CN102925430A - Quick batch preparation method of cotton genome DNA (deoxyribonucleic acid) suitable for PCR (polymerase chain reaction) - Google Patents

Quick batch preparation method of cotton genome DNA (deoxyribonucleic acid) suitable for PCR (polymerase chain reaction) Download PDF

Info

Publication number
CN102925430A
CN102925430A CN2012105148275A CN201210514827A CN102925430A CN 102925430 A CN102925430 A CN 102925430A CN 2012105148275 A CN2012105148275 A CN 2012105148275A CN 201210514827 A CN201210514827 A CN 201210514827A CN 102925430 A CN102925430 A CN 102925430A
Authority
CN
China
Prior art keywords
dna
cotton
centrifuge tube
pcr
extracting
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Pending
Application number
CN2012105148275A
Other languages
Chinese (zh)
Inventor
张道远
李小双
李海燕
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Xinjiang Institute of Ecology and Geography of CAS
Original Assignee
Xinjiang Institute of Ecology and Geography of CAS
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Xinjiang Institute of Ecology and Geography of CAS filed Critical Xinjiang Institute of Ecology and Geography of CAS
Priority to CN2012105148275A priority Critical patent/CN102925430A/en
Publication of CN102925430A publication Critical patent/CN102925430A/en
Pending legal-status Critical Current

Links

Images

Landscapes

  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)

Abstract

The invention discloses a quick batch preparation method of cotton genome DNA (deoxyribonucleic acid) suitable for PCR (polymerase chain reaction), relating to the molecular detection of genetically modified crops in the field of crop breeding. The method comprises the following steps of: putting the tender leaves at the top of a cotton plant into a centrifuge tube; adding an extracting solution and steel balls; breaking the sample; performing treatment in a water bath; adding a leaching solution for leaching; precipitating DNA with isopropyl alcohol; washing with ethanol; and dissolving the precipitate in water to obtain the extracted DNA. The method disclosed by the invention solves the problems of complicated steps and time and labor consumption in cotton genome DNA extraction; the invention provides a method capable of quickly extracting the DNA meeting the requirements of PCR detection in batches; and the method can be applied to the molecular biological detection in the links of genetically modified cotton breeding, safety report and the like.

Description

Be applicable to quick, the batch preparation of cotton genomic dna of PCR
Technical field
The present invention relates to quick, the batch preparation of a kind of cotton genomic dna for PCR.
Background technology
Cotton is important cash crop in China and even the world wide, and China is maximum in the world Cotton Production state at present.In recent years, along with the development of Protocols in Molecular Biology and Biotechnology in Genetic Breeding, large quantities of have antibiont and coerce the gene of (pest-resistant) and resisting abiotic stress (antiweed, drought resisting) and successfully change cotton over to.The genetic resources of these high-qualitys is that crop high yield and environmental contamination reduction have been made great contribution.Yet when cultivating new variety, the land for growing field crops testing of every generation transgene cotton is puzzlement breeding man and molecular biology research person's a great problem always.Because this link workload is large, waste time and energy.Often need in the short period of time from several thousand strains of field planting even strain cotton up to ten thousand, to identify the transgenic positive strain.This just need a kind of easy, identify the molecular biology method of transgenosis field experiment material efficiently, fast.And according to the requirement that China's transgenic crop security is declared, the transgene cotton security is declared also needs to carry out molecular Biological Detection.Can be divided into method of protein detection and nucleic acid detection method to the detection method of genetically modified crops at present, and the polymerase chain reaction in the nucleic acid detection method (PCR) technology is owing to its highly sensitive, high specific, the main method that has become transgenic plant and products thereof detection easy and simple to handle.
The prerequisite of carrying out the PCR detection is the genomic dna of the extraction cotton of rapid, high volume.At present, all set up the technology of efficient rapid extraction genomic dna for wheat, corn, paddy rice, soybean and rape etc.But for cotton, because cotton is rich in the secondary meta-bolitess such as gossypol, polysaccharide, tannin, such material is very easily oxidation when cytoclasis, and can form mixture with nucleic acid and protein binding, affect the extraction of high quality cotton DNA, and then affect a series of molecular biology operations such as follow-up PCR, enzyme cut.Utilize high level salt solution protein precipitation and acidic polysaccharose such as traditional CTAB method, the principle of less salt solution precipitation nucleic acid is removed albumen and glucide, but so just increased adding different concns NaCl and extracting, centrifugal operation with its removal, often needed the steps such as long precipitation, ice bath in order to improve yield simultaneously.SDS method and then utilize the abundant lysing cell of SDS to discharge nucleic acid substances based on the improved the whole bag of tricks of this method, and use chloroform: the primary isoamyl alcohol repeatedly method of extracting comes purify DNA, but this method extraction efficiency concerning this species that are rich in secondary metabolite of cotton is very low.The oxidation that a lot of improved SDS methods adding antioxidant suppress aldehydes matter is with the raising productive rate, but effect is unsatisfactory.The modification method that has the scholar to propose the CTAB-SDS combination extracts cotton genomic dna, although obtained a large amount of high-quality genomic dnas, but still step is complicated, consuming time longer, the fast PCR that is unsuitable for transgene cotton detects.In addition, method of drawing material in the past mostly is to get to wrap in paper bag or the plastics bag behind the functional leaf takes back the laboratory, then directly puts into refrigerator freezing until use.Such method of drawing material increased material exsomatize, the operating time of the link such as tubulature numbering and the number of times of sample multigelation before the transportation, experiment, cause dna degradation, further increased the difficulty of cotton high quality extracting genome DNA.
Round pcr can be implemented in and external target dna carried out amplifications up to a million time, therefore is to detect the most accurately one of method of genetically modified crops and products thereof at present.This technology is not very strict to the purity requirement of template DNA, and the amount that needs is not a lot of yet.The method that therefore, can find a kind of rapid extraction also can satisfy the cotton genomic dna of pcr amplification demand is the key that solves the large problem of positive strain testing amount in the transgene cotton breeding.
Summary of the invention
The object of the invention is, the cotton genomic dna that a kind of PCR of being applicable to is provided fast, batch preparation, the method is packed the young leaflet tablet at cotton plants top in the centrifuge tube, add extracting solution and steel ball, sample is carried out break process, then water-bath, add the extract extracting, use isopropanol precipitating DNA, wash one time with ethanol again, precipitate the water-soluble DNA that is extraction.The invention solves the problem that the cotton genomic dna extraction step is complicated, take time and effort, provide a kind of can be fast, extraction in batches satisfies the method that PCR detects the DNA of demand, adopt the method from cotton leaf, efficient, quick, easy extraction to satisfy the template DNA that PCR detects, can be applied to transgene cotton breeding and security and the molecular Biological Detection in the link such as declare.
Quick, the batch preparation of cotton genomic dna that is applicable to PCR of the present invention follows these steps to carry out:
A, get healthy cotton leaf 0.05-0.15g and put into the 2mL centrifuge tube, the extracting solution that adds 600 μ L is the mixture of NaCl, Tutofusin tris, sodium lauryl sulphate, polyvinylpolypyrrolidone, beta-mercaptoethanol and RNase A, and adds two steel balls;
B, the centrifuge tube that step a is equipped with sample are put into cell crushing instrument, and broken 5min processes in the frequency of 30HZ, and the centrifuge tube after processing is put into 65 ℃ of water-bath water-baths of temperature 10min;
C, take out centrifuge tube, at room temperature add 700 μ L chloroforms: the extract extracting of primary isoamyl alcohol once, the centrifugal 6min of 7000rpm,
D, suct clearly in new centrifuge tube, add isopyknic Virahol mixing, room temperature is placed 10min, and the centrifugal 6min of 12000rpm abandons supernatant, obtains DNA and slightly puies forward precipitation;
E, gained DNA is slightly put forward precipitation is 75% washing with alcohol with the 1mL volumetric concentration, and the centrifugal 3min of 12000rpm abandons supernatant liquor, obtains the DNA precipitation, adds the 60 μ L distilled water of sterilizing again, and temperature-20 a ℃ preservation gets final product.
Extracting solution described in the step a is NaCl 500mmol/L, Tutofusin tris 50mmol/L, and pH=8.0, sodium lauryl sulphate 2%, polyvinylpolypyrrolidone 6%, beta-mercaptoethanol 1% and final concentration are the mixture of the RNase A of 20 μ g/mL.
The particle diameter of steel ball is 4-6mm among the step a.
Cotton leaf among the step a drops into and to take back the laboratory the liquid nitrogen container and be stored in-80 ℃ of refrigerators for get the young leaflet tablet 2mL centrifuge tube of packing into from cotton plants top, land for growing field crops, or gets the young leaflet tablet 2mL centrifuge tube of packing into from the cotton plants of any indoor cultivation and drop into the liquid nitrogen and be stored in-80 ℃ of refrigerators.
Extract volume ratio chloroform: primary isoamyl alcohol=24:1 among the step c.
Quick, the batch preparation of cotton genomic dna that is applicable to PCR of the present invention, beta-mercaptoethanol belongs to volatile component in the extracting solution in the method, this composition can stop brownization of aldehydes matter, accounts for mixeding liquid volume than the consumption of 1%-3% so add according to the old young degree of blade before use.Ultimate principle of the present invention is: polyvinylpolypyrrolidone in the extracting solution (PVP) and beta-mercaptoethanol, can effectively remove polyphenol; Lipid and the albumen of sodium lauryl sulphate (SDS) on can the dissolved cell film, isolating nucleic acid and albumen; The chloroform extracting can be removed the materials such as most pigment, albumen, phenols, polysaccharide.The precipitation of DNA only adopts Virahol, and the ethanol of 60%-80% is adopted in the washing of DNA.Compare with the method for other DNA extraction, gained DNA of the present invention can also can directly use in temperature-20 ℃ prolonged preservation is for subsequent use.
Utilize the present invention all to obtain a large amount of DNA in the embodiment that extracts the total DNA of cotton gene group, the DNA color of extraction is that bright yellow is to light brown (according to the old young degree of blade).Detect through the foranalysis of nucleic acids instrument, all between 1.7-2.0, absorption curves all shows preferably peak value to OD260/280, and the DNA of extraction contains the pollution of slight albumen and impurity.Detect on agarose gel electrophoresis and show, the total DNA of cotton that the method is extracted has clear master tape, simultaneously carrying DNA is detected through PCR, all obtains amplified band clear, that size is correct; Illustrate that the DNA that the method is extracted can satisfy the requirement that PCR detects.
The method of the invention is compared with existing cotton DNA extracting method, has following advantage:
Fast, easy: the present invention utilizes the mechanical means smudge cells, and primary fragmentation 48 duplicate samples can be finished the fragmentation of 96 duplicate samples in the 15min.Compare with traditional CTAB, SDS method, step is simple, can finish the extraction of 96 duplicate samples in 2 hours, and a people can extract 400 duplicate samples in one day, and traditional method is finished the extraction of 96 duplicate samples generally all at 5-6 hour;
Cost is low: the present invention has reduced in the past loaded down with trivial details impurity elimination step in the cotton leaching process, has reduced the use kind of reagent, and only adopt extracting solution, chloroform: several reagent such as primary isoamyl alcohol, Virahol and ethanol just can be finished whole steps;
The DNA yield is high: it is 60-100 μ g DNA that the 0.05g cotton leaf adopts present method can obtain concentration, can do the template of 500-700 pcr amplification;
The DNA quality meets the demand that PCR detects: the cotton DNA that extracts take the method for the invention carries out pcr amplification as template, all obtains amplified band clear, that size is correct;
Material requested is few, scope of selecting material is wide: the present invention all is suitable for the top young leaflet tablet of cotton growth Seedling Stage, flowering period and knot bell phase in the cycle and the functional leaf at plant middle part, but Lao Ye and the old and feeble blade extraction effect bottom the plant that is in the growth later stage is not so good as the good of young leaflet tablet;
The method that the sampling of a kind of suitable land for growing field crops sample, transportation is provided and has stored: the young leaflet tablet of getting the cotton plants top 2mL centrifuge tube of packing into, drop into liquid nitrogen container and take back the laboratory, be stored in-80 ℃ of refrigerators.Directly take out centrifuge tube during detection and use, avoided dividing the multigelation of tubulature to material before in the past collection pack, transportation and the experiment;
The DNA that the method for the invention obtains is the same with the DNA that traditional method obtains, and uses also standing storage but can dilute short-term.
Description of drawings
Fig. 1 is the electrophorogram that extracts the total DNA of cotton gene group among the present invention, M wherein, DL2000DNA marker; Swimming lane 1-3 is DNA in the homogenate supernatant of contrast 1 gained; Swimming lane 4-6 is DNA in the contrast 2 gained extracts; Swimming lane 7-9 is gained DNA of the present invention; The DNA that swimming lane 10-12 extracts for contrast 3;
Fig. 2 is the DNA that extracts of the present invention and the DNA that extracted by contrast 3, measures the content balance figure that draws through the foranalysis of nucleic acids instrument, and wherein 1-5 is the measured value of 5 duplicate samples of random choose; 1 is gained nucleic acid content of the present invention, and 2 are contrast 3 gained nucleic acid contents;
Fig. 3 is that the present invention extracts the design sketch that the DNA that turns ScALDH gene cotton and acceptor strain implements behind pcr amplification, M wherein, DL2000 DNA marker; Swimming lane 1 is the plasmid positive control; The DNA that swimming lane 2-5 extracts for contrast 1 is the PCR result of template; The DNA that swimming lane 6-9 extracts for contrast 2 is the PCR result of template; Swimming lane 10-13 is that the DNA that the present invention extracts is the PCR result of template; The DNA that swimming lane 14-17 extracts for contrast 3 is the PCR result of template, and wherein 5,9,13,17 is the negative strain of acceptor transgenosis;
Fig. 4 is that the present invention extracts the design sketch that the DNA that turns EsDREB gene cotton and acceptor strain implements behind pcr amplification, M wherein, DL2000 DNA marker; Swimming lane 1 is the plasmid positive control; The DNA that swimming lane 2-5 extracts for contrast 1 is the PCR result of template; The DNA that swimming lane 6-9 extracts for contrast 2 is the PCR result of template; Swimming lane 10-13 is that the DNA that the present invention extracts is the PCR result of template; The DNA that swimming lane 14-17 extracts for contrast 3 is the PCR result of template, and wherein 5,9,13,17 is the negative strain of acceptor transgenosis;
Fig. 5 is that the present invention extracts the design sketch that the DNA that turns TcLEA gene cotton and acceptor strain implements behind pcr amplification, M wherein, DL2000 DNA marker; Swimming lane 1 is the plasmid positive control; The DNA that swimming lane 2-5 extracts for contrast 1 is the PCR result of template; The DNA that swimming lane 6-9 extracts for contrast 2 is the PCR result of template; Swimming lane 10-13 is that the DNA that the present invention extracts is the PCR result of template; The DNA that swimming lane 14-17 extracts for contrast 3 is the PCR result of template, and wherein 5,9,13,17 is the negative strain of acceptor transgenosis.
Embodiment
Embodiment 1(the method for the invention :)
The collection of sample: cotton leaf drops into and to take back the laboratory the liquid nitrogen container and be stored in-80 ℃ of refrigerators for get the young leaflet tablet 2mL centrifuge tube of packing into from cotton plants top, land for growing field crops, or from the material of the fresh collection of cotton of any indoor cultivation; Get this laboratory field planting of 0.05-0.15g and detect positive turn ScALDH gene (1450bp), EsDREB gene (750bp), TcLEA gene (310bp) cotton strain and contrast strain young leaflet tablet by kantlex and put into 2mL centrifuge tube (giving birth to worker's biotechnology (Shanghai) limited-liability company produces), drop into immediately and take back the laboratory in the liquid nitrogen container and be stored in temperature-80 ℃ refrigerator;
The extraction of transgene cotton genomic dna:
Get the healthy cotton leaf that stores and put into the 2mL centrifuge tube, the extracting solution that adds 600 μ L is NaCl 500mmol/L, Tutofusin tris 50mmol/L, pH=8.0, sodium lauryl sulphate 2% and polyvinylpolypyrrolidone 6%, beta-mercaptoethanol 1% and final concentration are the mixture of the RNase A of 20 μ g/mL, and adding two steel balls (cell crushing instrument carries), particle diameter is 4-6mm;
The centrifuge tube that sample is housed is put into cell crushing instrument, and broken 5min processes in the frequency of 30HZ, and the centrifuge tube after processing is put into 65 ℃ of water-bath water-baths of temperature 10min;
Take out centrifuge tube, at room temperature add 700 μ L volume ratio chloroforms: the extract extracting of primary isoamyl alcohol=24:1 once, the centrifugal 6min of 7000rpm;
Suct clearly in new centrifuge tube, add isopyknic Virahol mixing, room temperature is placed 10min, and the centrifugal 6min of 12000rpm abandons supernatant, obtains DNA and slightly puies forward precipitation, and is as far as possible soft when sucting clearly, do not touch egg white layer, avoids being drawn onto impurity;
It is 75% washing with alcohol with the 1mL volumetric concentration that gained DNA is slightly put forward precipitation, the centrifugal 3min of 12000rpm, and abandoning supernatant liquor must precipitate, be inverted centrifuge tube in the ventilation, dry, be attached to the DNA that is precipitated as of tube wall bottom, add 60 μ L sterilization distilled water, temperature-20 a ℃ preservation gets final product again;
The PCR that extracts DNA detects:
The DNA that embodiment 1 described method is extracted is template, with the positive contrast of positive plasmid, carries out pcr amplification reaction.The primer is respectively:
ScALDH (DL-f:5 ' CCATGACGGGGGAAGTGAAGGAGTATC3 ' and DL-r:5 ': CTAGGGACTCCCACGTTGCGCATG3 '), EsDREB (DL-f:5 ' TTC TTCCTC AAATGCCTTCTGG3 ' and
DL-r:5 ' ATGCAAAACTTACATCAAGACAATG3 ') TcLEA (DL-f:5 ' CAGAGAGAGAAAGAGAGAGCGG T3 ' and DL-r:5 ' CTTGTTCGCATTGCTGGTAGTCA3 ').Amplification system and reaction system are as follows:
Figure BDA00002528901100071
It is 20 μ L that adding ddH2O makes final volume, reaction conditions: 95 ℃ of temperature, time 5min; 94 ℃ of temperature, time 30s, 60/52/56 ℃ of temperature, time 45s, 72 ℃ of temperature, a time 1min(35 circulation); 72 ℃ of temperature, time 7min, 4 ℃ of coolings of temperature are got respectively amplified production 8 μ L and are carried out electrophoresis detection at 1% sepharose; Experimental result: extract three kinds of transgene cotton genome DNA precipitation colors with the method for the invention and be bright yellow; Detect through the foranalysis of nucleic acids instrument, OD260/280 is all between 1.7-2.0, the absorption curves peak value is good, DNA concentration is between 1000-2000ng/ μ L, the DNA that extracts is shown in the detection of 1% agarose gel electrophoresis: the total DNA of cotton that the method for the invention is extracted has clear master tape, have a small amount of RNA to pollute, electrophoresis result is seen accompanying drawing 1, the 7-9 swimming lane; The transgenic positive strain that utilizes simultaneously three kinds of the present invention to vary in size all amplifies the correct fragment of purpose size, and the acceptor strain is all without bands visible; Although amplified band not with test kit extract bright, but be enough to distinguish transgenosis and non-transgenic, illustrate that the DNA that the method for the invention is extracted can satisfy the requirement that transgene cotton PCR detects, the results are shown in Figure 3,10,11,12,13 swimming lanes of Fig. 4, Fig. 5.
Embodiment 2(and contrast of the present invention)
Identical among used sample and acquisition method and the embodiment 1 in the present embodiment;
Contrast method 1:
The extraction of transgene cotton genomic dna:
Get the 2mL centrifuge tube that cotton leaf is housed, adding 600 μ L extracting solutions in the centrifuge tube is that NaCl500mmol/L, Tutofusin tris (Tris-Cl) 50mmol/L, pH=8.0, sodium lauryl sulphate (SDS) 2%, polyvinylpolypyrrolidone (PVP) 6%, beta-mercaptoethanol 1% and final concentration are the RNase A of 50 μ g/mL, and adding two steel balls (cell crushing instrument carries), particle diameter is 4-6mm;
Centrifuge tube is put into mixing and grinding machine, in the broken 5min of the frequency of 30HZ, realize the fragmentation to blade, centrifuge tube after processing is put into 65 ℃ of water-bath water-baths of temperature 10min, the centrifugal 2min of 7000rpm gets 400 μ L supernatants and is transferred in the new centrifuge tube, puts temperature-20 ℃ preservation;
Adopt the PCR system identical with embodiment 1 and condition that the genomic dna of three kinds of transfer-gen plants of contrast method 1 extraction is increased.
Experimental result: it is impure more to extract three kinds of transgene cotton genome DNA with contrast method 1, the absorption peak of impurity affects detected result when detecting with the foranalysis of nucleic acids instrument, 260/280 between 1.25-1.5, the DNA that extracts is shown in the detection of 1% agarose gel electrophoresis: the total DNA of cotton that contrast method 1 extracts is without band, electrophoresis result is seen accompanying drawing 1, the 1-3 swimming lane; The result of pcr amplification be transgenic positive strain and acceptor strain all without the purpose band, electrophoresis result is seen 2,3,4,5 swimming lanes of Fig. 3, Fig. 4, Fig. 5.
Contrast method 2
The extraction of transgene cotton genomic dna:
Get the 2mL centrifuge tube that cotton leaf is housed, room temperature is placed 5min, adding 600 μ L extracting solutions in the centrifuge tube is that NaCl500mmol/L, Tutofusin tris (Tris-Cl) 50mmol/L, pH=8.0, sodium lauryl sulphate (SDS) 2%, polyvinylpolypyrrolidone (PVP) 6%, beta-mercaptoethanol 1% and final concentration are the RNase A of 50 μ g/mL, and adding two steel balls (cell crushing instrument carries), particle diameter is 4-6mm;
The centrifuge tube of gained is put into mixing and grinding machine, in the broken 5min of the frequency of 30HZ, realize the fragmentation to blade, the centrifuge tube after processing is put into 65 ℃ of water-bath water-baths of temperature 10min;
Take out centrifuge tube, at room temperature add 700 μ L volume ratio chloroforms: primary isoamyl alcohol (24:1) extract, concuss 1min, the centrifugal 6min of 7000rpm;
Inhale 400 μ L supernatants in new centrifuge tube, in temperature-20 ℃ preservation;
Adopt the PCR system identical with embodiment 1 and condition that the genomic dna of three kinds of transfer-gen plants contrasting the extraction of 2 methods is increased;
Experimental result: extract three kinds of transgene cotton genome DNA solution with contrast 2 methods and be rendered as brown, impure more, the foranalysis of nucleic acids instrument detects 260/280 between 1.5-1.7; The DNA that extracts is shown that in the detection of 1% agarose gel electrophoresis the total DNA of cotton that 2 methods that contrast are extracted is without clear master tape, and RNA pollutes more serious; Electrophoresis result is seen accompanying drawing Isosorbide-5-Nitrae-6 swimming lane; The result of pcr amplification be transgenic positive strain and acceptor strain all without visible purpose band, electrophoresis result is seen 6,7,8,9 swimming lanes of Fig. 3, Fig. 4, Fig. 5.
Contrast method 3
It is the cotton DNA extraction test kit extraction (Cat No:CW2088) in century that health is adopted in the extraction of transgene cotton genomic dna, and concrete grammar is referring to this test kit specification sheets;
Adopt the PCR system identical with embodiment 1 and condition that the genomic dna of three kinds of transfer-gen plants contrasting the extraction of 3 methods is increased;
Experimental result: extracting three kinds of transgene cottons with contrast 3 methods is oyster white based on the total DNA precipitation of group color; Detect through the foranalysis of nucleic acids instrument, all between 1.9-2.0, DNA concentration is at 300-900ng/ μ L for OD260/280; The DNA that extracts is shown that in the detection of 1% agarose gel electrophoresis the total DNA of cotton that 3 methods that contrast are extracted has clear master tape, have micro-RNA to pollute, electrophoresis result is seen accompanying drawing 1, the 10-12 swimming lane; The result of pcr amplification is that the transgenic positive strain has clearly, the better purpose master tape of brightness, and the acceptor strain is without amplified band; Electrophoresis result is seen 14,15,16,17 swimming lanes of Fig. 3, Fig. 4, Fig. 5.
The result that the DNA that the method for the invention and contrast 1,2 and 3 methods are extracted detects through the foranalysis of nucleic acids instrument:
Figure BDA00002528901100101
Be not difficult to find out from the data that the foranalysis of nucleic acids instrument draws, utilize DNA concentration that the present invention extracts all more than 1000ng/ μ L, although showing, OD260/280 has contaminating impurity, but the result from electrophoresis result and PCR detection, the DNA band that the method for the invention is extracted is the brightest, and the positive strain of pcr amplification also obtains the significantly correct purpose band of size, illustrates that present method can detect transgenosis and non-transgenic plant.
The comparison of the method for the invention and laboratory DNA extraction method commonly used:
Figure BDA00002528901100102
Figure BDA00002528901100111
The method of the extraction cotton DNA of the various improvement that the present invention and laboratory is commonly used is compared, and the fast and convenient advantage of the method for the invention just seems particularly outstanding; The present invention utilizes the mechanical means smudge cells, reduced in the past loaded down with trivial details step in the cotton leaching process, the program of tubulature when the method for sampling that settles at one go has simultaneously reduced batch experiment, numbering, minority but the selection of committed step makes the DNA of acquisition can satisfy the requirement of PCR; Utilizing the method for the invention one people can extract 400 duplicate samples in one day, is existing usefulness method 6-10 workload doubly; Just can obtain concentration with 0.05g cotton leaf of the present invention is 60-100 μ g DNA, can do the template of 500-700 pcr amplification after the dilution, this explanation the present invention a kind of method of extracting fast, reliably cotton genomic dna of can yet be regarded as.

Claims (5)

  1. A cotton genomic dna that is applicable to PCR fast, batch preparation, it is characterized in that following these steps to carrying out:
    A, get healthy cotton leaf 0.05-0.15g and put into the 2mL centrifuge tube, the extracting solution that adds 600 μ L is the mixture of NaCl, Tutofusin tris, sodium lauryl sulphate, polyvinylpolypyrrolidone, beta-mercaptoethanol and RNase A, and adds two steel balls;
    B, the centrifuge tube that step a is equipped with sample are put into cell crushing instrument, and broken 5min processes in the frequency of 30HZ, and the centrifuge tube after processing is put into 65 ℃ of water-bath water-baths of temperature 10min;
    C, take out centrifuge tube, at room temperature add 700 μ L chloroforms: the extract extracting of primary isoamyl alcohol once, the centrifugal 6min of 7000rpm,
    D, suct clearly in new centrifuge tube, add isopyknic Virahol mixing, room temperature is placed 10min, and the centrifugal 6min of 12000rpm abandons supernatant, obtains DNA and slightly puies forward precipitation;
    E, gained DNA is slightly put forward precipitation is 75% washing with alcohol with the 1mL volumetric concentration, and the centrifugal 3min of 12000rpm abandons supernatant liquor, obtains the DNA precipitation, adds the 60 μ L distilled water of sterilizing again, and temperature-20 a ℃ preservation gets final product.
  2. 2. method according to claim 1, it is characterized in that the extracting solution described in the step a is NaCl 500mmol/L, Tutofusin tris 50mmol/L, pH=8.0, sodium lauryl sulphate 2%, polyvinylpolypyrrolidone 6%, beta-mercaptoethanol 1% and final concentration are the mixture of the RNase A of 20 μ g/mL.
  3. 3. method according to claim 1, the particle diameter that it is characterized in that steel ball among the step a is 4-6mm.
  4. 4. method according to claim 1, it is characterized in that the cotton leaf among the step a drops into and to take back the laboratory the liquid nitrogen container and be stored in-80 ℃ of refrigerators for get the young leaflet tablet 2mL centrifuge tube of packing into from cotton plants top, land for growing field crops, or get the young leaflet tablet 2mL centrifuge tube of packing into from the cotton plants of any indoor cultivation and drop into the liquid nitrogen and be stored in-80 ℃ of refrigerators.
  5. 5. method according to claim 1 is characterized in that extract volume ratio chloroform: primary isoamyl alcohol=24:1 among the step c.
CN2012105148275A 2012-12-05 2012-12-05 Quick batch preparation method of cotton genome DNA (deoxyribonucleic acid) suitable for PCR (polymerase chain reaction) Pending CN102925430A (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
CN2012105148275A CN102925430A (en) 2012-12-05 2012-12-05 Quick batch preparation method of cotton genome DNA (deoxyribonucleic acid) suitable for PCR (polymerase chain reaction)

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CN2012105148275A CN102925430A (en) 2012-12-05 2012-12-05 Quick batch preparation method of cotton genome DNA (deoxyribonucleic acid) suitable for PCR (polymerase chain reaction)

Publications (1)

Publication Number Publication Date
CN102925430A true CN102925430A (en) 2013-02-13

Family

ID=47640361

Family Applications (1)

Application Number Title Priority Date Filing Date
CN2012105148275A Pending CN102925430A (en) 2012-12-05 2012-12-05 Quick batch preparation method of cotton genome DNA (deoxyribonucleic acid) suitable for PCR (polymerase chain reaction)

Country Status (1)

Country Link
CN (1) CN102925430A (en)

Cited By (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN103305501A (en) * 2013-06-03 2013-09-18 合肥丰乐种业股份有限公司 Quick batch extraction method for cotton DNA (Deoxyribonucleic Acid) suitable for PCR (Polymerase Chain Reaction)
CN104371998A (en) * 2014-11-25 2015-02-25 福建省农业科学院甘蔗研究所 DNA extracting method for bitter gourd hybrid purity molecular identification
CN104694530A (en) * 2015-03-10 2015-06-10 西北农林科技大学 Extraction method of wheat genome DNA

Non-Patent Citations (3)

* Cited by examiner, † Cited by third party
Title
傅焕延等: "《遗传学实验》", 31 March 1987 *
孙志栋等: "棉花DNA 提取方法的探讨", 《浙江农业学报》 *
李宏等: "植物组织RNA提取的难点及对策", 《生物技术通报》 *

Cited By (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN103305501A (en) * 2013-06-03 2013-09-18 合肥丰乐种业股份有限公司 Quick batch extraction method for cotton DNA (Deoxyribonucleic Acid) suitable for PCR (Polymerase Chain Reaction)
CN104371998A (en) * 2014-11-25 2015-02-25 福建省农业科学院甘蔗研究所 DNA extracting method for bitter gourd hybrid purity molecular identification
CN104694530A (en) * 2015-03-10 2015-06-10 西北农林科技大学 Extraction method of wheat genome DNA

Similar Documents

Publication Publication Date Title
CN105154550B (en) A kind of method using 1217 purity of EST-SSR molecular labeling Rapid identification variety of watermelon treasure sweet tea
CN102643896B (en) Kit for identifying authenticity of medicago sativa seed and detection method thereof
CN101586102B (en) Genomic DNA extraction method of peanut leaf blades
CN104711361A (en) Method for quickly identifying purity of new watermelon species namely red peace hybrid seeds as well as primer and kit adopted by method
Ibeas et al. Dynamic subcellular localization of iron during embryo development in Brassicaceae seeds
CN108220475A (en) Cherry ash arrhizus bacteria detection method and detection primer special based on RPA technologies
CN107119048B (en) Pseudocercospora mori rDNA and application thereof in molecular detection of pseudocercospora mori
CN102925430A (en) Quick batch preparation method of cotton genome DNA (deoxyribonucleic acid) suitable for PCR (polymerase chain reaction)
CN102899321A (en) Method for selecting specific SRAP marking tapes for coilia ectenes genders and gender determination method
CN105803094B (en) A kind of SCAR mark and its application identified or assist identification potato maturity
CN102732508B (en) Method for extracting genome DNA (deoxyribonucleic acid) from peanuts
CN102912017B (en) Method for quickly and accurately identifying northern snakehead, Taiwan snakehead and hybrid snakehead
CN106978504A (en) A kind of preparation method and application of spinach SSR marker
CN106591145A (en) Plectosphaerella sp. EF01 separated from root tuber of radix tetrastigme and application of Plectosphaerella sp. EF01
CN101899435A (en) High-throughput extraction method for sugarcane leaf genome by using ball mill
CN104164419A (en) Dioscorea alata lirm.sp tissue RNA extraction method
CN103866038B (en) For detecting tobacco to the N gene-specific primer of TMV resistance to, detection method and test kit
CN104694530A (en) Extraction method of wheat genome DNA
CN104911262B (en) A kind of dalbergia odorifera tar spot bacterium molecule detection primer and quick determination method
CN104911207B (en) The method and special plasmid for the genetically modified plants that a kind of cultivation isoflavones and condensed tannin content increase
CN105296470A (en) Kit for extracting high-purity DNA of colla corii asini and derivative products of colla corii asini, as well as extraction method
CN104032003B (en) A kind of method of detection by quantitative ustilaginoidea virens from kind of biography and native medium are situated between
CN104195223B (en) A kind of method for the identification of resistance to iron deficiency apple rootstock
CN102559923B (en) Method of quickly identifying category of pathogenic bacteria of fungal diseases in chrysanthemum
CN102081075B (en) Method for identifying genetically modified rice and non-genetically modified rice

Legal Events

Date Code Title Description
C06 Publication
PB01 Publication
C10 Entry into substantive examination
SE01 Entry into force of request for substantive examination
C02 Deemed withdrawal of patent application after publication (patent law 2001)
WD01 Invention patent application deemed withdrawn after publication

Application publication date: 20130213