CN105861350A - Molybdenum-rich saccharomyces cerevisiae and preparing method thereof - Google Patents
Molybdenum-rich saccharomyces cerevisiae and preparing method thereof Download PDFInfo
- Publication number
- CN105861350A CN105861350A CN201610429223.9A CN201610429223A CN105861350A CN 105861350 A CN105861350 A CN 105861350A CN 201610429223 A CN201610429223 A CN 201610429223A CN 105861350 A CN105861350 A CN 105861350A
- Authority
- CN
- China
- Prior art keywords
- saccharomyces cerevisiae
- molybdenum
- rich
- yeast
- expression carrier
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/415—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from plants
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K36/00—Medicinal preparations of undetermined constitution containing material from algae, lichens, fungi or plants, or derivatives thereof, e.g. traditional herbal medicines
- A61K36/06—Fungi, e.g. yeasts
- A61K36/062—Ascomycota
- A61K36/064—Saccharomycetales, e.g. baker's yeast
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
- C12N15/80—Vectors or expression systems specially adapted for eukaryotic hosts for fungi
- C12N15/81—Vectors or expression systems specially adapted for eukaryotic hosts for fungi for yeasts
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2800/00—Nucleic acids vectors
- C12N2800/10—Plasmid DNA
- C12N2800/102—Plasmid DNA for yeast
Abstract
The invention discloses molybdenum-rich saccharomyces cerevisiae and a preparing method thereof, and belongs to the fields of human health and fermentation engineering. The saccharomyces cerevisiae can constitutively express genes shown in SEQ NO.1 and can be used for preparing drugs for preventing and/or treating cancers, cardiovascular and cerebrovascular diseases and/or hepatic diseases. The genes shown in SEQ NO.1 are connected to a saccharomyces cerevisiae constitutive expression carrier to construct a recombinant expression vector, and the recombinant expression vector is transferred into saccharomyces cerevisiae to obtain the molybdenum-rich saccharomyces cerevisiae. The molybdenum-rich saccharomyces cerevisiae is high in enrichment capacity and has high economic benefits and social benefits.
Description
Technical field
The present invention relates to health and field of fermentation engineering, be specifically related to a kind of rich molybdenum saccharomyces cerevisiae and preparation method thereof.
Background technology
Molybdenum is one of micronutrient element necessary to animal, microorganism and human body, is the important composition composition of the multiple enzymes such as azotase, nitrate reductase, xanthine oxidase, aldehyde oxidase, sulfite oxidase.The multiple metabolic process that molybdenum participates in and affects in body；Molybdenum can suppress the growth of breast carcinoma, controls esophageal carcinoma and the mortality rate of other cancer；Molybdenum can protect cardiac muscle, prevention cardiovascular and cerebrovascular disease and hepatic disease；Molybdenum has good preventive and therapeutic effect to endemic diseases such as Keshan disease, dental caries, microcytic hypochromic anemia and regional alopecias simultaneously.Molybdenum can increase the ability of body opposing pathogenic bacteria, improves body immunity；Growth to animal has obvious facilitation.
Yeast can pass through sorption enhanced, by trace element enrichment contained in culture medium in own cells tissue, inorganic microelement changes over the organic form that toxicity is low, improves bioavailability and safety；Meanwhile, the biological active matter confrontation organism of yeast itself also has health-care effect, is one of the effective carrier of Rich in Trace Element.In adult's meals every day, trace element molybdenum demand is about 0.1mg, therefore rich molybdenum yeast supplementing as body molybdenum source, and the important functional component especially as prevention and treatment cancer, cardiovascular and cerebrovascular disease and liver disease medicament has caused people greatly to pay attention to.
The method that eutrophy element yeast species selection-breeding at present is used mainly includes that the acquisitions such as ultraviolet, microwave and chemical reagent mutation have the mutant yeast that eutrophy element is higher.There is certain blindness and randomness in above breeding method, process is relatively complicated.Such as, although ultraviolet mutagenesis operates fairly simple, but misoperation can produce injury to human body, and the method also needs to carry out the substantial amounts of Screening and Identification without purposiveness and works.
In sum, invent a kind of method that can improve yeast molybdenum content rapidly and accurately and be very important, and be prepared by this method other with yeast for carrier enrichment various trace elements yeast new varieties also be tool be of great significance.
Summary of the invention
It is an object of the invention to provide a kind of rich molybdenum saccharomyces cerevisiae, it is strong to the absorption accumulation ability of molybdenum, it is possible to increase the molybdenum content of saccharomyces cerevisiae Related product, the necessary trace element molybdenum required for the supplementary people of effective and safe.The present invention also aims to provide the preparation method of described rich molybdenum saccharomyces cerevisiae, the method accurately, ecological safety, brief and practical, low cost, the suitability wide, workable.
In order to realize above-mentioned purpose, the present invention by the following technical solutions:
A kind of rich molybdenum saccharomyces cerevisiae, for energy constitutive expressionGlym08g22300The saccharomyces cerevisiae of gene, describedGlym08g22300The nucleotide sequence of gene is as shown in SEQ ID NO.1.
Preferably, described rich molybdenum saccharomyces cerevisiae is that conversion can constitutive expressionGlym08g22300The saccharomyces cerevisiae INVSC1 of the recombinant vector of gene；Described recombinant vector is using pAG306GPD-ccdB as skeleton carrier.
The preparation method of described rich molybdenum saccharomyces cerevisiae, comprise the steps: byGlym08g22300Gene is connected on yeast constitutive expression carrier build recombinant expression carrier, then proceeds to recombinant expression carrier obtain rich molybdenum saccharomyces cerevisiae in saccharomyces cerevisiae.
Described rich molybdenum saccharomyces cerevisiae richness molybdenum ability is strong, can be used for preparation prevention and/or treatment cancer, cardiovascular and cerebrovascular disease and/or the medicine of hepatic disease.
The screening technique of a kind of rich molybdenum saccharomyces cerevisiae, comprises the steps:
(1) obtain molybdenum by blast and transport sub-homologous genes；
(2) it is connected to homologous genes on yeast constitutive expression carrier build recombinant expression carrier；
(3) recombinant expression carrier is proceeded in saccharomyces cerevisiae；Gained transformant collects yeast cells after cultivating in containing molybdenum culture medium, measures molybdenum content.
Yeast itself has culture medium Middle nutrition element that it is enriched in the function in own cells tissue, the present invention utilizes transgenic technology that the genes of interest with molybdenum absorption function is proceeded in yeast, by measuring yeast molybdenum absorbtivity, it is thus achieved that a kind of saccharomyces cerevisiae with higher molybdenum accumulation ability.The present invention compared with prior art, has the advantages that:
(1) to screen the cycle short for the present invention, can obtain the mutants which had with higher molybdenum accumulation ability within the very fast time；
(2) ecological safety of the present invention, it is not necessary to the method such as physics, chemistry carries out mutagenic treatment；
(3) the rich molybdenum yeast molybdenum accumulation ability that the present invention is obtained is higher, can effectively meet the molybdenum nutrition required for organism.
Therefore, the present invention has good economic benefit and social benefit.
Accompanying drawing explanation
Fig. 1 is the column cartogram of molybdenum content in the yeast converting the expression vector containing different genes of interest.
Detailed description of the invention
Below in conjunction with embodiment, the present invention is described in further detail, but embodiments of the present invention are not limited to this.If not specializing, the conventional means that technological means used in embodiment is well known to those skilled in the art.
Embodiment 1
1, the determination of candidate gene and the design of primer
Utilize arabidopsis molybdenum to transport sub-AtMOT1 and AtMOT2 protein sequence blast soybean gene group data base (http://www.soybase.org/), obtain Molybdenum In Soybean transhipment sub-homologous genes totally 7；7 Molybdenum In Soybeans are transported sub-homologous genes and arabidopsis molybdenum is transported sub-AtMOT1 and AtMOT2 and carried out homology analysis, using wherein 3 Molybdenum In Soybean homologous geness of transhipment as subjects, be respectivelyGlym08g22300(SEQ ID NO.1),Glyma06g07780(SEQ ID NO.2),Glyma14g16610(SEQ ID NO.3).According on phytozome announce Semen sojae atricolor candidate gene sequence (Glym08g22300、Glyma06g07780、Glyma14g16610) and pENTR/D-TOPO cloning
Kit(Gateway technology) requirement design primer.
The primer sequence expanding each gene is as follows:
AmplificationGlyma06g07780The primer of gene:
Forward primer 5 '-3 ': CACCATGGCACCACCGAACCCCCCA,
Reverse primer 5 '-3 ': AACTTGCTCATCAGGGCCTTCATGCTGCTTCCA, Tm=55 DEG C, GC=68%；
AmplificationGlym08g22300The primer of gene:
Forward primer 5 '-3 ': CACCATGGCACCCTCAATCTCCGAC,
Reverse primer 5 '-3 ': GGCAATCAAGCTAGCTTGTTC, Tm=60 DEG C, GC=57%；
The primer of amplification Glyma14g16610 gene:
Forward primer 5 '-3 ': CACCATGGGTGACCTTGGCACTTATA,
Reverse primer 5 '-3 ': AACTTGCTCAGGTCTTTTCTGCATCCA, Tm=63 DEG C, GC=50%.
2, entry vector and Yeast expression carrier build
(1) gateway entry vector builds: gather soybean leaves or the sample of root, uses RNeasy
Plant test kit (QIAGEN) and RNA, reverse transcription RNA obtains cDNA simultaneously.Phusion high-fidelity enzyme is used to carry out PCR amplification with cDNA for template, and according to pENTR/D-TOPO
The explanation of cloning kit description is attached, checks order, builds entry vector (pEnter carrier).
Wherein, pcr amplification reaction system is: 5 × Phusion
HF Buffer 10 L, 10mM dNTPs 1 L, 20 M forward primer 1.25 L, 20 M reverse primer 1.25 L, DMSO 1.5 L, Phusion DNA Polymerase 1 L, template DNA 4 L.
Pcr amplification reaction program is: mono-circulation of 98 DEG C of 30s；98 DEG C of 10s, 66 DEG C of 20s, 72 DEG C of 45s, 30 circulations；72 DEG C of 1min, a circulation.
(2) Yeast expression carrier builds
Utilize Gateway LR Clonase
Genes of interest in entry vector is connected to pAG306GPD-ccdB(composing type by II Enzyme mix LR enzyme reagent kit (the Invitrogen U.S.)) or pAG306GAL-ccdB(galactose promoter induction type) upper structure yeast heterologous expression vector.
3, Yeast expression carrier converts in saccharomyces cerevisiae INVSC1
Use Frozen-EZ Yeast Transformation IITMTest kit (ZYMO, USA), by with genes of interest yeast heterologous expression vector convert to yeast (Saccharomyces cerevisiae) in INVSC1, compare transporting the empty plasmid of sub-candidate gene without molybdenum；Utilize uracil-deficient type SD solid medium to screen, filter out the successful yeast of conversion.
4, the checking of yeast molybdenum absorption function
Picking converts successful yeast list bacterium colony and is cultivating mid-log phase, i.e. OD without molybdenum uracil-deficient type glucose or galactose SD fluid medium (0.77gCSM-URA, 20g glucose or galactose, 6.7g is settled to 1000mL without molybdenum YNB, deionized water) are upper600=1.0；Subsequently bacterium solution is proceeded to containing 250nM
In the uracil-deficient type glucose of Mo or galactose SD fluid medium, cultivate 45 minutes for 30 DEG C, 220 revs/min.4 DEG C of centrifuge, 3000 revs/min centrifugal 2 minutes, abandon supernatant, and wash 2 times with deionization sterilized water, drying is weighed, and adds top grade pure concentrated nitric acid nitrification, utilizes Expec 7000 type ICP-MS to measure the molybdenum content in yeast.
5, data analysis
Data process and draw and use Excel software.
Will be containing different genesGlym08g22300、Glyma06g07780、Glyma14g16610Yeast expression carrier proceed in saccharomyces cerevisiae INVSC1, Yeast expression carrier includes pAG306GPD(composing type) and pAG306GAL(galactose promoter induction type) two distinct types of expression vector.Yeast is cultivated to mid-log phase on the type SD fluid medium of uracil-deficient without molybdenum containing glucose or two kinds of different carbon source of galactose, it is then transferred to the uracil-deficient type SD fluid medium containing 250nM Mo carries out cultivating 45 minutes, the molybdenum content being measured in cell.As shown in Figure 1, the Yeast expression carrier of pAG306GPD type has higher molybdenum accumulation capability than pAG306GAL type in saccharomyces cerevisiae INVSC1 heterogenous expression is tested, and shows that galactose promoter shows higher molybdenum accumulation capability to molybdenum transhipment subbase because it can not be induced to express；And when yeast allos constitutive expressionGlym08g22300During gene, its molybdenum content is far above other two genes.
Above-described embodiment is the present invention preferably embodiment; but embodiments of the present invention are also not restricted to the described embodiments; the change made under other any spirit without departing from the present invention and principle, modify, substitute, combine, simplify; all should be the substitute mode of equivalence, within being included in protection scope of the present invention.
Claims (6)
1. a rich molybdenum saccharomyces cerevisiae, it is characterised in that: for the saccharomyces cerevisiae of gene shown in energy constitutive expression SEQ ID NO.1.
Rich molybdenum saccharomyces cerevisiae the most according to claim 1, it is characterised in that: can the saccharomyces cerevisiae INVSC1 of recombinant vector of gene shown in constitutive expression SEQ ID NO.1 for converting.
Rich molybdenum saccharomyces cerevisiae the most according to claim 1, it is characterised in that: described recombinant vector is using pAG306GPD-ccdB as skeleton carrier.
4. the preparation method of the rich molybdenum saccharomyces cerevisiae described in claim 1, it is characterized in that comprising the steps: to be connected to gene shown in SEQ ID NO.1 on yeast constitutive expression carrier build recombinant expression carrier, then proceed to recombinant expression carrier saccharomyces cerevisiae obtains rich molybdenum saccharomyces cerevisiae.
5. the application in the medicine of preparation prevention and/or treatment cancer, cardiovascular and cerebrovascular disease and/or hepatic disease of the rich molybdenum saccharomyces cerevisiae described in any one of claim 1-3.
6. the screening technique of a rich molybdenum saccharomyces cerevisiae, it is characterised in that comprise the steps:
(1) obtain molybdenum by blast and transport sub-homologous genes；
(2) it is connected to homologous genes on yeast constitutive expression carrier build recombinant expression carrier；
(3) recombinant expression carrier is proceeded in saccharomyces cerevisiae；Gained transformant collects yeast cells after cultivating in containing molybdenum culture medium, measures molybdenum content.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201610429223.9A CN105861350B (en) | 2016-06-16 | 2016-06-16 | A kind of rich molybdenum saccharomyces cerevisiae and preparation method thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201610429223.9A CN105861350B (en) | 2016-06-16 | 2016-06-16 | A kind of rich molybdenum saccharomyces cerevisiae and preparation method thereof |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN105861350A true CN105861350A (en) | 2016-08-17 |
| CN105861350B CN105861350B (en) | 2017-06-16 |
Family
ID=56649679
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201610429223.9A Active CN105861350B (en) | 2016-06-16 | 2016-06-16 | A kind of rich molybdenum saccharomyces cerevisiae and preparation method thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN105861350B (en) |
Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN1301811A (en) * | 1999-12-29 | 2001-07-04 | 吴光耀 | Transgenosis ferritin enzyme capable of compensating iron for human and its producing method |
| CN101942399A (en) * | 2010-09-08 | 2011-01-12 | 中国科学院微生物研究所 | Molybdenum-enriched saccharomyces cereuisiae and application thereof |
| CN104489345A (en) * | 2014-12-12 | 2015-04-08 | 韦文峰 | Molybdenum-rich microbial feed additive for dairy cow and preparation method of molybdenum-rich microbial feed additive |
-
2016
- 2016-06-16 CN CN201610429223.9A patent/CN105861350B/en active Active
Patent Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN1301811A (en) * | 1999-12-29 | 2001-07-04 | 吴光耀 | Transgenosis ferritin enzyme capable of compensating iron for human and its producing method |
| CN101942399A (en) * | 2010-09-08 | 2011-01-12 | 中国科学院微生物研究所 | Molybdenum-enriched saccharomyces cereuisiae and application thereof |
| CN104489345A (en) * | 2014-12-12 | 2015-04-08 | 韦文峰 | Molybdenum-rich microbial feed additive for dairy cow and preparation method of molybdenum-rich microbial feed additive |
Non-Patent Citations (3)
| Title |
|---|
| 匿名: "GENBANK登录号：XM_003531645.3", 《GENBANK数据库》 * |
| 匿名: "登录号：XM_003527756.3", 《GENBANK数据库》 * |
| 匿名: "登录号：XM_003545468.3", 《GENBANK数据库》 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN105861350B (en) | 2017-06-16 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Han et al. | Phylogenetic reassessment of Hyaloscyphaceae sensu lato (Helotiales, Leotiomycetes) based on multigene analyses | |
| Lagrange et al. | New insights into the mycorrhizal status of Cyperaceae from ultramafic soils in New Caledonia | |
| CN102787121A (en) | Method for validating transcription factor gene function | |
| CN100441686C (en) | Small quality fast extraction method for soil total DNA | |
| Wikström et al. | Phylogeny of epiphytic Huperzia (Lycopodiaceae): paleotropical and neotropical clades corroborated by rbcL sequences | |
| CN104558128B (en) | The albumen related to anti-Fusarium graminearum stem rot and its encoding gene and application | |
| CN109295253A (en) | High oleic acid peanut is quickly chosen seeds kit | |
| CN105861350A (en) | Molybdenum-rich saccharomyces cerevisiae and preparing method thereof | |
| CN103898094B (en) | Extraction method of rosewood heartwood genome DNA (deoxyribonucleic acid) | |
| CN106243205A (en) | The albumen of a kind of clavacin of degrading and encoding gene thereof and application | |
| CN114525213B (en) | Strain with high erythritol yield and method for producing erythritol by fermenting strain | |
| CN102925430A (en) | Quick batch preparation method of cotton genome DNA (deoxyribonucleic acid) suitable for PCR (polymerase chain reaction) | |
| CN105779446B (en) | Glycerol 3-phosphate kinase promoter and terminator and its application | |
| CN108728569A (en) | A kind of okra reference gene and its application | |
| CN106906225A (en) | The manganese peroxidase enzyme gene and its acquisition methods of a kind of lignin degrading | |
| CN106755055B (en) | Kit and method for inhibiting pine wood nematode gene expression | |
| CN101220390B (en) | Method for rapidly extracting plants sample DNA | |
| CN105238858B (en) | It is a kind of for detecting the flanking sequence and its specificity identification method that turn restructuring lactoferrin rice strain G281 | |
| CN109136393A (en) | Detect the primer and method of Agasicles hygrophila CCO gene expression characteristics | |
| CN105838707A (en) | Method for extraction of total RNA from pomacea canaliculata muscular tissue | |
| CN108950015A (en) | Identify the multiple PCR detection kit and its detection method of Pomacea canaliculata hybrid | |
| CN106148338B (en) | Na+/ Pi cotransporter promoter and terminator and its application | |
| CN106755564A (en) | A kind of method for identifying molecules of upland cotton I formula fruit branches | |
| CN104388455B (en) | The RNAi carrier and its construction method of Chlamydomonas reinhardtii related gene and application | |
| CN107267647A (en) | A kind of PCR reaction systems of root of kudzu vine SCoT molecular labelings |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant |