 76
<212> DNA
<213>artificial sequence (Artifial Sequence)
<400> 33
cctttgtcaa aggtggcaaa gaatttgatg taaggctgga agtgttcagc tgcttcttca 60
aaagccttgt agtcta 76
<210> 34
<211> 90
<212> DNA
<213>artificial sequence (Artifial Sequence)
<400> 34
attggggttt cataggtact tacccctttg tcaaaggtgg caaagaattt gatgtaaggc 60
tggaagtgtt cagctgcttc ttcaaaagcc 90
<210> 35
<211> 83
<212> DNA
<213>artificial sequence (Artifial Sequence)
<400> 35
aacttacatt ctgagtcctc actcttgaaa aagccaatga gtttgatgta gtcttcaatg 60
cgttcgaagg cttggacttc cag 83
<210> 36
<211> 82
<212> DNA
<213>artificial sequence (Artifial Sequence)
<400> 36
tctattgtgc gatcaccctt aagaatatac aggcttcctt cttcatcaaa acctgtaaga 60
aacaaagagg cccacagaga ag 82
<210> 37
<211> 91
<212> DNA
<213>artificial sequence (Artifial Sequence)
<400> 37
actccaccaa gacatcagct gcaaactcgc catcaaactc tattgtgcga tcacccttaa 60
gaatatacag gcttccttct tcatcaaaac c 91
<210> 38
<211> 78
<212> DNA
<213>artificial sequence (Artifial Sequence)
<400> 38
ttcgtttctt tcccacatac agtatctcaa aaatcacact tacccagttt cttggcaagc 60
ttggcttctt tcttggca 78
<210> 39
<211> 58
<212> DNA
<213>artificial sequence (Artifial Sequence)
<400> 39
tcggaaagac ttaccactcg gtccttccca tcatatgtgg ggaaattaag cccctctt 58
<210> 40
<211> 90
<212> DNA
<213>artificial sequence (Artifial Sequence)
<400> 40
tcccatcata tgtggggaaa ttaagcccct cttctgccct gcaagaggac agaaaataaa 60
tccccacaat aaacaagtga gttctcttca 90
<210> 41
<211> 81
<212> DNA
<213>artificial sequence (Artifial Sequence)
<400> 41
aaagaacaac agaagctatg cttggcagca gaaggatttg gcaacagact ttgtttcttg 60
gagtccactt ccaattccaa g 81
<210> 42
<211> 56
<212> DNA
<213>artificial sequence (Artifial Sequence)
<400> 42
tgaagatgat gctgctgact gctcttcctc tttctgtgca gaatgtgccc ccagac 56
<210> 43
<211> 59
<212> DNA
<213>artificial sequence (Artifial Sequence)
<400> 43
ctgcaggaga tgctggctaa caccgtggag aaatcagaag gggcaagtac ccaatttat 59
<210> 44
<211> 69
<212> DNA
<213>artificial sequence (Artifial Sequence)
<400> 44
acggacatgc catattgctg cgccattcct atagtggcat ggtgagtagg catttgattt 60
catctccct 69
<210> 45
<211> 67
<212> DNA
<213>artificial sequence (Artifial Sequence)
<400> 45
aaacctctac ttacaactac tgattttgta ctttgtagta tctgtgctgc ctgtccacct 60
cccggtc 67
<210> 46
<211> 91
<212> DNA
<213>artificial sequence (Artifial Sequence)
<400> 46
ctacttacaa ctactgattt tgtactttgt agtatctgtg ctgcctgtcc acctcccggt 60
cttcaactga taagctggct tttgatgttg g 91
<210> 47
<211> 60
<212> DNA
<213>artificial sequence (Artifial Sequence)
<400> 47
tgataagctg gcttttgatg ttggcttgca agaggacacc acaggtaagc atcttgtgct 60
<210> 48
<211> 68
<212> DNA
<213>artificial sequence (Artifial Sequence)
<400> 48
cgatcagaag gagaaaaagt acgagttgga gatgacctca tcttagttag cgtgtcctct 60
gaaaggta 68
<210> 49
<211> 77
<212> DNA
<213>artificial sequence (Artifial Sequence)
<400> 49
accatacacc ctgcctctaa gcagcgatca gaaggagaaa aagtacgagt tggagatgac 60
ctcatcttag ttagcgt 77
<210> 50
<211> 63
<212> DNA
<213>artificial sequence (Artifial Sequence)
<400> 50
cctgaagtga tgcctccttt tgcctcttga tacagcactt gtcttatggc aacggcagct 60
tac 63
<210> 52
<211> 55
<212> DNA
<213>artificial sequence (Artifial Sequence)
<400> 52
atccttacag ggtatctcat tggtggtgat gtcctcaggt tgctgcatgg acaca 55
<210> 52
<211> 67
<212> DNA
<213>artificial sequence (Artifial Sequence)
<400> 52
ccttcaggag aacatggtga agagcagcgg aggttagtac ctgagctcat tgcattgaga 60
cttgcac 67
<210> 53
<211> 88
<212> DNA
<213>artificial sequence (Artifial Sequence)
<400> 53
catgtttaac tcacatttgg gcttttgttt gtttgttgaa acagaactgt tcattatgaa 60
ggtggcgctg tgtctgttca tgcacgtt 88
<210> 54
<211> 69
<212> DNA
<213>artificial sequence (Artifial Sequence)
<400> 54
taagatgggg acagccattc cgactacgcc atgtcacaac aggaaaatac ttgagtctca 60
tggaagaca 69
<210> 55
<211> 91
<212> DNA
<213>artificial sequence (Artifial Sequence)
<400> 55
ttccgactac gccatgtcac aacaggaaaa tacttgagtc tcatggaaga caaaaacctt 60
ctactcatgg acaaagagaa agctgatgta a 91
<210> 56
<211> 79
<212> DNA
<213>artificial sequence (Artifial Sequence)
<400> 56
ctcagtatgc tatatacaac atgtagacac aggcctatgg cttacttacc agtctgtgga 60
cgtgaaatcc gtgagaatg 79
<210> 57
<211> 59
<212> DNA
<213>artificial sequence (Artifial Sequence)
<400> 57
agtttgtcga gatcccagca tgaagaatca cgcacagccc gagttatccg gagcacagt 59
<210> 58
<211> 95
<212> DNA
<213>artificial sequence (Artifial Sequence)
<400> 58
ccagcatgaa gaatcacgca cagcccgagt tatccggagc acagtcttcc ttttcaatag 60
atttataagg tactttttct tttgtaggcg tagtt 95
<210> 59
<211> 75
<212> DNA
<213>artificial sequence (Artifial Sequence)
<400> 59
catttagagc atgaagacaa acagaacaga ctacgagccc tgaagaatcg gcaaaatctc 60
ttccaggaag aggtc 75
<210> 60
<211> 58
<212> DNA
<213>artificial sequence (Artifial Sequence)
<400> 60
agcagtgcag cacactttgc tgatgttgct gggcgagaag caggagagtc ttggaaat 58
<210> 61
<211> 79
<212> DNA
<213>artificial sequence (Artifial Sequence)
<400> 61
tgctgatgtt gctgggcgag aagcaggaga gtcttggaaa tccattctga attctctgta 60
tgagttgctg ggtaagaag 79
<210> 62
<211> 73
<212> DNA
<213>artificial sequence (Artifial Sequence)
<400> 62
tgcagcggct ctaattagag gaaatcgtaa aaactgtgct caattttctg gctccctcga 60
ctggttgatc agc 73
<210> 63
<211> 59
<212> DNA
<213>artificial sequence (Artifial Sequence)
<400> 63
cactctgtgt ttgccacggg gttgcagtcc gttctaacca gcatctcatc tgtgacaat 59
<210> 64
<211> 93
<212> DNA
<213>artificial sequence (Artifial Sequence)
<400> 64
catctcatct gtgacaatct cctaccagga agagacttgt tattgcagac acgtcttgtg 60
aaccatgtca gcaggtaaat tcagacagac aat 93
<210> 65
<211> 80
<212> DNA
<213>artificial sequence (Artifial Sequence)
<400> 65
catgagaccc aatatttttc tgggcgtcag tgaaggttct gctcagtata agaaatggta 60
ctatgaattg atggtggacc 80
<210> 66
<211> 74
<212> DNA
<213>artificial sequence (Artifial Sequence)
<400> 66
atctcttctc ctatggattt gatggccttc atctctggtc aggtacgtac tatccatttt 60
ctttcaccgt gttc 74
<210> 67
<211> 90
<212> DNA
<213>artificial sequence (Artifial Sequence)
<400> 67
tggagatgat ctcttctcct atggatttga tggccttcat ctctggtcag gtacgtacta 60
tccattttct ttcaccgtgt tccagaagat 90
<210> 68
<211> 94
<212> DNA
<213>artificial sequence (Artifial Sequence)
<400> 68
atacatgacc ttccttaatg ttttcccccc aataggttgt attgctcgta ctgtaagctc 60
accaaaccaa catctgttaa gaactgatga tgtc 94
<210> 69
<211> 86
<212> DNA
<213>artificial sequence (Artifial Sequence)
<400> 69
atgtcatcag ttgctgttta gatctgagtg ccccaagcat ctcgttccga attaatggac 60
aacctgttca aggaatgttt gagaat 86
<210> 70
<211> 69
<212> DNA
<213>artificial sequence (Artifial Sequence)
<400> 70
ataaaattga ctctaacgtg catcctcttt agagtacgct ttctgcttgg agggcgacat 60
ggagaattc 69
<210> 71
<211> 88
<212> DNA
<213>artificial sequence (Artifial Sequence)
<400> 71
tgctccttgt tatgaagctg ttctgccaaa agaaaagttg aaagtggaac acagccgaga 60
gtacaagcaa gaaagaactt acacacgc 88
<210> 72
<211> 95
<212> DNA
<213>artificial sequence (Artifial Sequence)
<400> 72
cgtgttgcct cctcatctag aaagaataag agaaaaactg gcagagaata tccatgaact 60
ctgggttatg aataaaattg agcttggctg gcagt 95
<210> 73
<211> 67
<212> DNA
<213>artificial sequence (Artifial Sequence)
<400> 73
caatttcctg tcctgtttca ggttagagat gacaacaaga gacaacaccc atgcctggtg 60
gagttct 67
<210> 74
<211> 87
<212> DNA
<213>artificial sequence (Artifial Sequence)
<400> 74
tgatcacact tatctctggt tttgttttcc aggactttgt tggcattagg atgtcatgtg 60
ggtatatcag atgaacatgc tgaagac 87
<210> 75
<211> 58
<212> DNA
<213>artificial sequence (Artifial Sequence)
<400> 75
ctgacaagtg gatacaagcc tgcccctatg gacctgagct ttatcaaact caccccat 58
<210> 76
<211> 84
<212> DNA
<213>artificial sequence (Artifial Sequence)
<400> 76
ttgtagttac cagctgacaa gtggatacaa gcctgcccct atggacctga gctttatcaa 60
actcacccca tcacaagaag caat 84
<210> 77
<211> 62
<212> DNA
<213>artificial sequence (Artifial Sequence)
<400> 77
acagaagaaa tcctcgcctt gttccctaca ctcttctgga tgaccgaacc aagaaatcca 60
ac 62
<210> 78
<211> 55
<212> DNA
<213>artificial sequence (Artifial Sequence)
<400> 78
cacctcccca tccaatgacc accagaaatc tctgtccatt tcccagcagc cagag 55
<210> 79
<211> 59
<212> DNA
<213>artificial sequence (Artifial Sequence)
<400> 79
tattttgaat ttgagacggt cactgctgga gacatgaggg ttggttggag tcgtcctgg 59
<210> 80
<211> 57
<212> DNA
<213>artificial sequence (Artifial Sequence)
<400> 80
aaccggatca ggagcttggc tcagatgaac gtgcctttgc ctttgatggc ttcaagg 57
<210> 81
<211> 67
<212> DNA
<213>artificial sequence (Artifial Sequence)
<400> 81
caagcaggcg atgtcgtggg gtgtatggtt gacatgaacg aacacaccat gatgttcaca 60
ctgaatg 67
<210> 82
<211> 87
<212> DNA
<213>artificial sequence (Artifial Sequence)
<400> 82
ttgacatgaa cgaacacacc atgatgttca cactgaatgg tgaaatcctt cttgatgatt 60
caggctcaga actggctttc aaggact 87
<210> 83
<211> 75
<212> DNA
<213>artificial sequence (Artifial Sequence)
<400> 83
ttttcttccc aggattcata cctgtgtgta gccttggagt ggctcaagtg ggtaggatga 60
actttggaaa ggatg 75
<210> 84
<211> 67
<212> DNA
<213>artificial sequence (Artifial Sequence)
<400> 84
agtcttttgg ttctcagaac agcaacactg atatcatgtt ttatcgcctg agcatgccga 60
tcgagtg 67
<210> 85
<211> 88
<212> DNA
<213>artificial sequence (Artifial Sequence)
<400> 85
ctaggtgacc agaatagacg gcaccataga cagttcccca tgtttaaagg tcactcagaa 60
gtcttttggt tctcagaaca gcaacact 88
<210> 86
<211> 84
<212> DNA
<213>artificial sequence (Artifial Sequence)
<400> 86
tttgggccca agaatgactt ggaagattat gatgctgatt ctgactttga ggttctgatg 60
aagacagctc atggccatct agtg 84
<210> 87
<211> 63
<212> DNA
<213>artificial sequence (Artifial Sequence)
<400> 87
ttgctgatga tcgggatgac tatgatttct tgatgcaaac gtccacggta tgaggttgca 60
gct 63
<210> 88
<211> 80
<212> DNA
<213>artificial sequence (Artifial Sequence)
<400> 88
ccattctgca agactcaccg aagatgtcct tgctgatgat cgggatgact atgatttctt 60
gatgcaaacg tccacggtat 80
<210> 89
<211> 92
<212> DNA
<213>artificial sequence (Artifial Sequence)
<400> 89
tatgacacag gctttgactt ggacagagtt cgcacagtaa cagttactct aggagatgaa 60
aaaggaaaag tgcatgaaag gttagttttc ct 92
<210> 90
<211> 66
<212> DNA
<213>artificial sequence (Artifial Sequence)
<400> 90
aatggcaagg aactgagcac atactatcag gtacgcggtc agtgatgata tcagtcttct 60
agggag 66
<210> 91
<211> 94
<212> DNA
<213>artificial sequence (Artifial Sequence)
<400> 91
ttatctgtgg ttgtacaaag ataaaaatgt tcttttgaaa ttcagcatca aacgcagcaa 60
ctgctatatg gtatgtgcgg gtgagagcat gagc 94
<210> 92
<211> 94
<212> DNA
<213>artificial sequence (Artifial Sequence)
<400> 92
tttcaggtgg aaccgagtac aaaattattt cctgcggttt ttgcacaagc tacaagtccc 60
aatgttttcc agtttgagtt gggaagaata aagg 94
<210> 93
<211> 61
<212> DNA
<213>artificial sequence (Artifial Sequence)
<400> 93
atcctctgca gttcatgtct cttcatatcc ctgaggaaaa caggtcagcc ccagtgaatc 60
c 61
<210> 94
<211> 60
<212> DNA
<213>artificial sequence (Artifial Sequence)
<400> 94
cagagttccc actggacatc ctcaagtcca aaaccataca gatgctgaca gaagctgtta 60
<210> 95
<211> 87
<212> DNA
<213>artificial sequence (Artifial Sequence)
<400> 95
acccagttgg agggactact gaattcctct ttgtacctct catcaagctt ttctataccc 60
tgctgatcat gggcatcttt cacaacg 87
<210> 96
<211> 68
<212> DNA
<213>artificial sequence (Artifial Sequence)
<400> 96
aagcggccca aggaaggcct gctccaaatg aaactgccag agccagttaa attgcaggta 60
atcagaac 68
<210> 97
<211> 56
<212> DNA
<213>artificial sequence (Artifial Sequence)
<400> 97
ctgccaggtc cggcaccgga tagaagccat tgtagccttt tcagatgatt ttgtgg 56
<210> 98
<211> 92
<212> DNA
<213>artificial sequence (Artifial Sequence)
<400> 98
tcagctgcac tcacagccag gaagacaaag gaatttagat caccacctca agaacaggta 60
cagaaatgaa atgaaaattc ttcgtattta tg 92
<210> 99
<211> 64
<212> DNA
<213>artificial sequence (Artifial Sequence)
<400> 99
cagttgagag tgactccaaa aagtcctgta agcagtatga gagtgcactg gcagaatgac 60
ccaa 64
<210> 100
<211> 82
<212> DNA
<213>artificial sequence (Artifial Sequence)
<400> 100
aagaagcaag cagaaaaacc agttgagagt gactccaaaa agtcctgtaa gcagtatgag 60
agtgcactgg cagaatgacc ca 82
<210> 101
<211> 56
<212> DNA
<213>artificial sequence (Artifial Sequence)
<400> 101
cggcattggg ggtcttgttc gggccctgcc aaagacctac acgataaatg gtgtgt 56
<210> 102
<211> 69
<212> DNA
<213>artificial sequence (Artifial Sequence)
<400> 102
ttggaggtgg agagtccaag gtaacgtctt tgattcctga gatgctattt agtatcatct 60
cctggagta 69
<210> 103
<211> 87
<212> DNA
<213>artificial sequence (Artifial Sequence)
<400> 103
tagggatatt atgaataaca aagtgtttta ccagcaccct aatctcatga gggcactggg 60
gatgcacgag actgtgatgg aggtcat 87
<210> 104
<211> 82
<212> DNA
<213>artificial sequence (Artifial Sequence)
<400> 104
agctaatgac atgctttatc tgtaggaaat cacctttccc aagatggtgg ccaactgttg 60
ccgttttctc tgttacttct gt 82
<210> 105
<211> 65
<212> DNA
<213>artificial sequence (Artifial Sequence)
<400> 105
cagctatgag aggttcaaca ccactggatg tggctgcagc ttcggtgatg gataataatg 60
aacta 65
<210> 106
<211> 83
<212> DNA
<213>artificial sequence (Artifial Sequence)
<400> 106
acgatccagg ttatatttca tcttcatttg aattaatagc ctccccagct atgagaggtt 60
caacaccact ggatgtggct gca 83
<210> 107
<211> 68
<212> DNA
<213>artificial sequence (Artifial Sequence)
<400> 107
aagttgccag atgctggtgt ctaagggcta tccagacatt gggtggaacc cagttgaagg 60
agagagat 68
<210> 108
<211> 59
<212> DNA
<213>artificial sequence (Artifial Sequence)
<400> 108
tggaggaaaa tgcaaatgtc gtggtgagat tgctcattcg gaggcctgag tgttttggt 59
<210> 109
<211> 71
<212> DNA
<213>artificial sequence (Artifial Sequence)
<400> 109
tcccgagatg gtccctcacc aaatagcgga tccagtaaaa cactgtaggt ctaatataca 60
caccctcacg a 71
<210> 110
<211> 77
<212> DNA
<213>artificial sequence (Artifial Sequence)
<400> 110
cattcatgaa agtgacacag aggaggagga agatgacact atccacatgg ggaacgcgat 60
catgaccttc tattcag 77
<210> 111
<211> 60
<212> DNA
<213>artificial sequence (Artifial Sequence)
<400> 111
agaattaggt ccattttgag atccctcatt cccctgggag atttggtggg cgttatcagc 60
<210> 112
<211> 93
<212> DNA
<213>artificial sequence (Artifial Sequence)
<400> 112
ttcccctggg agatttggtg ggcgttatca gcatcgcttt tcagatgcca acaatagcca 60
aaggtaaggc caacttcaat ttgtcctaat tca 93
<210> 113
<211> 77
<212> DNA
<213>artificial sequence (Artifial Sequence)
<400> 113
caccaaaatt cacttctctc ttttagatgg gaatgtggtg gaacctgaca tgtctgcggg 60
gttttgccca gatcaca 77
<210> 114
<211> 86
<212> DNA
<213>artificial sequence (Artifial Sequence)
<400> 114
tgtgtataga ctttctaagg gctgttcact taccaaagct cagcgggatt ccatagaagt 60
ttgtttactc tctatttgtg ggtgag 86
<210> 115
<211> 95
<212> DNA
<213>artificial sequence (Artifial Sequence)
<400> 115
tatagacttt ctaagggctg ttcacttacc aaagctcagc gggattccat agaagtttgt 60
ttactctcta tttgtgggtg agtggataac aaatt 95
<210> 116
<211> 67
<212> DNA
<213>artificial sequence (Artifial Sequence)
<400> 116
catagctgct gacaaatcat tatgaaagat gctggaaata ttactgcctg cctggagggt 60
ggggaaa 67
<210> 117
<211> 83
<212> DNA
<213>artificial sequence (Artifial Sequence)
<400> 117
ctgacaaatc attatgaaag atgctggaaa tattactgcc tgcctggagg gtggggaaac 60
tttggtgctg cctcagaaga aga 83
<210> 118
<211> 88
<212> DNA
<213>artificial sequence (Artifial Sequence)
<400> 118
cgggagcttt gcctccagac tacatggagt caaattatgt cagtatgatg gaaaaacagt 60
catcaatgga ttctgaaggg aactttaa 88
<210> 119
<211> 71
<212> DNA
<213>artificial sequence (Artifial Sequence)
<400> 119
aatcaaagaa tctttaaaaa ctatgctggc ttggggctgg agaattgaaa gaactcggga 60
gggagacagc a 71
<210> 120
<211> 82
<212> DNA
<213>artificial sequence (Artifial Sequence)
<400> 120
tggcccttta caaccggact cgtcgtattt ctcagacaag ccaggtaaga attcatcacg 60
gtgatgaatc aactgtttat gt 82
<210> 121
<211> 63
<212> DNA
<213>artificial sequence (Artifial Sequence)
<400> 121
acaaatgatc taggtttctg tggacgctgc ccatggttac agtccccggg ccattgacat 60
gag 63
<210> 122
<211> 77
<212> DNA
<213>artificial sequence (Artifial Sequence)
<400> 122
tcttgtcctg acatactctt aggaggagga aaccatcctc tgctggtgcc ctatgataca 60
ctgacagcca aagagaa 77
<210> 123
<211> 86
<212> DNA
<213>artificial sequence (Artifial Sequence)
<400> 123
atacactgac agccaaagag aaagccaagg atagagaaaa agcacaggac atcctcaagt 60
tcttgcagat caatggatat gctgta 86
<210> 124
<211> 92
<212> DNA
<213>artificial sequence (Artifial Sequence)
<400> 124
tgtacaaatt gctttcccat tttcattttt gctcttccag aggatttaag gacctggaac 60
tggacacgcc ttctattgag aaacgatttg cc 92
<210> 125
<211> 80
<212> DNA
<213>artificial sequence (Artifial Sequence)
<400> 125
tcccattttc atttttgctc ttccagagga tttaaggacc tggaactgga cacgccttct 60
attgagaaac gatttgccta 80
<210> 126
<211> 77
<212> DNA
<213>artificial sequence (Artifial Sequence)
<400> 126
caatgtttcc agtgcagcat ttacctaaaa actcttcaaa tctacagatg gtggcagcag 60
aggcaaagga gaacatt 77
<210> 127
<211> 84
<212> DNA
<213>artificial sequence (Artifial Sequence)
<400> 127
ttcaaaaacc atcgtttata cttcttatct gcagcaagca gacctctctg ctctggagga 60
catgcttcca acaaagagaa agaa 84
<210> 128
<211> 93
<212> DNA
<213>artificial sequence (Artifial Sequence)
<400> 128
cagcaagcag acctctctgc tctggaggac atgcttccaa caaagagaaa gaaatggtga 60
ctaggtaaac agctataaaa ataagcactg ttg 93
<210> 129
<211> 81
<212> DNA
<213>artificial sequence (Artifial Sequence)
<400> 129
ccttcccttc ccccttccct tttctctttt gtttttcttt tgtcttcagc ctattctgca 60
aacttggagt tcttgtcagg c 81
<210> 130
<211> 94
<212> DNA
<213>artificial sequence (Artifial Sequence)
<400> 130
cagggcaatt tatacagcat tttgtttcct ctttaggcaa tgatgcaaca tcaattgtca 60
actgtcttca tattttgggt cagactttgg atgc 94
<210> 131
<211> 64
<212> DNA
<213>artificial sequence (Artifial Sequence)
<400> 131
aagactggcc tggagagtgt taaaagtgca ctcagagctt ttctggacaa cgctgcagag 60
gatc 64
<210> 132
<211> 88
<212> DNA
<213>artificial sequence (Artifial Sequence)
<400> 132
ccttagtgga agatgtccag gtgtcttgtt atagaattct gactagctta tatgctttgg 60
gaaccagcaa gagtatttac gtggagag 88
<210> 133
<211> 73
<212> DNA
<213>artificial sequence (Artifial Sequence)
<400> 133
aacgttctgc attaggagaa tgtctagctg cctttgctgg tgcttttcct gtagcatttt 60
tggaaactca tct 73
<210> 134
<211> 86
<212> DNA
<213>artificial sequence (Artifial Sequence)
<400> 134
taggcaacgt tctgcattag gagaatgtct agctgccttt gctggtgctt ttcctgtagc 60
atttttggaa actcatctgg acaaac 86
<210> 135
<211> 67
<212> DNA
<213>artificial sequence (Artifial Sequence)
<400> 135
tcgtggaatt agccgagtcc ggcattcgct acactcaaat gccacatgtc atggaagtca 60
tactgcc 67
<210> 136
<211> 64
<212> DNA
<213>artificial sequence (Artifial Sequence)
<400> 136
aggcagaact cctcatccta gatgagttca ccacactggc cagagatctc tatgccttct 60
accc 64
<210> 137
<211> 87
<212> DNA
<213>artificial sequence (Artifial Sequence)
<400> 137
agtgaaacct cagctcttga aaactcattt cttgccgtta atggagaaac tcaagaaaaa 60
ggcagctacg gtggtgtctg aggaaga 87
<210> 138
<211> 65
<212> DNA
<213>artificial sequence (Artifial Sequence)
<400> 138
tttattatgt gatccagggc aaagtggcta aaggagccta acccagaagc agaggagctc 60
ttccg 65
<210> 139
<211> 60
<212> DNA
<213>artificial sequence (Artifial Sequence)
<400> 139
ctcattgctc tggccaaaaa tcgatttagc ctggtaagtc tccttttcat cccagcggta 60
<210> 140
<211> 93
<212> DNA
<213>artificial sequence (Artifial Sequence)
<400> 140
ttgttccata ggcagctgtt tctgatcagg aaaggaagaa aatgaagcgc aaaggagatc 60
ggtattccat gcagacctct ctgattgtag cag 93
<210> 141
<211> 80
<212> DNA
<213>artificial sequence (Artifial Sequence)
<400> 141
ctgcagttgg aggatcctgc tattagatgg caaatggctc tttacaaaga cttaccaaac 60
aggactgatg atacctcaga 80
<210> 142
<211> 68
<212> DNA
<213>artificial sequence (Artifial Sequence)
<400> 142
tcagaagtct aaacgtgtgg gtcggagaca ttactgtctg ggaagtacag tgctcaatgg 60
cctagaga 68
<210> 143
<211> 77
<212> DNA
<213>artificial sequence (Artifial Sequence)
<400> 143
aacgtgtggg tcggagacat tactgtctgg gaagtacagt gctcaatggc ctagagatta 60
ctaattaatt taggttt 77
<210> 144
<211> 69
<212> DNA
<213>artificial sequence (Artifial Sequence)
<400> 144
agggctgttg tagcctgctt ccggatggcc cccttatata atctgccaag gtcggaatta 60
ctttatttt 69
<210> 145
<211> 94
<212> DNA
<213>artificial sequence (Artifial Sequence)
<400> 145
ccctttttct gaaattgtgc ttacctttca ggcatcgggc tgtcaatctc tttcttcagg 60
gatatgaaaa gtcttggatt gaaacagaag aaca 94
<210> 146
<211> 63
<212> DNA
<213>artificial sequence (Artifial Sequence)
<400> 146
tggggctgaa cctccagaag aagatgaagg cactaagaga gttgatcctc tacatcagct 60
gat 63
<210> 147
<211> 83
<212> DNA
<213>artificial sequence (Artifial Sequence)
<400> 147
aaacctgggg ctgaacctcc agaagaagat gaaggcacta agagagttga tcctctacat 60
cagctgatcc ttctgtttag tcg 83
<210> 148
<211> 86
<212> DNA
<213>artificial sequence (Artifial Sequence)
<400> 148
tatacagagt tgtcatgatg aggaagatga cgatggtgaa gaggaagtga agagttttga 60
agtaagatgg atctttctgg atttgc 86
<210> 149
<211> 58
<212> DNA
<213>artificial sequence (Artifial Sequence)
<400> 149
acagacaatc agtgccagca aaggtaaggt tccttgagtt cccctcacga gtgtctgt 58
<210> 150
<211> 88
<212> DNA
<213>artificial sequence (Artifial Sequence)
<400> 150
tagcagctac tctgaaactt ggaattgcta ttttaaatgg tgggaactcc acagtacagc 60
aggtaacagc ttccagtcat tcatataa 88
<210> 151
<211> 89
<212> DNA
<213>artificial sequence (Artifial Sequence)
<400> 151
atttcttagg tgaaactgga ccaatggtag cagctactct gaaacttgga attgctattt 60
taaatggtgg gaactccaca gtacagcag 89
<210> 152
<211> 60
<212> DNA
<213>artificial sequence (Artifial Sequence)
<400> 152
ctgatgcagt catgtaggta aggactcact tccttcttgg gggttctact cagtggttgt 60
<210> 153
<211> 82
<212> DNA
<213>artificial sequence (Artifial Sequence)
<400> 153
tgagcgacaa aacaaagctg aaggtcttgg gatggtgaca gaggaaggat caggtattaa 60
tgacttacat taaaaggatc ac 82
<210> 154
<211> 95
<212> DNA
<213>artificial sequence (Artifial Sequence)
<400> 154
tagtgtcctt gacctaaatg catttgagcg acaaaacaaa gctgaaggtc ttgggatggt 60
gacagaggaa ggatcaggta ttaatgactt acatt 95
<210> 155
<211> 60
<212> DNA
<213>artificial sequence (Artifial Sequence)
<400> 155
tggctggtaa tgtttgatcc ctctggattt cccacaggag aaaaggttct gcaggacgat 60
<210> 156
<211> 95
<212> DNA
<213>artificial sequence (Artifial Sequence)
<400> 156
tcagaattat ctgagaactc agactggcaa taatacaact gtcaacataa ttatctccac 60
tgtagactac ctactgagag ttcaggtatg ttgct 95
<210> 157
<211> 56
<212> DNA
<213>artificial sequence (Artifial Sequence)
<400> 157
tgtctgttta tgctccaggg tccttgcact gggaatcaac agagtttggc acacag 56
<210> 158
<211> 60
<212> DNA
<213>artificial sequence (Artifial Sequence)
<400> 158
aatcaacaga gtttggcaca cagcaggctg tgggatgctg tggtcggctt tcttcatgtg 60
<210> 159
<211> 68
<212> DNA
<213>artificial sequence (Artifial Sequence)
<400> 159
ctgtgggatg ctgtggtcgg ctttcttcat gtgtttgccc atatgcagat gaagctgtcg 60
caggtaaa 68
<210> 160
<211> 87
<212> DNA
<213>artificial sequence (Artifial Sequence)
<400> 160
tcaggattcc agtcaaattg agctattaaa agaattaatg gatctgcaga aggatatggt 60
ggtcatgttg ctgtccatgt tagaagg 87
<210> 161
<211> 66
<212> DNA
<213>artificial sequence (Artifial Sequence)
<400> 161
tcttttcatc ctactggagt attttcatga ccctcttgca cttcgtggcc agcgttttca 60
gaggct 66
<210> 162
<211> 58
<212> DNA
<213>artificial sequence (Artifial Sequence)
<400> 162
aaactgattc ctcataatcc aaatgctggg ctcagtgacc tcatgagcaa cccagtcc 58
<210> 163
<211> 86
<212> DNA
<213>artificial sequence (Artifial Sequence)
<400> 163
acagaggaaa gtgaccttct ttcggacatc tttggcctgg atctgaagag agaaggagga 60
cagtacaaac tgattcctca taatcc 86
<210> 164
<211> 72
<212> DNA
<213>artificial sequence (Artifial Sequence)
<400> 164
taggggagaa gatggagaaa aagaagagaa agccaaggaa gacaagggca aacaaaagtt 60
gaggcagctt ca 72
<210> 165
<211> 88
<212> DNA
<213>artificial sequence (Artifial Sequence)
<400> 165
aaaagttgag gcagcttcac acacacagat acggagaacc agaagtgcca gagtcagcat 60
tctggaagaa aatcatagca tatcaaca 88
<210> 166
<211> 66
<212> DNA
<213>artificial sequence (Artifial Sequence)
<400> 166
tcactatgta ctagaggaga gcagcggcta catggagccc acgttgcgta tcttagctat 60
tctgca 66
<210> 167
<211> 82
<212> DNA
<213>artificial sequence (Artifial Sequence)
<400> 167
cgagaaaagg aagtggcacg gaaattggaa tttgatgggc tttatattac agaacagcct 60
tcagaagatg atattaaagg cc 82
<210> 168
<211> 64
<212> DNA
<213>artificial sequence (Artifial Sequence)
<400> 168
agagttctac ggccgagaca gaatcagtga attacttggc atggacaagg cagctctgga 60
cttc 64
<210> 169
<211> 85
<212> DNA
<213>artificial sequence (Artifial Sequence)
<400> 169
aaaagaagaa gccaaagaaa gacagctcct tatcagctgt gtaagtgtta cttcggctct 60
atcctacaga cttagattga aaggg 85
<210> 170
<211> 85
<212> DNA
<213>artificial sequence (Artifial Sequence)
<400> 170
tgtcattgca gactgaactc cattgatgtg aagtatcaga tgtggaaact aggagtcgtt 60
ttcactgaca acgtaagcct acttc 85
<210> 171
<211> 93
<212> DNA
<213>artificial sequence (Artifial Sequence)
<400> 171
tgccgctcac cttctcgaca ttgctatggg attcaagaca ttaagaacca tcttgtcctc 60
agtaactcac aatggcaaac aggtaaacag ttt 93
<210> 172
<211> 82
<212> DNA
<213>artificial sequence (Artifial Sequence)
<400> 172
acctggtcct tgtcacattg ttttccagct cgtattaacc gttggcttat tagctgttgt 60
tgtataccta tacactgtgg tg 82
<210> 173
<211> 64
<212> DNA
<213>artificial sequence (Artifial Sequence)
<400> 173
aggagggatc ggggatgaaa tcgaagaccc agcaggagat gaatatgaga tctatcgaat 60
catc 64
<210> 174
<211> 83
<212> DNA
<213>artificial sequence (Artifial Sequence)
<400> 174
tggaggaggg atcggggatg aaatcgaaga cccagcagga gatgaatatg agatctatcg 60
aatcatcttt gacatcactt tct 83
<210> 175
<211> 91
<212> DNA
<213>artificial sequence (Artifial Sequence)
<400> 175
ctaattattg atgcttttgg agaactaaga gaccaacagg aacaagtcaa agaagacatg 60
gaggtaagct tctccattca tgactcagct t 91
<210> 176
<211> 77
<212> DNA
<213>artificial sequence (Artifial Sequence)
<400> 176
tttgttttct agaccaaatg cttcatctgt gggataggca atgattactt cgacacagtg 60
ccacatggct ttgaaac 77
<210> 177
<211> 85
<212> DNA
<213>artificial sequence (Artifial Sequence)
<400> 177
aatgattact tcgacacagt gccacatggc tttgaaaccc acactttaca ggagcacaac 60
ttggctaatt acttgtgagt gtgcc 85
<210> 178
<211> 85
<212> DNA
<213>artificial sequence (Artifial Sequence)
<400> 178
tatcaagaaa ggtgttggga atttttccca gcaggggatt gcttccggaa acagtatgaa 60
gaccagctaa attaaactca gaccc 85
<210> 179
<211> 55
<212> DNA
<213>artificial sequence (Artifial Sequence)
<400> 179
tggtggctct agtgacactg tcataggagg gtgggaagga agtggaggag atgga 55
<210> 180
<211> 70
<212> DNA
<213>artificial sequence (Artifial Sequence)
<400> 180
agttctccag gatgatggca atgtacatgt tgaccacgat gaggaaggag atgatgatgt 60
aggtggtgaa 70
<210> 181
<211> 56
<212> DNA
<213>artificial sequence (Artifial Sequence)
<400> 181
agctgacttg tatacccacc cacgatggag aggatgacaa ccacgaagtc gaagat 56
<210> 182
<211> 75
<212> DNA
<213>artificial sequence (Artifial Sequence)
<400> 182
agatggccac aaagagcagg ttgatcttgg ccaagatgtt gattttctca ggactttggt 60
catctgtctc cacca 75
<210> 183
<211> 59
<212> DNA
<213>artificial sequence (Artifial Sequence)
<400> 183
tatgaagccc tggtacttgt tctgaaagga gaggcaaatg gaaagtgctc agcagggcc 59
<210> 184
<211> 55
<212> DNA
<213>artificial sequence (Artifial Sequence)
<400> 184
tcctctgtca tgaagatgtc ctggccccct aagtgcaaag agaaggcacc aacct 55
<210> 185
<211> 63
<212> DNA
<213>artificial sequence (Artifial Sequence)
<400> 185
cttggagccc agcttcttca tggcattgta gtacttcttc tgctcctctg tcatgaagat 60
gtc 63
<210> 186
<211> 79
<212> DNA
<213>artificial sequence (Artifial Sequence)
<400> 186
cccagtgggg agctggtgct ctacgtatct ttttcttctg ttggttgaag ttgtcaatga 60
tgacaccaat aaagaggtt 79
<210> 187
<211> 63
<212> DNA
<213>artificial sequence (Artifial Sequence)
<400> 187
acatgtagag gttgtattcc cactgaggct gctcttcata ctgcaaggga gaaatcacac 60
agg 63
<210> 188
<211> 88
<212> DNA
<213>artificial sequence (Artifial Sequence)
<400> 188
aaaatgacaa aatagatgta catgtagagg ttgtattccc actgaggctg ctcttcatac 60
tgcaagggag aaatcacaca gggagatc 88
<210> 189
<211> 68
<212> DNA
<213>artificial sequence (Artifial Sequence)
<400> 189
cctggagtcc acagctgcat acataatgtc catccagcct ttaaatgttg cctgggagga 60
aaagacaa 68
<210> 190
<211> 57
<212> DNA
<213>artificial sequence (Artifial Sequence)
<400> 190
aaagaggttc acgcccatga tgctgaagat gagccagaag atgaggcaga cgaggag 57
<210> 191
<211> 80
<212> DNA
<213>artificial sequence (Artifial Sequence)
<400> 191
aaagttgact ttcaccttgg tccagtacaa ttctccggtc aagttcaagg actcacactg 60
gctcttgttg ttcacgatgg 80
<210> 192
<211> 60
<212> DNA
<213>artificial sequence (Artifial Sequence)
<400> 192
cagcatctcc agcacgaaga catatgtgaa catcttgtcg gcatactcaa gcagaacctt 60
<210> 193
<211> 62
<212> DNA
<213>artificial sequence (Artifial Sequence)
<400> 193
aagccgtagg ccacccactt gagcagcatc tccagcacga agacatatgt gaacatcttg 60
tc 62
<210> 194
<211> 56
<212> DNA
<213>artificial sequence (Artifial Sequence)
<400> 194
accttgatgg tcttccgctc ctctaggtag atgtcctcga aggcctgcag acaagg 56
<210> 195
<211> 56
<212> DNA
<213>artificial sequence (Artifial Sequence)
<400> 195
ccccaggagg gtaccagcgc tccactgctg agtaggatca tgaagatgat gaatgt 56
<210> 196
<211> 68
<212> DNA
<213>artificial sequence (Artifial Sequence)
<400> 196
ctgagtagga tcatgaagat gatgaatgtc tcgaaccagc tgtgctccac gatgtggtag 60
caggtctt 68
<210> 197
<211> 55
<212> DNA
<213>artificial sequence (Artifial Sequence)
<400> 197
acacaggctg ggattcctgc tgaaaagacc ccagcctatg agctgagtcc acaca 55
<210> 198
<211> 55
<212> DNA
<213>artificial sequence (Artifial Sequence)
<400> 198
tcctccgtgc ccaggctgtt ctcctcatct tcttcttggt catctgtgtc tgact 55
<210> 199
<211> 61
<212> DNA
<213>artificial sequence (Artifial Sequence)
<400> 199
caaagagctg catgcccacc acagcaaaga tgaacacgat gatggctagc accagtgtca 60
g 61
<210> 200
<211> 66
<212> DNA
<213>artificial sequence (Artifial Sequence)
<400> 200
atggtgtgtg tgtggccctt ggccaactta ccacaaggtt gccaatgacc ataacaagca 60
agaaga 66
<210> 201
<211> 62
<212> DNA
<213>artificial sequence (Artifial Sequence)
<400> 201
tggaagtagt agtaggggtc gagggcaatg atcttgaagg tcatctctgc tgtgaaaatc 60
cc 62
<210> 202
<211> 63
<212> DNA
<213>artificial sequence (Artifial Sequence)
<400> 202
cccttaccag gtttccgacc tgcagcatct cctcgaattc acttgtcatg ttgtagtgct 60
cca 63
<210> 203
<211> 70
<212> DNA
<213>artificial sequence (Artifial Sequence)
<400> 203
atgttgtagt gctccagcgc catgaagagt gtgttgagta cgatgcacat agtgatggtg 60
aggtcagtaa 70
<210> 204
<211> 57
<212> DNA
<213>artificial sequence (Artifial Sequence)
<400> 204
ctctcccccg ctgtgctgtt ttcatcatct gcaaaatctg cttcagaacc caggtct 57
<210> 205
<211> 63
<212> DNA
<213>artificial sequence (Artifial Sequence)
<400> 205
cgctgtgctg ttttcatcat ctgcaaaatc tgcttcagaa cccaggtctc gcctgcgaaa 60
ggt 63
<210> 206
<211> 61
<212> DNA
<213>artificial sequence (Artifial Sequence)
<400> 206
caccctggaa aagctagaac cacagctggg attaccattg ctctgggacc atcttctgag 60
t 61
<210> 207
<211> 55
<212> DNA
<213>artificial sequence (Artifial Sequence)
<400> 207
cccacctcgt gttctttctt gagcatttcc atggcctcct ggaagcgctt ttcct 55
<210> 208
<211> 72
<212> DNA
<213>artificial sequence (Artifial Sequence)
<400> 208
atcaggttca ccaggtagaa ggaccccagg aagatgacaa gcatgaagaa gatcatgtag 60
atcttccctg cg 72
<210> 209
<211> 55
<212> DNA
<213>artificial sequence (Artifial Sequence)
<400> 209
agtcctgcgt catcaggcgg aagagtgcaa gaaaggccca ggcaaaggaa tcgaa 55
<210> 210
<211> 73
<212> DNA
<213>artificial sequence (Artifial Sequence)
<400> 210
acatacccag cgtcagagct gttcccacac agtaacacat cagaggtgcc gttcttgagc 60
aggtaatttt ctg 73
<210> 211
<211> 55
<212> DNA
<213>artificial sequence (Artifial Sequence)
<400> 211
tcacaaagtc ttccccagct gcagagcaag ttcgcacctg gatcactgag gtaaa 55
<210> 212
<211> 56
<212> DNA
<213>artificial sequence (Artifial Sequence)
<400> 212
agagcaagtt cgcacctgga tcactgaggt aaaggtccag ggattcccag accaag 56
<210> 213
<211> 66
<212> DNA
<213>artificial sequence (Artifial Sequence)
<400> 213
ccttggtgtt taacctgatt ttcacctgaa atgactgata tagttttcag ggcccggagg 60
actcgg 66
<210> 214
<211> 76
<212> DNA
<213>artificial sequence (Artifial Sequence)
<400> 214
aaacctgggc atcttacctg ggataactga aatagttttt agagctctca ggactctgaa 60
agttcgaaga gccgac 76
<210> 215
<211> 93
<212> DNA
<213>artificial sequence (Artifial Sequence)
<400> 215
ctgggcatct tacctgggat aactgaaata gtttttagag ctctcaggac tctgaaagtt 60
cgaagagccg acaaattgcc tagttttata ttt 93
<210> 216
<211> 58
<212> DNA
<213>artificial sequence (Artifial Sequence)
<400> 216
atctgttgat cagcttgtgc ctggctcaga agtccttgaa atcatgaggt ggaggtgg 58
<210> 217
<211> 60
<212> DNA
<213>artificial sequence (Artifial Sequence)
<400> 217
agacagaggc actggaagat gggaagagag gttgcctgaa tatctgttct tccaactact 60
<210> 218
<211> 65
<212> DNA
<213>artificial sequence (Artifial Sequence)
<400> 218
tcagcttgtg cctggctcag aagtccttga aatcatgagg tggaggtggc ctgaatactc 60
attgg 65
<210> 219
<211> 64
<212> DNA
<213>artificial sequence (Artifial Sequence)
<400> 219
cagtgtggcc tgcaaggcat agcacagcat agcaaatgag atacttacgc catgataatc 60
acac 64
<210> 220
<211> 55
<212> DNA
<213>artificial sequence (Artifial Sequence)
<400> 220
catgaacacg cagttggtga ggatggtgca catgatgagc atgttgaaga gcgtg 55
<210> 221
<211> 57
<212> DNA
<213>artificial sequence (Artifial Sequence)
<400> 221
tgcacatgat gagcatgttg aagagcgtgc gtggggtcaa ggaaagctga gcagcat 57
<210> 222
<211> 64
<212> DNA
<213>artificial sequence (Artifial Sequence)
<400> 222
ccagggggta ctcagcaggt attaactgca aaggatatga gtgaaccaga atcttcacag 60
ccgc 64
<210> 223
<211> 55
<212> DNA
<213>artificial sequence (Artifial Sequence)
<400> 223
atgagctctt ggggtggatt gccatagaga tctggcagct ttttggaggc ctgca 55
<210> 224
<211> 59
<212> DNA
<213>artificial sequence (Artifial Sequence)
<400> 224
ccccgaggta ataggaagtt tgccatcttc tcatcctgct tctgggcaca ggctctcct 59
<210> 225
<211> 60
<212> DNA
<213>artificial sequence (Artifial Sequence)
<400> 225
atttgcttga ccagagctct ctccagggcg gtctgcagga gtgaaaggaa actgaaatcc 60
<210> 226
<211> 75
<212> DNA
<213>artificial sequence (Artifial Sequence)
<400> 226
tctcaggtgt tattctattc atctcttact tgttggtttg ggcttggctg tggagaatgg 60
aggcaagcac atggc 75
<210> 227
<211> 78
<212> DNA
<213>artificial sequence (Artifial Sequence)
<400> 227
attctattca tctcttactt gttggtttgg gcttggctgt ggagaatgga ggcaagcaca 60
tggcatattg atgagtac 78
<210> 228
<211> 82
<212> DNA
<213>artificial sequence (Artifial Sequence)
<400> 228
cttgctccac tgtcttggtt gttttctctt ccttctttcc aggtacagct gcaaaacaaa 60
gataaggttt aaagaagagt tc 82
<210> 229
<211> 73
<212> DNA
<213>artificial sequence (Artifial Sequence)
<400> 229
ttgaaaccgc accaatctcc tctttggctc gttcagtttc tgcaagttca gatattaaag 60
gaatgagaag tgg 73
<210> 230
<211> 74
<212> DNA
<213>artificial sequence (Artifial Sequence)
<400> 230
catgagtatt cggaatccag caacagtggt cttactcacc tgagtgttct ttctttggtg 60
actttgctgt atca 74
<210> 231
<211> 86
<212> DNA
<213>artificial sequence (Artifial Sequence)
<400> 231
tggtaaattg tactcacaaa aggctcagtg ggattttgca taaaacatac cttccttctt 60
ttcatccttc ttagctgctg ctgaag 86
<210> 232
<211> 58
<212> DNA
<213>artificial sequence (Artifial Sequence)
<400> 232
tctggaagct tgttctgtcg gtaagggagg tggaatggct gggctttgtc ctacacaa 58
<210> 233
<211> 73
<212> DNA
<213>artificial sequence (Artifial Sequence)
<400> 233
tctggaagct tgttctgtcg gtaagggagg tggaatggct gggctttgtc ctacacaatg 60
tagaagtagg aat 73
<210> 234
<211> 70
<212> DNA
<213>artificial sequence (Artifial Sequence)
<400> 234
ctggagtttc tgatcccagg acctgggaac cctatgattg ggaaagacat aaggttaagg 60
tagaaggtat 70
<210> 235
<211> 62
<212> DNA
<213>artificial sequence (Artifial Sequence)
<400> 235
catgtgcttc ttgcccaata ttctcttaga acctccggca gcctcctgct ctgaatgttt 60
ac 62
<210> 236
<211> 86
<212> DNA
<213>artificial sequence (Artifial Sequence)
<400> 236
actgcatgtg cttcttgccc aatattctct tagaacctcc ggcagcctcc tgctctgaat 60
gtttaccttt ctgttcatgc tttgac 86
<210> 237
<211> 72
<212> DNA
<213>artificial sequence (Artifial Sequence)
<400> 237
cagttcagtc atggttcgct tagtcaatcc gtactcaaga gctgtgtcca acttctgtga 60
tcaaaggaat ta 72
<210> 238
<211> 82
<212> DNA
<213>artificial sequence (Artifial Sequence)
<400> 238
tgatgtcaga taacaaagaa aagaagccat agatccagtc cgtggtttcc tccatagcat 60
cacgtaccag ttttaaagga tc 82
<210> 239
<211> 91
<212> DNA
<213>artificial sequence (Artifial Sequence)
<400> 239
aagaagccat agatccagtc cgtggtttcc tccatagcat cacgtaccag ttttaaagga 60
tctgagccaa tcttggcaat agagcttgct a 91
<210> 240
<211> 59
<212> DNA
<213>artificial sequence (Artifial Sequence)
<400> 240
ttatcagggc aatgaccaga agccaggctg caggggagct gaacgtcgtc actatgtct 59
<210> 241
<211> 79
<212> DNA
<213>artificial sequence (Artifial Sequence)
<400> 241
tggtagcaat accttcagca gtgatctcag tcatggtggt cgtcaaaagt aaaagtcagt 60
tgaaaagttc ccgtcaagt 79
<210> 242
<211> 91
<212> DNA
<213>artificial sequence (Artifial Sequence)
<400> 242
tactatcgga aaatggtagc aataccttca gcagtgatct cagtcatggt ggtcgtcaaa 60
agtaaaagtc agttgaaaag ttcccgtcaa g 91
<210> 243
<211> 56
<212> DNA
<213>artificial sequence (Artifial Sequence)
<400> 243
acggtacatc gaggaagcag ggctggagct tacctgagaa agcgagtcca aggtga 56
<210> 244
<211> 55
<212> DNA
<213>artificial sequence (Artifial Sequence)
<400> 244
cgggatcatg ttggtctgga accaaaatca gtatcagggc cctttcagtg ctctc 55
<210> 245
<211> 57
<212> DNA
<213>artificial sequence (Artifial Sequence)
<400> 245
taactccgta ctgccggggg agcccgggat catgttggtc tggaaccaaa atcagta 57
<210> 246
<211> 59
<212> DNA
<213>artificial sequence (Artifial Sequence)
<400> 246
ttgaaggtga tctccaggct ggaccagaag tggtcggaga actcagggta catgtccag 59
<210> 247
<211> 56
<212> DNA
<213>artificial sequence (Artifial Sequence)
<400> 247
ttgcatacag gttcagaggc tccccaaaga tgtcattctt ccctggaggc catgga 56
<210> 248
<211> 76
<212> DNA
<213>artificial sequence (Artifial Sequence)
<400> 248
atctagattt gatcctactt taaggaagca aaaagtgtct gtttgtggcg gatcctgaag 60
ggaaggagaa tgtggg 76
<210> 249
<211> 87
<212> DNA
<213>artificial sequence (Artifial Sequence)
<400> 249
ctagatttga tcctacttta aggaagcaaa aagtgtctgt ttgtggcgga tcctgaaggg 60
aaggagaatg tgggaacccc agagttc 87
<210> 250
<211> 59
<212> DNA
<213>artificial sequence (Artifial Sequence)
<400> 250
cctgggcaca ctcacagcca atgagcatga cgcagatgga gaagatcttc tctgagttg 59
<210> 251
<211> 56
<212> DNA
<213>artificial sequence (Artifial Sequence)
<400> 251
cgtaggtggt gcggaagttg atgaggatgt ccacaatgaa catgatgtcc acgatg 56
<210> 252
<211> 67
<212> DNA
<213>artificial sequence (Artifial Sequence)
<400> 252
tgaccacctc ctcgttggca ttgacgtagg tggtgcggaa gttgatgagg atgtccacaa 60
tgaacat 67
<210> 253
<211> 58
<212> DNA
<213>artificial sequence (Artifial Sequence)
<400> 253
ccttgaggtc cacaaagttg agggtgattt ggggaatctt gctaatggtg cggtagcg 58
<210> 254
<211> 57
<212> DNA
<213>artificial sequence (Artifial Sequence)
<400> 254
cttctccatc accacctcga aattgaggat gaacatgatg acagccccat cctcgtt 57
<210> 255
<211> 66
<212> DNA
<213>artificial sequence (Artifial Sequence)
<400> 255
ccatgtcctt ctccatcacc acctcgaaat tgaggatgaa catgatgaca gccccatcct 60
cgttct 66

Claims (10)

1. a kind of construction method in the genetic test library of heredity arrhythmia cordis, which comprises the steps of: pass through The DNA library of the dedicated sequence measuring joints connection reaction preparation of illumina microarray dataset obtains mesh using the method for hybridization probe capture Regional libraries are marked, library is expanded using LMPCR method, then carry out library purifying to get sequencing genetic test library；The mesh Mark the coding of mutation and the above gene that regional DNA is KCNH2, KCNQ1, SCN5A, RYR2, CASQ2, TRDN, CALM1 gene Each 20 base zone of exon region and exon upstream and downstream of amino acid.
2. a kind of construction method in the genetic test library of heredity arrhythmia cordis as described in claim 1, which is characterized in that Include the following steps:
(1) DNA quality standard: the genomic DNA of subject's sample is provided, after nucleic acid extraction, quality inspection, it is desirable that DNA meets Certain quality control standard；
(2) prepared by library: will above-mentioned standard compliant genomic DNA, ultrasound is random to be interrupted to 180bp-220bp short-movie section, so End-filling is carried out afterwards and adds A, connects the dedicated sequence measuring joints of illumina microarray dataset, and certain total amount is reached by PCR amplification DNA library；
(3) hybrid capture: the library that step 2 is obtained carries out specific hybrid with disease associated custom probe, and capture contains purpose The library in region, then the DNA library containing destination region is left to get target area library by magnetic bead crawl, enrichment；
(4) LMPCR is expanded: the target area library that step 3 is obtained, and as LMPCR template, is added matched with sequence measuring joints Primer and corresponding reagent, are expanded, and magnetic beads for purifying is added after amplification to get purified library；
(5) library Quality Control: the purified library that step 4 is obtained carries out Quality Control, and Qubit 3.0 is selected to carry out quantitative detection, Agilent2100 or Agilent 4200 carries out qualitative detection, checks whether library fragments distribution meets the requirements.
3. a kind of construction method in the genetic test library of heredity arrhythmia cordis as claimed in claim 2, which is characterized in that DNA quality control standard described in above-mentioned steps (1) is DNA concentration >=20ng/ μ L；DNA purity: OD260/280=1.8-2.0, OD260/230>2.0；The total initial amount of DNA: 0.1 μ g-1 μ g.
4. a kind of construction method in the genetic test library of heredity arrhythmia cordis as described in claim 1, which is characterized in that End-filling described in step (2) adds the reaction of A to refer to that DNA random fragmentation to 180-220bp, passes through 5' → 3' polymerase And the circumscribed enzyme effect of 3' → 5', carry out end-filling, while the end 5' carry out phosphorylation, secondly 3' add A, so as to sequence measuring joints into Row connection.
5. a kind of construction method in the genetic test library of heredity arrhythmia cordis as described in claim 1, which is characterized in that The reaction of the dedicated sequence measuring joints of connection illumina microarray dataset described in step (2) include jointing reaction, digestion reaction and Purifying reaction, the jointing refer to DNA fragmentation both ends connection illumina platform-specific sequence measuring joints, containing and Particular sequence P5, P7 and sequencing primer sequence that platform chip combines, wherein sample label is contained at the end P7, and length 6bp is surveyed Sequence template specific structure is as follows:
P5+Read1 sequencing primer+insertion DNA+Read2 sequencing primer+Index (6bp)+P7.
6. a kind of construction method in the genetic test library of heredity arrhythmia cordis as claimed in claim 5, which is characterized in that Sequencing template sequence one end are as follows: AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCC GATCT；
Another terminal sequence are as follows:
ATCGGAAGAGCACACGTCTGAACTCCAGTCAC*NNNNNN*ATCTCGTATGCCGTCT TCTGCTTG, wherein NNNNNN represents 6bp base sample label.
7. a kind of construction method in the genetic test library of heredity arrhythmia cordis as described in claim 1, which is characterized in that The DNA library that step (3) obtains step 2 carries out library sample mixing, total amount >=1-1.5 μ g, by the library etc. of different sample labels Amount mixing is added the corresponding closing primer kit of sample label and closes DNA, and concentration is dried to dry powder, adds hybridization buffer, Then customization probe reaction is added in blending incubation, after reaction, pretreated specific magnetic beads for purifying, enrichment capture is added The destination region DNA fragmentation arrived.
8. a kind of construction method in the genetic test library of heredity arrhythmia cordis as described in claim 1, which is characterized in that After probe hybridization reaction described in step (3), the specific magnetic bead for having marked by streptavidin is selected, specific can grab has The probe of biotin labeling carries out purifying cleaning, to be enriched with target area DNA fragmentation.
9. a kind of construction method in the genetic test library of heredity arrhythmia cordis as described in claim 1, which is characterized in that Step (5) quantitative detection selects Qubit3.0 instrument, obtains library concentration total amount >=0.5ug, the qualitative Quality Control selection Agilent2100 or Agilent4200 instrument, segment ranges are between 150-500bp；It is fixed that real-time fluorescence is carried out before upper machine sequencing It is quantitative to measure PCR progress library, with the library for meeting sequencing requirement is expanded with P5, P7 primer specific, draws standard curve, determines and close Machine concentration on suitable library.
10. a kind of gene detecting kit of heredity arrhythmia cordis, which is characterized in that including in claim 1-9 meaning one Library reagent, hybridization probe sequence, primer sequence are built in the genetic test library, the probe sequence SEQ ID No 1 to SEQ ID No 255。
CN201811493198.6A 2018-12-07 2018-12-07 A kind of construction method and its kit in the genetic test library of heredity arrhythmia cordis Pending CN109593828A (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
CN201811493198.6A CN109593828A (en) 2018-12-07 2018-12-07 A kind of construction method and its kit in the genetic test library of heredity arrhythmia cordis

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CN201811493198.6A CN109593828A (en) 2018-12-07 2018-12-07 A kind of construction method and its kit in the genetic test library of heredity arrhythmia cordis

Publications (1)

Publication Number Publication Date
CN109593828A true CN109593828A (en) 2019-04-09

Family

ID=65961327

Family Applications (1)

Application Number Title Priority Date Filing Date
CN201811493198.6A Pending CN109593828A (en) 2018-12-07 2018-12-07 A kind of construction method and its kit in the genetic test library of heredity arrhythmia cordis

Country Status (1)

Country Link
CN (1) CN109593828A (en)

Cited By (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN113088571A (en) * 2021-05-11 2021-07-09 郑州普利莱医学检验所股份有限公司 SCN5A gene detection kit and detection method
CN113151448A (en) * 2021-05-11 2021-07-23 郑州普利莱医学检验所股份有限公司 KCNH2 gene detection kit and detection method
CN113174430A (en) * 2021-05-11 2021-07-27 郑州普利莱医学检验所股份有限公司 KCNQ1 gene detection kit and detection method
CN113957075A (en) * 2021-11-22 2022-01-21 百世诺(北京)医学检验实验室有限公司 Mutated genetic arrhythmia gene and application thereof
CN117487907A (en) * 2023-12-29 2024-02-02 湖南家辉生物技术有限公司 KCNH2 gene mutant, mutant protein, reagent, kit and application

Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN105969843A (en) * 2016-04-16 2016-09-28 杨永臣 High-throughput sequencing detection method for gene copy number and gene mutation based on MLPA
CN108424955A (en) * 2018-05-09 2018-08-21 合肥中科金臻生物医学有限公司 A kind of high-flux sequence method and its application of a variety of variation type genes of detection

Patent Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN105969843A (en) * 2016-04-16 2016-09-28 杨永臣 High-throughput sequencing detection method for gene copy number and gene mutation based on MLPA
CN108424955A (en) * 2018-05-09 2018-08-21 合肥中科金臻生物医学有限公司 A kind of high-flux sequence method and its application of a variety of variation type genes of detection

Non-Patent Citations (1)

* Cited by examiner, † Cited by third party
Title
曹克将等: "室性心律失常中国专家共识", 《中国心脏起搏与心电生理杂志》 *

Cited By (7)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN113088571A (en) * 2021-05-11 2021-07-09 郑州普利莱医学检验所股份有限公司 SCN5A gene detection kit and detection method
CN113151448A (en) * 2021-05-11 2021-07-23 郑州普利莱医学检验所股份有限公司 KCNH2 gene detection kit and detection method
CN113174430A (en) * 2021-05-11 2021-07-27 郑州普利莱医学检验所股份有限公司 KCNQ1 gene detection kit and detection method
CN113957075A (en) * 2021-11-22 2022-01-21 百世诺(北京)医学检验实验室有限公司 Mutated genetic arrhythmia gene and application thereof
CN113957075B (en) * 2021-11-22 2023-04-07 百世诺(北京)医学检验实验室有限公司 Mutated genetic arrhythmia gene and application thereof
CN117487907A (en) * 2023-12-29 2024-02-02 湖南家辉生物技术有限公司 KCNH2 gene mutant, mutant protein, reagent, kit and application
CN117487907B (en) * 2023-12-29 2024-04-23 湖南家辉生物技术有限公司 KCNH2 gene mutant, mutant protein, reagent, kit and application

Similar Documents

Publication Publication Date Title
CN109593828A (en) A kind of construction method and its kit in the genetic test library of heredity arrhythmia cordis
EP0726905B1 (en) Single nucleotide polymorphisms and their use in genetic analysis
CN110541025B (en) Detection method, primer composition and kit for Duchenne muscular dystrophy gene defect
CN110719957B (en) Methods and kits for targeted enrichment of nucleic acids
JP2001525181A (en) Method for preparing a complex DNA methylation fingerprint
CN109486937A (en) A kind of construction method and its kit in the genetic test library of heredity hypertrophic cardiomyopathy
CN112662762A (en) Probe composition for detecting 5 tumors of digestive tract
CN111440856B (en) Probe set and kit for detecting related pathogenic genes of methylmalonic acidemia
TW200404889A (en) Method of typing gene polymorphisms
JP5301281B2 (en) Organ-specific gene, identification method thereof and use thereof
CN108676797B (en) For detecting the reagent set and method of human papilloma virus
CN112662764A (en) Probe composition for detecting 11 cancers
CN111139297B (en) Kit for preimplantation embryo genetic diagnosis and prenatal diagnosis of DMD
WO2023141829A1 (en) Method for simultaneously performing whole-genome dna sequencing and whole-genome dna methylation or/and hydroxymethylation sequencing
CN112899364B (en) Primer probe composition for detecting LMNA gene mutation and application thereof
CN114277186B (en) MNP (MNP) labeling combination, primer pair combination and kit for influenza A, B and C viruses and application of MNP labeling combination and primer pair combination
KR101439448B1 (en) A High-density Genetic linkage map of Capsicum sp.
KR101439454B1 (en) A High-density Genetic linkage map of Capsicum sp.
JP3222850B2 (en) Gene diagnosis of bovine Chediak-Higashishi syndrome
KR101439456B1 (en) A High-density Genetic linkage map of Capsicum sp.
KR101439459B1 (en) A High-density Genetic linkage map of Capsicum sp.
KR101439452B1 (en) A High-density Genetic linkage map of Capsicum sp.
KR101439451B1 (en) A High-density Genetic linkage map of Capsicum sp.
KR101439457B1 (en) A High-density Genetic linkage map of Capsicum sp.
KR101439449B1 (en) A High-density Genetic linkage map of Capsicum sp.

Legal Events

Date Code Title Description
PB01 Publication
PB01 Publication
SE01 Entry into force of request for substantive examination
SE01 Entry into force of request for substantive examination
RJ01 Rejection of invention patent application after publication
RJ01 Rejection of invention patent application after publication

Application publication date: 20190409