CN105907880A - Method for identifying rs15869 polymorphism of human breast cancer 2 (BRCA2) gene by using MwoI - Google Patents

Abstract

The invention discloses a method for identifying rs15869 polymorphism of a human breast cancer 2 (BRCA2) gene by using MwoI. The method comprises the steps of amplifying a target deoxyribonucleic acid (DNA) fragment by adopting a polymerase chain reaction (PCR), and then carrying out enzyme digestion on the DNA fragment to be detected by using restriction enzyme, wherein the restriction enzyme can identify and cut a specific sequence; after that, carrying out electrophoresis on a product treated by enzyme digestion, analyzing specific enzyme digestion sites of the section of sequence by using a restriction enzyme map, and comparing the differences of gene sequences having different sources by means of the diversity of the fragment. In short, according to the method, the corresponding target fragment is firstly amplified by using the PCR, an enzyme digestion reaction is then carried out by using the restriction enzyme, observation and comparison are carried out after electrophoresis, and the differences among the sequences are analyzed by means of the restriction map. The method is good in repeatability, simpler in operation, low in cost and easy in identification of enzyme digestion results. The invention aims at providing the method which is used for detecting the rs15869 polymorphism of the human breast cancer 2 (BRCA2) predisposing gene by using the MwoI and is simple in operation, low in cost and wide in application scope, and a detection kit for the method.

Description

A kind of method of MwoI surveyor's breast carcinoma BRCA2 gene rs15869 polymorphism

Technical field

The invention belongs to biological technical field, relate to one MwoI surveyor breast carcinoma BRCA2 gene rs15869 polymorphic The method of property.

Background technology

Single nucleotide polymorphism (single nucleotide polymorphism, SNP), is primarily referred to as in genomic level by list DNA sequence polymorphism caused by the variation of individual nucleotide.It is modal one in the heritable variation of the mankind.Account for institute Have more than the 90% of known polymorphism.SNP is widely present in human genome, in the most every 500～1000 base pairs just There is 1, estimate that its sum is the most up to 3,000,000.CAPs(cleaved amplification polymorphism Sequence-tagged sites) CAPs technology is also called PCR-RFLP, restriction fragment length polymorphism polymerase chain reaction (PCR-RFLP) technology.The ultimate principle of PCR-RFLP is to expand target DNA with PCR, and amplified production is again with special Property endonuclease digestion cut into different size fragment, directly on gel electrophoresis differentiate.The most homoallelic Restriction Enzyme cuts position Point distribution difference, produces the DNA fragmentation band of different length.Technique substantially increases content and the phase of target DNA To specificity, and method is easy, and the typing time is short.This method, compared with RFLP, except for the difference that instead of enzyme with amplification Cut, it is to avoid the step such as loaded down with trivial details for RFLP DNA enzymatic is cut, shifted, hybridization.

BRCA2 gene (breast cancer 2, early onset) is positioned at human chromosomal 13q12.3, mankind BRCA 2 gene and contains 28 exons, cDNA has 10254 base pairs, and the protein of coding contains 3418 aminoacid.Produced by this gene Protein is the key repairing impaired gene.BRCA2 combines single stranded DNA and interacts with recombinase BRCA2 is homology weight A step important during group.Hereditary variation about BRCA2 3 '-UTR region has been reported with associating of human tumor recently. Generally this polymorphic genotype that there are three kinds of BRCA2 genes in crowd: AA type (the two of human genome rs15869 polymorphic site Individual allele base is A), (two allele bases of human genome rs15869 polymorphic site are respectively C to AC type And A) and CC type (two allele bases of human genome rs15869 polymorphic site BRCA2 are C).

The restricted enzyme that surveyor breast carcinoma BRCA2 gene polymorphic rs15869 uses often at present is expensive, tests into This height, it is difficult to universal use in the lab.Therefore, this area exists simple to operate, low cost, wide new of range The demand of type detection SNP method.

Sequence specific primers PCR is also referred to as ApoE gene (AS-PCR), and its principle is based on Taq DNA Polymerase can not DNA plerosis primer at the single base mispairing of 3 ' ends.So, when 3 ' terminal nucleotides and the equipotential base of primer Because variation site sequences is complementary, then template is amplified.But, when primer 3 ' terminal nucleotide and template mispairing, then template will not It is amplified or amplification efficiency is extremely low.Each allelic detection, need to design two set primers, a set of draws for allele-specific Thing, a set of for general primer.After PCR primer gel electrophoresis, the presence or absence of DNA is detected by ultraviolet (uv) transmission, Existence or the disappearance of DNA band i.e. can determine that genotype.Another pair of primers in same reaction (generally expands human growth hormone One section of gene) always produce a DNA segment, unrelated with HPA genotype, as the control of PCR effectiveness.Gene is special The shortcoming of opposite sex PCR (AS-PCR) is that amplification efficiency is relatively low, and specific amplification is poor, and therefore the specificity of PCR primer is with steady Qualitative cannot ensure, meanwhile, genotyping result is relatively easy to erroneous judgement, less stable.

TaqMan probe method refers to that it is possible to additionally incorporate a specific fluorescence when PCR expands while adding pair of primers visits Pin, this probe only with template specificity combine, its binding site is between two primers.5 ' ends of probe are marked with fluorescence Reporter group (Reporter, R), such as FAM, VIC etc., 3 ' ends are marked with fluorescent quenching group (Quencher, Q), such as TAMRA Deng.When probe is complete when, the fluorescence that 5 ' end reporter groups excite through light source for instrument is just held fluorescent bases by in-plant 3 ' Group's cancellation, instrument can't detect the 5 ' fluorescence signals holding reporter groups to be excited (that is the transmitting wavelength of 5 ' fluorophors is just It is well the absorbing wavelength of 3 ' fluorophors, thus energy is delivered to 3 ' fluorophors by absorption and sends other fluorescence).Along with The carrying out of PCR, Taq enzyme runs into the probe being combined with template during chain extension, its 5 '-3 ' 5 prime excision enzyme activity (this activity Being double-stranded specific, free single-stranded probe is unaffected) will will cut probe, release 5 ' end reporter group is free on In reaction system, away from the shieldings of 3 ' end fluorescent quenching groups, 5 ' end reporter groups launched fluorescence signals that are stimulated just may be used To be detected by probe.The most often one DNA of amplification, just has a fluorescence molecule to be formed, it is achieved that fluorescence signal Accumulation forms Complete Synchronization with PCR primer.The intensity of report signal just represents the copy number of template DNA.Taqman fluorescence Sonde method needs expensive instrument and longer step, relatively costly, it is difficult to universal use in the lab.

The cardinal principle of dye method gene qualitative analysis (HRM) is that the length according to DNA sequence, G/C content and base are mutual Mending sex differernce, apply high-resolution melting curve to be analyzed sample, its high temperature uniformity and temperature resolution make Resolving accuracy can reach the differentiation to single base difference.The shortcoming of dye method gene method for qualitative analysis is due to dye method Specificity is not strong, as long as the DNA of double-strand can be in conjunction with luminescence, therefore, specificity is poor.

Summary of the invention

In order to overcome defect present in prior art, the present invention provides a kind of simple to operate, low cost, the scope of application Widely by the method for MwoI surveyor's breast carcinoma BRCA2 gene rs15869 polymorphism, the method is saving experiment On the premise of cost, by the improvement of PCR-RFLP technology, come exploiting economy, quickly detection human breast carcinoma BRCA2 The test kit of rs15869 gene pleiomorphism.Demonstrate BRCA2 gene mononucleotide polymorphism site rs15869 first It is positioned at introne 3 ' in-UTR, the invention provides a kind of method detecting breast cancer predisposing genes on this basis, Utilizing the genotype of detection site of the present invention, method is simple, rapidly and efficiently, with low cost, examining for breast carcinoma Break and provide a simple and direct new way.

Its technical scheme is as follows:

A kind of method of MwoI surveyor's breast carcinoma BRCA2 gene rs15869 polymorphism, comprises the following steps:

The genomic DNA of (a) extracting sample；

B () provides forward primer and the reverse primer of amplification human breast carcinoma BRCA2 gene pleiomorphism rs15869 location proximate sequence, Rs15869 forward primer: 5 '-AAGCAGGACACAATTACAAC-3 ', rs15869 downstream primer: 5 '- CAGGCTGGTCTTGAACTC-3 ', the human gene group DNA to be measured extracted with step (a), as template, carries out PCR expansion Increase, obtain amplified production；

C () uses restricted enzyme that the amplified production obtained in step (b) is carried out enzyme action, obtain corresponding digestion products；

D digestion products is used the agarose gel of 3% to carry out electrophoresis, to judge that BRCA2 gene pleiomorphism rs15869's is each by () Genotype.Wherein, having two band persons for CC genotype after electrophoresis, three band persons are AA genotype, four band Person is AC genotype.

Compared with prior art, beneficial effects of the present invention:

The present invention uses PCR machine (PCR-RFLP) method, is to use polymerase Chain reaction (PCR) amplification target DNA fragment, then by DNA fragmentation digestion with restriction enzyme to be detected, Restricted enzyme identification also cuts special sequence, then the product after enzyme action is carried out electrophoresis, then by restriction endonuclease map (restriction map) analyzes the special restriction enzyme site of this section of sequence, carrys out comparison separate sources gene by the multiformity of fragment The diversity of sequence.It is simply that first PCR expands corresponding purpose segment, then carry out digestion with restriction enzyme anti- Should, observe after electrophoresis and compare the difference that restriction map comes between analytical sequence.The method is reproducible, and operation is relatively simple, Low cost, enzyme action result is easily discernible.The invention provides a kind of simple to operate, low cost, detection applied widely The method of human breast carcinoma tumor susceptibility gene BRCA2 polymorphism rs15869 and detection kit, the susceptibility of measurable breast carcinoma, For clinical early diagnosis.

Accompanying drawing explanation

Fig. 1 is pcr amplification reaction program；

Fig. 2 is the electrophoresis pattern in BRCA2 rs15869 site；

Fig. 3 is BRCA2 rs15869 site AA genotype Sequencing chromatogram；

Fig. 4 is BRCA2 rs15869 site AC genotype Sequencing chromatogram；

Fig. 5 is BRCA2 rs15869 site CC genotype Sequencing chromatogram.

Detailed description of the invention

Technical scheme is further illustrated below in conjunction with the accompanying drawings with embodiment.

The invention provides a kind of method detecting breast cancer susceptibility gene, owing to identifying the restricted enzyme of specific site MwoI is applied widely, and price is relatively inexpensive, and then greatly reduces the cost of detection SNP.Find through sequence analysis, Detect method polymorphic for this C/A and can use a kind of enzyme in table 1.Consider simple operations and economic and practical, limit Property restriction endonuclease MwoI is only selection.

The price of the restricted enzyme provided in table 1 is from NEB company (http://www.neb-china.com), restricted interior The selection cutting enzyme obtains from WatCut restriction endonuclease analysis software (http://watcut.uwaterloo.ca/template.php？Act=snp_new), in this, as restriction enzyme enzyme recognition site and The reference of price.

1 one kinds of restriction endonuclease recognition sequences of table and price thereof

In an embodiment of the present invention, the Primer6.0 software that is designed with of forward primer and reverse primer is carried out, the principle of design Consider the impact of sensitivity, specificity and amplification efficiency that PCR is expanded by primer.According to the most unpaired former of base Then design primer, primer length typically between 15～30 bases, the long or short poor specificity that all can cause, long also can lead Cause its elongating temperature and be more than 74 DEG C, be unsuitable for Taq DNA polymerase and react.Primer G/C content between 40%～60%, Tm value is preferably close to 72 DEG C, and G/C content is too high or too low is all unfavorable for initiation reaction.Base wants random distribution, primer self And between primer, should there is not complementary series, otherwise primer self can be folded into hairpin structure and make the renaturation of primer own.Primer 5 ' End and middle Δ G-value should be of a relatively high, and 3 ' end Δ G-value are relatively low.The strand of amplified production can not form secondary structure.Draw Thing should have specificity, after design of primers completes, tackles it and carries out BLAST detection, to guarantee that it does not has with other gene There is complementarity.On this basis, the forward primer finally chosen: 5 '-AAGCAGGACACAATTACAAC-3 ', downstream is drawn Thing: 5 '-CAGGCTGGTCTTGAACTC-3 ',.Thus fragment 376bp in the face that primer amplification goes out, amplified production is as follows:AAGCAGGACACAATTACAACTAAAAAATATATCTAAGCATTTGCAAAGGCGACAATAAATTATTGAC GCTTAACCTTTCCAGTTTATAAGACTGGAATATAATTTCAAACCACACATTAGTACTTATGTTGCACAA TGAGMAAAGAAATTAGTTTCAAATTTACCTCAGCGTTTGTGTATCGGGCAAAAATCGTTTTGCCCGA TTCCGTATTGGTATACTTTTGCTTCAGTTGCATATCTTAAAACTAAATGTAATTTATTAACTAATCAAGA AAAACATCTTTGGCTGAGCTCGGTGGCTCATGCCTGTAATCCCAACACTTTGAGAAGCTGAGGTGGG AGGAGTGCTTGAGGCCAGGAGTTCAAGACCAGCCTG(376bp)

Underscore part is respectively forward primer and reverse primer, and the 141st bpM represents the polymorphic i.e. SNP site of A/C rs15869.The amplified production of this length of 376bp can produce 230bp, 146bp, 137bp after restricted enzyme MwoI enzyme action With 93bp totally four kinds of clip types.Genotype result of determination: CC mutated-genotype, a length of 146bp, 137bp and 93bp Three bands；AA wild-type genotype, a length of 230bp and 146bp two band；CA heterozygous genotypes, a length of 230bp, 146bp, 137bp and 93bp totally four band.

Gel electrophoresis is divided into agarose gel electrophoresis and polyacrylamide gel electrophoresis, agarose (Agarose) to be a kind of linear Polysaccharide polymer, is to extract from Red seaweeds product agar and come.Cooled and solidified after agarose solution is heated to boiling point Will form good electrophoretic medium, its density is to be determined by the concentration of agarose, and can be used for DNA fragmentation prepares electrophoresis. Polyacrylamide gel mainly has two ways: one is for separating and the non denatured polyacrylamide of purification double chain DNA fragment Amine gel, two is for separating and the denaturing polyacrylamide gel of purification of single stranded DNA fragmentation.But consider practicality, Convenience and economy, use agarose gel electrophoresis to can yet be regarded as a kind of optimum selection.In the present invention, primer amplification bar Part is as it is shown in figure 1, purpose amplified production uses enzyme action 6-14h in restriction endonuclease XmnIMwoI5U water-bath. Digestion products uses the agarose of 3% to carry out agarose gel electrophoresis, judges wild according to different bands under ultra violet lamp Homozygous genotype, heterozygous genotypes and mutant homozygous genotype.

In the present invention, the reaction condition of PCR amplification system is not particularly limited, PCR-based principle three step and set Put degeneration-annealing-extension three temperature spot.In standard reaction, use three temperature spot methods, double-stranded DNA 90～95 DEG C of degeneration, Being rapidly cooled to 40～60 DEG C again, primer annealing is also attached on target sequence, is then rapidly heated to 70～75 DEG C, Under the effect of Taq DNA polymerase, primer strand is made to extend along template.For shorter target gene (when a length of 100～300bp) Can use two temperature spot methods, in addition to denaturation temperature, annealing can unite two into one with elongating temperature, 94 DEG C of degeneration of general employing, 65 DEG C Left and right annealing and extension (this temperature TaqDNA enzyme still has higher catalysis activity).And it is also the highest for DNA to be measured Concentration and purity requirement, both can be the DNA extracted in human body fluid or tissue, it is also possible to through degradation treatment in advance Genome.But implementing for convenience and reduce experimenter's misery, ordinary priority selects to carry out genomic DNA from blood Extract.

In specific embodiments of the present invention, the present invention detects human breast carcinoma BRCA2 gene mononucleotide polymorphism site Rs15869 specifically comprises the following steps that

L () extracts human gene group DNA's template to be measured, described human gene group DNA's template is the people that human body any part obtains Genomic templates.

(2) PCR amplifying genom DNA, carries out PCR amplification to templet gene group DNA extracted, it is thus achieved that containing polymorphic attached The PCR primer of nearly sequence.

(3) pcr amplification product restriction endonuclease BccI is carried out endonuclease reaction, obtain digestion products；

(4) digestion products carries out agarose gel electrophoresis, judges wild homozygous gene according to different bands under ultra violet lamp Type, heterozygous genotypes and mutant homozygous genotype.

Below each key step above-mentioned is described in detail:

1 materials and methods

1.1 key instruments and reagent

Instrument: BCD-228CH refrigerator (newly flies electrical equipment), HH-2 digital display thermostat water bath (China's peak instrument), SmartGel coagulates Glue imager (Beijing match intelligence is started an undertaking), GT9612 grads PCR instrument (hundred Tykes are biological), WD900SL23-2 model Microwave oven (Glanz electrical equipment), DG-300C type electrophresis apparatus (ancient cooking vessel state prosperity is biological) etc..

Reagent: NEP004-1 DNA extraction kit (ancient cooking vessel state prosperity is biological), 50bp DNA Ladder (Lay thing humorously), 2 × Taq PCR Mix (Lay thing humorously), MspI (Thermo), agarose (SIGMA) etc..

1.2 design of primers

In the dbSNP data base of NCBI, the nucleotide sequence searching BRCA2 rs15869 is as follows:

ACATTTGTTTCTCCGGCTGCACAGAAGGCATTTCAGCCACCAAGGAGTTGTGGCA CCAAATACGAAACACCCATAAAGAAAAAAGAACTGAATTCTCCTCAGATGACTCCATTT AAAAAATTCAATGAAATTTCTCTTTTGGAAAGTAATTCAATAGCTGACGAAGAACTTGC ATTGATAAATACCCAAGCTCTTTTGTCTGGTTCAACAGGAGAAAAACAATTTATATCTGT CAGTGAATCCACTAGGACTGCTCCCACCAGTTCAGAAGATTATCTCAGACTGAAACGA CGTTGTACTACATCTCTGATCAAAGAACAGGAGAGTTCCCAGGCCAGTACGGAAGAAT GTGAGAAAAATAAGCAGGACACAATTACAACTAAAAAATATATCTAAGCATTTGCAAAG GCGACAATAAATTATTGACGCTTAACCTTTCCAGTTTATAAGACTGGAATATAATTTCAA ACCACACATTAGTACTTATGTTGCACAATGAGMAAAGAAATTAGTTTCAAATTTACCTC AGCGTTTGTGTATCGGGCAAAAATCGTTTTGCCCGATTCCGTATTGGTATACTTTTGCTT CAGTTGCATATCTTAAAACTAAATGTAATTTATTAACTAATCAAGAAAAACATCTTTGGC TGAGCTCGGTGGCTCATGCCTGTAATCCCAACACTTTGAGAAGCTGAGGTGGGAGGAG TGCTTGAGGCCAGGAGTTCAAGACCAGCCTGGGCAACATAGGGAGACCCCCATCTTTA CAAAGAAAAAAAAAAGGGGAAAAGAAAATCTTTTAAATCTTTGGATTTGATCACTACA AGTATTATTTTACAAGTGAAATAAACATACCATTTTCTTTTAGATTGTGTCATTAAATGGA ATGAGGTCTCTTAGTACAGTTATTTTGATGCAGATAATTCCTTTTAGTTTAGCTACTATTT TAGGGGATTTTTTTTAGAGGTAACTCACTATGAAATAGTTCTCCTTAATGCAAATATG

It is polymorphic that 501st base R of gene order represents A/C, is the pleomorphism site of rs15869.By above sequence Affix in primer-design software Primer Premier 6.0, the parameter such as primer length and amplification purpose fragment length is set and draws Thing designs, and selects optimum upstream and downstream primer according to G/C content and annealing temperature etc., then by this primer and the Blast in Pubmed Sequence alignment function (http://blast.ncbi.nlm.nih.gov/Blast.cgi) carries out primer comparison, the upstream and downstream primer finally determined For forward primer sequence: 5 '-AAGCAGGACACAATTACAAC-3 ', reverse sequence: 5 '- CAGGCTGGTCTTGAACTC-3 ', the synthesis of primer can use method (such as solid-phase synthesis) generally in the art, also Biotech firm can be entrusted to synthesize.

The selection of 1.3 restricted enzyme

According to the base sequence in dbSNP five sites, with WatCut online restriction endonuclease analysis software, on-line search Obtain the information of the restricted enzyme in recognizable mutational site, consider its enzyme action specificity and economic and practical Sexual behavior mode is optimal Restricted enzyme MwoI.

1.4 genomic DNAs extracting sample to be tested from whole blood

Genomic DNA is extracted in strict accordance with centrifugal column type DNA extraction kit operating procedure.

L), after adding 300 μ l hemocytees in 1.5ml centrifuge tube, add 900 μ l cell pyrolysis liquids and be mixed evenly, at ice After upper placement 10min, in centrifuge, 12000rpm is centrifuged 1min, abandons supernatant, again adds 900 μ l cells and splits Solve liquid, after blowing afloat precipitation with rifle and mix, repeat the above steps；

2) in precipitate, add 600 μ l solution B solution, after blowing afloat precipitation gently with liquid-transfering gun, add 10 μ l albumen Enzyme K mixes, and after placing 10min in 70 DEG C of water-baths, 12000rpm is centrifuged 5min；

3) in the new centrifuge tube proceeding to the supernatant in centrifuge tube to compile number, then it is anhydrous to add 500 μ l in new centrifuge tube Ethanol, period, this floccule was DNA it is possible that flocky precipitate；

4) being proceeded to by the liquid of mixing (if once cannot not turn completely, graded proceeds to) in centrifugal column, room temperature stands 2min, then 12000 Rpm is centrifuged 1min, abandons waste liquid；

5) adding 700 μ l and added the solution C rinsing liquid of respective volume dehydrated alcohol, room temperature stands 2min, 12000rpm Centrifugal 1min, abandons waste liquid；

6) adding 700 μ l and added the solution D rinsing liquid of respective volume dehydrated alcohol, room temperature stands 2min, and 12000 Rpm is centrifuged 1min, abandons waste liquid；

7) adding 500 μ l solution D rinsing liquids, 12000rpm is centrifuged 1min, abandons waste liquid；

8) recentrifuge 2min, is placed in centrifugal column in the new centrifuge tube compiled number, uncovered puts into 37 DEG C of calorstats 10 Min is until without obvious ethanol taste；

9) have been preheated with the solution E 100 μ l of 65 DEG C in the addition of silica-based plasma membrane central authorities, room temperature places 5min, 12000rpm Centrifugal 1min, once, the liquid after being centrifuged eventually is the genomic DNA extracted to repeat the above steps；

10) draw the DNA NanoPhotometer Pearl micro-spectrophotometer that 2 μ l extract and measure its concentration and purity.

2 results

2.1 PCR amplifications

(1) according to the concentration of extraction genomic DNA, the DNA of object of study is diluted, makes final concentration of 20 μ g/ μ l.

(2) PCR amplification system is each 0.3 μ l of 2 × Taq PCR Mix 7.5 μ l, forward primer and downstream primer, template DNA 1.0 μ l, finally supplements cumulative volume to 15 μ l with distilled water.

(3) PCR reaction condition: first stage is the denaturation stage, 94 DEG C/5min；Second stage includes that three steps are altogether 35 circulations, to set gradually be 94 DEG C/30s, 58 DEG C of annealing time 45s, 72 DEG C/45s；72 DEG C/5min of three phases. Product Sequence after amplification is:

AAGCAGGACACAATTACAACTAAAAAATATATCTAAGCATTTGCAAAGGCGACAATAAATTATTGAC GCTTAACCTTTCCAGTTTATAAGACTGGAATATAATTTCAAACCACACATTAGTACTTATGTTGCACAA TGAGMAAAGAAATTAGTTTCAAATTTACCTCAGCGTTTGTGTATCGGGCAAAAATCGTTTTGCCCGA TTCCGTATTGGTATACTTTTGCTTCAGTTGCATATCTTAAAACTAAATGTAATTTATTAACTAATCAAGA AAAACATCTTTGGCTGAGCTCGGTGGCTCATGCCTGTAATCCCAACACTTTGAGAAGCTGAGGTGGG AGGAGTGCTTGAGGCCAGGAGTTCAAGACCAGCCTG(376bp)

Underscore part is respectively forward primer and reverse primer, and the 243rd bpM represents the polymorphic i.e. SNP site of A/C rs15869。

2.2 endonuclease reaction

Enzyme action system is pcr amplification product 5 μ l, upper restricted enzyme 0.5 μ l, Buffer 1.0 μ l, finally mends with distilled water Fill cumulative volume to 15 μ l.Mixing is placed in water-bath 37 DEG C of water-baths 4-16 hour.

The judgement of 2.3 genotype

By digestion products with 3% agarose gel under conditions of 4-10V/cm, electrophoresis 20-40min, energy to uviol lamp After distinguishing obvious band and qualification of taking pictures.For different genotype, rs15869 site different genotype shows different Band (see Fig. 2), CC mutated-genotype, a length of 146bp, 137bp and 93bp tri-band；AA wild-type genotype, long For 230bp and 146bp two band；CA heterozygous genotypes, a length of 230bp, 146bp, 137bp and 93bp totally four band. Each genotype all shows complete with the result that prior art records through order-checking with qualification further, sequencing result (see Fig. 3 to 5) Identical.

Embodiment 1. human breast carcinoma tissue specimen measures human breast carcinoma BRCA2 rs15869 polymorphism.

In specific embodiments of the present invention, detection human breast carcinoma BRCA2 gene polymorphic rs15869 specifically comprises the following steps that

L () obtains the breast cancer tissue that operation cuts, use phenol-chloroform method to extract the genomic DNA of breast cancer tissue as to be measured DNA, extraction step is as follows:

1) being thawed by breast cancer tissue's block, wash away blood stains with normal saline, the tissue of clip 0.1g is milled, and adds 1ml Aquesterilisa, reverse mixing, 10000rpm is centrifuged 10min, abandons supernatant, and above step is repeated twice

2) adding the DNA lysate of 200 μ l, the E.C. 3.4.21.64 mixing of 5 μ l, 55 DEG C of water-baths digest overnight.

3) add isopyknic phenol chloroform mixed liquor (1:1) after having digested, acutely shake so that it is become milk coffee color.12000rpm Centrifugal 10min.

4) avoid when taking supernatant touching intermediate medium and lower floor's liquid.Reverse mixing after adding isopyknic chloroform.12000rm Centrifugal 10min.

5) take supernatant, note avoiding touching intermediate medium and lower floor's liquid.The sodium acetate of addition 1/10 and the nothing of 2.5 times Water-ethanol, reverse mixing, 12000rpm is centrifuged 10min, abandons supernatant.

6) 1ml 70% ethanol is added so that it is white precipitate suspends, and for several times, 12000rpm is centrifuged 10min in reverse mixing, abandons Supernatant, room temperature stands 5-10min makes ethanol volatilization clean.

7) 50 μ l aquesterilisa dissolving DNAs, Ji get breast cancer tissue genomic DNA are added.

(2) base sequence information obtains from the dbSNP data base of NCBI, checks on CHIP website, the most accurately nothing Primer Premier 6.0 is used to design each site primer, in conjunction with in annealing temperature, G/C content and Pubmed after Wu It is that forward draws that the information siftings such as Blast sequence alignment result (http://blast.ncbi.nlm.nih.gov/Blast.cgi) go out optimum primer Thing sequence: 5 '-AAGCAGGACACAATTACAAC-3 ', reverse sequence: 5 '-CAGGCTGGTCTTGAACTC-3 ', enter Performing PCR primer amplification, preparation PCR amplification system: 2 × TaqPCRMix7.5 μ l, distilled water 5.9 μ l, forward primer 0.3 μ l, 15.0 μ lPCR amplification reaction systems are i.e. obtained after downstream primer 0.3 μ l and template DNA 1.0 μ l, fully mixing；According to first In the stage: 94 DEG C of degeneration 5min, second stage includes three steps of 35 circulations altogether, and first 94 DEG C degeneration 30s, 58 DEG C are moved back Fire 45s, last 72 DEG C extend 45s, the phase III: 72 DEG C extend 5min, and final 4 DEG C store with standby, obtain a length of The pcr amplification product of 376bp；

(3) SNP fragment enzyme action 6-14h, the PCR product in restriction endonuclease MwoI 5U water-bath after amplification 5 μ l, restricted enzyme 0.5 μ l, Buffer1.0 μ l and nuclease free pure water 8.5 μ l amount to 15 μ l enzyme action systems, in water-bath In Guo, 37 DEG C of enzyme action 6-14h, obtain digestion products.Described identification GCN₅^N₂The restricted enzyme of GC sequence is interior Cut enzyme MwoI and isoschizomers thereof；Consider economic and practical and simple operations finally selects MwoI to carry out enzyme action mirror Fixed；

(4) digestion products uses the agarose of 3% to carry out agarose gel electrophoresis, judges according to different bands under ultra violet lamp Wild homozygous genotype, heterozygous genotypes and mutant homozygous genotype (being shown in Table 2).

Table 2 rs15869 loci gene type judges

Embodiment 2. human peripheral whole blood sample measures human breast carcinoma BRCA2 rs15869 polymorphism

Essentially identical with the step of embodiment 1, simply use method below to extract genomic DNA from human peripheral as treating Survey DNA.

The operating procedure extracting test kit according to NEP004-1 Whole Blood Genomic DNA carries out carrying of blood sample genomic DNA to be measured Take, specifically comprise the following steps that

L), after adding 300 μ l hemocytees in 1.5ml centrifuge tube, add 900 μ l cell pyrolysis liquids and be mixed evenly, at ice After upper placement 10min, in centrifuge, 12000rpm is centrifuged 1min, abandons supernatant, again adds 900 μ l cell pyrolysis liquids, After blowing afloat precipitation with rifle and mix, repeat the above steps；

2) in precipitate, add 600 μ l solution B solution, after blowing afloat precipitation gently with liquid-transfering gun, add 10 μ l albumen Enzyme K mixes, and after placing 10min in 70 DEG C of water-baths, 12000rpm is centrifuged 5min.

3) in the new centrifuge tube proceeding to the supernatant in centrifuge tube to compile number, then it is anhydrous to add 500 μ l in new centrifuge tube Ethanol, period, this floccule was DNA it is possible that flocky precipitate；

4) being proceeded to by the liquid of mixing (if once cannot not turn completely, graded proceeds to) in centrifugal column, room temperature stands 2min, then 12000 Rpm is centrifuged 1min, abandons waste liquid；

5) adding 700 μ l and added the solution C rinsing liquid of respective volume dehydrated alcohol, room temperature stands 2min, 12000rpm Centrifugal 1min, abandons waste liquid；

6) adding 700 μ l and added the solution D rinsing liquid of respective volume dehydrated alcohol, room temperature stands 2min, and 12000 Rpm is centrifuged 1min, abandons waste liquid；

7) adding 500 μ l solution D rinsing liquids, 12000rpm is centrifuged 1min, abandons waste liquid；

8) recentrifuge 2min, is placed in centrifugal column in the new centrifuge tube compiled number, uncovered puts into 37 DEG C of calorstats 10 Min is until without obvious ethanol taste；

9) have been preheated with the solution E 100 μ l of 65 DEG C in the addition of silica-based plasma membrane central authorities, room temperature places 5min, 12000rpm Centrifugal 1min, once, the liquid after being centrifuged eventually is the genomic DNA extracted to repeat the above steps.

Carry out the qualification of genotype after extracting complete genomic DNA according to the step of case one, qualification result is as follows: by enzyme action Product qualification of taking pictures under uviol lamp after the agarose gel electrophoresis of 3%.For different genotype, rs15869 site is different Genotype shows different bands (see Fig. 2), CC mutated-genotype, a length of 146bp, 137bp and 93bp tri-band； AA wild-type genotype, a length of 230bp and 146bp two band；CA heterozygous genotypes, a length of 230bp, 146bp, 137bp With 93bp totally four band.Each genotype all shows with qualification further, sequencing result (see Fig. 3, Fig. 4, Fig. 5) through order-checking The result recorded with prior art is identical.

The present invention can carry out the appraisal of genotype after PCR primer is carried out restriction enzyme digestion and electrophoresis, therefore has in practice Having the biggest motility, detection method is simple in addition, is therefore a kind of to carry out the good of single base mutation loci gene type qualification Method.Key problem in technology point is the upstream and downstream primer of BRCA2 polymorphism rs15869 designed, forward primer sequence: 5 '- AAGCAGGACACAATTACAAC-3 ', reverse sequence: 5 '-CAGGCTGGTCTTGAACTC-3 ', and restriction enzyme The use of enzyme MwoI.The method behaviour that must detect human breast carcinoma tumor susceptibility gene BRCA2 polymorphism rs15869 provided by the present invention Make simple, low cost, applied widely.

The above, only best mode for carrying out the invention, any those familiar with the art is at present disclosure In technical scope, the simple change of the technical scheme that can become apparent to or equivalence are replaced and are each fallen within protection scope of the present invention In.

Claims (1)

1. the method by MwoI surveyor's breast carcinoma BRCA2 gene rs15869 polymorphism, it is characterised in that include Following steps:

The genomic DNA of (a) extracting sample；

B () provides forward primer and the reverse primer of amplification human breast carcinoma BRCA2 gene pleiomorphism rs15869 location proximate sequence, Rs15869 forward primer: 5 '-AAGCAGGACACAATTACAAC-3 ', rs15869 downstream primer: 5 '- CAGGCTGGTCTTGAACTC-3 ', the human gene group DNA to be measured extracted with step (a), as template, carries out PCR expansion Increase, obtain amplified production；

C () uses restricted enzyme that the amplified production obtained in step (b) is carried out enzyme action, obtain corresponding digestion products；

D digestion products is used the agarose gel of 3% to carry out electrophoresis, to judge that BRCA2 gene pleiomorphism rs15869's is each by () Genotype, wherein, has two band persons for CC genotype after electrophoresis, and three band persons are AA genotype, four band Person is AC genotype.