CN105861350B - A kind of rich molybdenum saccharomyces cerevisiae and preparation method thereof - Google Patents
A kind of rich molybdenum saccharomyces cerevisiae and preparation method thereof Download PDFInfo
- Publication number
- CN105861350B CN105861350B CN201610429223.9A CN201610429223A CN105861350B CN 105861350 B CN105861350 B CN 105861350B CN 201610429223 A CN201610429223 A CN 201610429223A CN 105861350 B CN105861350 B CN 105861350B
- Authority
- CN
- China
- Prior art keywords
- saccharomyces cerevisiae
- molybdenum
- yeast
- rich molybdenum
- rich
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/415—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from plants
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K36/00—Medicinal preparations of undetermined constitution containing material from algae, lichens, fungi or plants, or derivatives thereof, e.g. traditional herbal medicines
- A61K36/06—Fungi, e.g. yeasts
- A61K36/062—Ascomycota
- A61K36/064—Saccharomycetales, e.g. baker's yeast
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
- C12N15/80—Vectors or expression systems specially adapted for eukaryotic hosts for fungi
- C12N15/81—Vectors or expression systems specially adapted for eukaryotic hosts for fungi for yeasts
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2800/00—Nucleic acids vectors
- C12N2800/10—Plasmid DNA
- C12N2800/102—Plasmid DNA for yeast
Abstract
The invention discloses a kind of rich molybdenum saccharomyces cerevisiae and preparation method thereof, belong to health and field of fermentation engineering.Richness molybdenum saccharomyces cerevisiae of the invention is the saccharomyces cerevisiae of gene shown in energy constitutive expression SEQ ID NO.1, its medicine that can be used to prepare prevention and/or treating cancer, cardiovascular and cerebrovascular disease and/or liver diseases.Recombinant expression carrier is built on yeast constitutive expression carrier by the way that gene shown in SEQ ID NO.1 is connected to, then recombinant expression carrier is transferred in saccharomyces cerevisiae is obtained rich molybdenum saccharomyces cerevisiae.Rich molybdenum yeast molybdenum accumulation ability of the invention is higher, with good economic benefit and social benefit.
Description
Technical field
The present invention relates to health and field of fermentation engineering, and in particular to a kind of rich molybdenum saccharomyces cerevisiae and its preparation side
Method.
Background technology
Molybdenum is one of animal, microorganism and micronutrient element necessary to human body, is azotase, nitrate reductase, Huang
The important composition composition of various enzymes such as purine oxidase, aldehyde oxidase, sulfite oxidase.Molybdenum is participated in and influences many in body
Plant metabolic process；Molybdenum can suppress the death rate of the growth of breast cancer, control cancer of the esophagus and other cancers；Molybdenum can protect cardiac muscle, in advance
Anti- cardiovascular and cerebrovascular disease and liver diseases；Molybdenum is to Keshan disease, carious tooth, microcytic hypochromic anemia and regional alopecia simultaneously
There is good preventive and therapeutic effect etc. endemic disease.Molybdenum can increase the ability that body resists germ, improve body immunity；To animal
Growth has obvious facilitation.
Yeast can be by sorption enhanced, by contained trace element enrichment in culture medium in own cells tissue, will be inorganic
Trace element changes over the low organic form of toxicity, improves bioavailability and security；Meanwhile, yeast bioactivity in itself
Material also has health-care effect to organism, is one of effective carrier of Rich in Trace Element.It is grown up trace element in daily meals
Molybdenum demand is about 0.1mg, therefore rich molybdenum yeast is used as the supplement of body molybdenum source, especially as prevention and treatment cancer,
The important functional component of cardiovascular and cerebrovascular disease and liver diseases medicine has caused people greatly to pay attention to.
The method that current eutrophy element yeast species seed selection is used mainly includes ultraviolet, microwave and chemical reagent
Mutagenesis etc. is obtained with eutrophy element mutant yeast higher.There is certain blindness and random in above breeding method
Property, process is relatively complicated.For example, although ultraviolet mutagenesis operation is fairly simple, misoperation can produce injury to human body,
And the method also needs to carry out the substantial amounts of Screening and Identification work without purpose.
In sum, a kind of method that can rapidly and accurately improve yeast molybdenum content is invented to be very important, and
It is also with very heavy that other are prepared by this method by carrier enrichment various trace elements yeast new varieties of yeast
The meaning wanted.
The content of the invention
It is an object of the invention to provide a kind of rich molybdenum saccharomyces cerevisiae, its absorption accumulation ability to molybdenum is strong, it is possible to increase
The molybdenum content of saccharomyces cerevisiae Related product, the necessary trace element molybdenum required for the supplement people of effective and safe.Mesh of the invention
Also reside in the preparation method that the rich molybdenum saccharomyces cerevisiae is provided, the method is accurate, ecological safety, brief and practical, it is low-cost,
Applicability is wide, workable.
In order to realize above-mentioned purpose, the present invention uses following technical scheme：
A kind of rich molybdenum saccharomyces cerevisiae, being can constitutive expressionGlym08g22300The saccharomyces cerevisiae of gene, it is describedGlym08g22300The nucleotide sequence of gene is as shown in SEQ ID NO.1.
Preferably, described rich molybdenum saccharomyces cerevisiae for conversion can constitutive expressionGlym08g22300The recombinant vector of gene
Saccharomyces cerevisiae INVSC1；Described recombinant vector is using pAG306GPD-ccdB as skeleton carrier.
The preparation method of described rich molybdenum saccharomyces cerevisiae, comprises the following steps：WillGlym08g22300Gene is connected to ferment
Recombinant expression carrier is built on female constitutive expression carrier, then recombinant expression carrier is transferred in saccharomyces cerevisiae is obtained the wine brewing of rich molybdenum
Yeast.
Described rich molybdenum saccharomyces cerevisiae richness molybdenum ability is strong, can be used to prepare prevention and/or treating cancer, cardiovascular and cerebrovascular disease
And/or the medicine of liver diseases.
A kind of screening technique of rich molybdenum saccharomyces cerevisiae, comprises the following steps：
（1）Molybdenum is obtained by blast and transports sub- homologous gene；
（2）Homologous gene is connected on yeast constitutive expression carrier and builds recombinant expression carrier；
（3）Recombinant expression carrier is transferred in saccharomyces cerevisiae；Gained transformant collects ferment after being cultivated in culture medium containing molybdenum
Mother cell, determines molybdenum content.
In itself with by nutrient in culture medium, it is enriched in the function in own cells tissue, the present invention is utilized yeast
Transgenic technology is transferred to the genes of interest with molybdenum absorption function in yeast, by determining yeast molybdenum uptake, obtains a kind of
There can be the saccharomyces cerevisiae of higher molybdenum accumulation ability.The present invention compared with prior art, has the advantages that：
（1）Present invention screening cycle is short, can obtain the mutant bacterium with higher molybdenum accumulation ability within the very fast time
Strain；
（2）Ecological safety of the present invention, it is not necessary to which the method such as physics, chemistry carries out mutagenic treatment；
（3）The rich molybdenum yeast molybdenum accumulation ability that is obtained of the present invention is higher, required for can effectively meeting organism
Molybdenum nutrition.
Therefore, the present invention has good economic benefit and social benefit.
Brief description of the drawings
Fig. 1 is the column statistical chart of molybdenum content in the yeast for convert the expression vector containing different genes of interest.
Specific embodiment
With reference to embodiment, the present invention is described in further detail, but embodiments of the present invention not limited to this.
If not specializing, the conventional meanses that technological means used is well known to those skilled in the art in embodiment.
Embodiment 1
1st, the determination of candidate gene and the design of primer
Sub- AtMOT1 and AtMOT2 protein sequences blast soybean gene group databases are transported using arabidopsis molybdenum（http://
www.soybase.org/）, obtain Molybdenum In Soybean and transport sub- homologous gene totally 7；Sub- homologous gene and plan are transported to 7 Molybdenum In Soybeans
Southern mustard molybdenum transports sub- AtMOT1 and AtMOT2 and carries out homology analysis, and sub- homologous gene as examination is transported using wherein 3 Molybdenum In Soybeans
Object is tested, respectivelyGlym08g22300（SEQ ID NO.1）、Glyma06g07780（SEQ ID NO.2）、Glyma14g16610（SEQ ID NO.3）.According to the soybean candidate gene sequence announced on phytozome
（Glym08g22300、Glyma06g07780、Glyma14g16610）And pENTR/D-TOPO cloning kit（Gateway
Technology）Requirement design primer.
The primer sequence for expanding each gene is as follows：
AmplificationGlyma06g07780The primer of gene：
Forward primer 5 ' -3 '：CACCATGGCACCACCGAACCCCCCA,
Reverse primer 5 ' -3 '：AACTTGCTCATCAGGGCCTTCATGCTGCTTCCA, Tm=55 DEG C, GC=68%；
AmplificationGlym08g22300The primer of gene：
Forward primer 5 ' -3 '：CACCATGGCACCCTCAATCTCCGAC,
Reverse primer 5 ' -3 '：GGCAATCAAGCTAGCTTGTTC, Tm=60 DEG C, GC=57%；
Expand the primer of Glyma14g16610 genes：
Forward primer 5 ' -3 '：CACCATGGGTGACCTTGGCACTTATA,
Reverse primer 5 ' -3 '：AACTTGCTCAGGTCTTTTCTGCATCCA, Tm=63 DEG C, GC=50%.
2nd, entry vector and Yeast expression carrier build
（1）Gateway entry vectors build：The sample of collection soybean leaves or root, using RNeasy Plant kits
（QIAGEN）And RNA, while reverse transcription RNA obtains cDNA.Enter performing PCR using Phusion high-fidelity enzymes as template with cDNA to expand
Increase, and be attached according to the explanation of pENTR/D-TOPO cloning kit specifications, be sequenced, build entry vector（pEnter
Carrier）.
Wherein, pcr amplification reaction system is：5 × Phusion HF Buffer, 10 μ L, 10mM dNTPs 1 μ L, 20 μM
Forward primer 1.25 μ L, 20 μM of μ L of 1.25 1.5 μ L, Phusion DNA Polymerase of μ L, DMSO of reverse primer 1, template
DNA 4µL。
Pcr amplification reaction program is：98 DEG C of 30s, mono- circulation；98 DEG C of 10s, 66 DEG C of 20s, 72 DEG C of 45s, 30 circulations；
72 DEG C of 1min, a circulation.
（2）Yeast expression carrier builds
Using Gateway LR Clonase II Enzyme mix LR enzyme reagent kits（The Invitrogen U.S.）Will
Genes of interest in entry vector is connected to pAG306GPD-ccdB（Composing type）Or pAG306GAL-ccdB（Galactolipin starts
Sub- induction type）Upper structure yeast heterologous expression vector.
3rd, Yeast expression carrier is converted in saccharomyces cerevisiae INVSC1
Using Frozen-EZ Yeast Transformation IITMKit（ZYMO, USA）, will be with genes of interest
Yeast heterologous expression vector convert to saccharomycete（Saccharomyces cerevisiae）In INVSC1, transported with without molybdenum
The empty plasmid of sub- candidate gene is compared；Screened using uracil-deficient type SD solid mediums, filter out and convert successfully
Yeast.
4th, the checking of yeast molybdenum absorption function
Picking converts successful yeast single bacterium colony without molybdenum uracil-deficient type glucose or galactolipin SD fluid nutrient mediums
（0.77gCSM-URA, 20g glucose or galactolipin, 6.7g are settled to 1000mL without molybdenum YNB, deionized water）Upper culture arrives right
Number mid-term, i.e. OD600=1.0；Bacterium solution is then transferred to the uracil-deficient type glucose containing 250nM Mo or galactolipin SD liquid
In body culture medium, 30 DEG C, 220 revs/min are cultivated 45 minutes.4 DEG C of centrifuge, 3000 revs/min be centrifuged 2 minutes, abandon supernatant,
And washed 2 times with deionization sterilized water, drying is weighed, and adds top pure grade concentrated nitric acid nitrification, is surveyed using the type ICP-MS of Expec 7000
Determine the molybdenum content in yeast.
5th, data analysis
Data processing and drawing use Excel softwares.
Different genes will be containedGlym08g22300、Glyma06g07780、Glyma14g16610Yeast expression carrier
It is transferred in saccharomyces cerevisiae INVSC1, Yeast expression carrier includes pAG306GPD（Composing type）And pAG306GAL（Galactolipin starts
Sub- induction type）Two distinct types of expression vector.Yeast is urinating phonetic containing two kinds of different carbon sources of glucose or galactolipin without molybdenum
Cultivated to mid-log phase on pyridine deficiency SD fluid nutrient mediums, be then transferred to the uracil-deficient type SD liquid containing 250nM Mo
Culture 45 minutes is carried out in body culture medium, the molybdenum content in cell is measured.As shown in figure 1, the yeast of pAG306GPD types
Expression vector has molybdenum accumulation capability higher, table in the experiment of saccharomyces cerevisiae INVSC1 heterogenous expressions than pAG306GAL type
Bright galactose promoter transports subbase to molybdenum, and because that can not carry out induction, it is expressed so as to show molybdenum accumulation capability higher；And work as
The heterologous constitutive expression of yeastGlym08g22300During gene, its molybdenum content is far above other two genes.
Above-described embodiment is the present invention preferably implementation method, but embodiments of the present invention are not by above-described embodiment
Limitation, it is other it is any without departing from Spirit Essence of the invention and the change, modification, replacement made under principle, combine, simplification,
Equivalent substitute mode is should be, is included within protection scope of the present invention.
Claims (5)
1. a kind of rich molybdenum saccharomyces cerevisiae, it is characterised in that：The wine brewing ferment of gene shown in energy constitutive expression SEQ ID NO.1
It is female.
2. rich molybdenum saccharomyces cerevisiae according to claim 1, it is characterised in that：For conversion can constitutive expression SEQ ID
The saccharomyces cerevisiae INVSC1 of the recombinant vector of gene shown in NO.1.
3. rich molybdenum saccharomyces cerevisiae according to claim 2, it is characterised in that：Described recombinant vector is with pAG306GPD-
CcdB is used as skeleton carrier.
4. the preparation method of the rich molybdenum saccharomyces cerevisiae described in claim 1, it is characterised in that comprise the following steps：By SEQ ID
Gene shown in NO.1 is connected to and recombinant expression carrier is built on yeast constitutive expression carrier, then recombinant expression carrier is transferred into wine
Rich molybdenum saccharomyces cerevisiae is obtained in brewer yeast.
5. the rich molybdenum saccharomyces cerevisiae described in any one of claim 1-3 is preparing prevention and/or treating cancer, cardiovascular and cerebrovascular disease
And/or the application in the medicine of liver diseases.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201610429223.9A CN105861350B (en) | 2016-06-16 | 2016-06-16 | A kind of rich molybdenum saccharomyces cerevisiae and preparation method thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201610429223.9A CN105861350B (en) | 2016-06-16 | 2016-06-16 | A kind of rich molybdenum saccharomyces cerevisiae and preparation method thereof |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN105861350A CN105861350A (en) | 2016-08-17 |
| CN105861350B true CN105861350B (en) | 2017-06-16 |
Family
ID=56649679
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201610429223.9A Active CN105861350B (en) | 2016-06-16 | 2016-06-16 | A kind of rich molybdenum saccharomyces cerevisiae and preparation method thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN105861350B (en) |
Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN1301811A (en) * | 1999-12-29 | 2001-07-04 | 吴光耀 | Transgenosis ferritin enzyme capable of compensating iron for human and its producing method |
| CN101942399A (en) * | 2010-09-08 | 2011-01-12 | 中国科学院微生物研究所 | Molybdenum-enriched saccharomyces cereuisiae and application thereof |
| CN104489345A (en) * | 2014-12-12 | 2015-04-08 | 韦文峰 | Molybdenum-rich microbial feed additive for dairy cow and preparation method of molybdenum-rich microbial feed additive |
-
2016
- 2016-06-16 CN CN201610429223.9A patent/CN105861350B/en active Active
Patent Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN1301811A (en) * | 1999-12-29 | 2001-07-04 | 吴光耀 | Transgenosis ferritin enzyme capable of compensating iron for human and its producing method |
| CN101942399A (en) * | 2010-09-08 | 2011-01-12 | 中国科学院微生物研究所 | Molybdenum-enriched saccharomyces cereuisiae and application thereof |
| CN104489345A (en) * | 2014-12-12 | 2015-04-08 | 韦文峰 | Molybdenum-rich microbial feed additive for dairy cow and preparation method of molybdenum-rich microbial feed additive |
Non-Patent Citations (1)
| Title |
|---|
| GENBANK登录号：XM_003531645.3;匿名;《GENBANK数据库》;20151125;参见序列及相关信息 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN105861350A (en) | 2016-08-17 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN108004402B (en) | A kind of method that Thiobacillus ferrooxidans leaches copper in discarded printed circuit boards | |
| CN107164249A (en) | One plant of sub- sieve solution fat yeast and its application | |
| CN108060092A (en) | A kind of recombinant bacterium and application thereof | |
| CN102787121A (en) | Method for validating transcription factor gene function | |
| CN100441686C (en) | Small quality fast extraction method for soil total DNA | |
| CN104558128B (en) | The albumen related to anti-Fusarium graminearum stem rot and its encoding gene and application | |
| CN107636155A (en) | The D amino acid inducible gene expression systems of Rhodosporidium and Rhodotorula | |
| CN105505930B (en) | Peanut Δ12Promoter of fatty acid dehydrogenase AhFAD2-1B-m genes and its preparation method and application | |
| CN105861350B (en) | A kind of rich molybdenum saccharomyces cerevisiae and preparation method thereof | |
| CN112608936B (en) | Promoter for regulating and controlling expression of exogenous gene of yeast, regulating and controlling method and application thereof | |
| CN106755138A (en) | It is a kind of to improve the method that fermentation of Aspergillus niger produces lemon acid yield | |
| CN109295253A (en) | High oleic acid peanut is quickly chosen seeds kit | |
| CN102433330B (en) | Recombinant plasmid for genetic transformation of pleurotus eryngii and application thereof | |
| CN107200773A (en) | Come from pathogenic gene MoSNT2 of Pyricularia oryzae and application thereof | |
| CN105087587B (en) | Peanut Δ12The promoter of fatty acid dehydrogenase AhFAD2 2A genes and its application | |
| CN105274112B (en) | A kind of promoter of induced expression in acid condition | |
| CN107325161A (en) | A kind of albumen related with high-salt stress to resistance to Low nitrogen stress and its encoding gene and application | |
| CN114525213B (en) | Strain with high erythritol yield and method for producing erythritol by fermenting strain | |
| CN102399795A (en) | Method for improving tropane alkaloid content in atropa belladonna by using atropa belladonna tropinone reductase I gene | |
| CN107881123A (en) | One plant of genetic engineering bacterium and its construction method and application using methanol production pyruvic acid | |
| CN105779446B (en) | Glycerol 3-phosphate kinase promoter and terminator and its application | |
| CN102925430A (en) | Quick batch preparation method of cotton genome DNA (deoxyribonucleic acid) suitable for PCR (polymerase chain reaction) | |
| CN113736806A (en) | Gene for improving oil synthesis of marine nannochloropsis and application thereof | |
| CN106906225A (en) | The manganese peroxidase enzyme gene and its acquisition methods of a kind of lignin degrading | |
| KR100606612B1 (en) | -6 delta-6 desaturase gene from camellia chinensis expression vector comprising the gene transformants transformed with the vector and production method of the transformants |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant |