CN104694530A - Extraction method of wheat genome DNA - Google Patents

Abstract

The invention discloses an extraction method of a wheat genome DNA. The method comprises the following steps: putting wheat material samples to be extracted into 96-well plates respectively; then putting steel balls into each hole; uncovering and putting into a vacuum freezing dryer to be subjected to freeze drying for 20-28 hours at the temperature of -100-(-120) DEG C; grinding the wheat material samples by using a grinding instrument; finally, extracting DNA from the grinded powder samples by using a discharge gun in an improved SDS method. According to the extraction method, wheat tissue vanes are pulverized by using the grinding instrument after vacuum freeze drying is carried out; compared with a traditional liquid nitrogen grinding method, the extraction method has the advantages that the labor force is greatly released, and the working efficiency is improved; meanwhile, by using 96-well plates and the discharge gun, the sample extraction efficiency is greatly improved. The extraction method of the wheat genome DNA is convenient, fast, high in flux and high in quality.

Description

A kind of Wheat volatiles DNA extraction method

Technical field

The present invention relates to a kind of plant genome DNA extracting method, be specifically related to a kind of Wheat volatiles DNA extraction method.

Background technology

Along with molecular biology constantly develops, the sample requirement amount of numerous molecular biology experiment is all very large, and the DNA extraction technology of simple and efficient efficient stable is the prerequisite advancing wheat correlative study to develop from molecular level, is also the key of Efficiency.The DNA extraction of Wheat volatiles generally must through several steps such as fracturing cell walls, lysing cell film, secondary substance such as removing polysaccharide and polyphenol etc., sex change isolated protein, precipitate nucleic acids, removal RNA and concentration of DNA.In general, CTAB (cetyltriethylammonium bromide) method has unique advantage to the plant tissue that process contains polysaccharide component, be widely used in the extraction of plant genome DNA, and SDS (sodium lauryl sulphate) method is applied less in the extraction of plant genome DNA, the RAPD be mainly used in template DNA specification of quality is not too tight analyzes.But traditional CTAB method complex operation, reagent consumption is large, and uses vessel many, and grinding vessel etc. need recycling, and easily cause sample contamination, productive rate is also lower.

At present, the report overwhelming majority about Method of Plant DNA Extraction is all improve in SDS method and CTAB method basis, but all cannot break away from the operation steps of grinding one by one sample with grinding rod or glass stick, and extraction step is loaded down with trivial details consuming time.Also there is other simple and easy extracting method of DNA of plants in recent years, as high salt, alkaline purification method, high-temperature water cooking method etc., although these method stepss are simple, speed is fast, cost is low, avoid using the reagent such as liquid nitrogen, phenol, but often also exist DNA extraction second-rate, 300 increment product within one day, can be extracted about, can not meet the demands the problems such as higher pcr amplification.Therefore, in the urgent need to setting up a high-quality DNA extraction method of fast, economical high-throughput, for the different kinds of molecules experiments such as pcr amplification, molecular mark, the assignment of genes gene mapping and transgenic plant detection provide effective means.

Summary of the invention

Technical problem to be solved by this invention is, provides a kind of easy, quick, high-throughput, high-quality Wheat volatiles DNA extraction method.

The technical scheme that the present invention solves the employing of its technical problem is, a kind of Wheat volatiles DNA extraction method, wheat lines sample to be extracted is placed in 96 orifice plates respectively, then in every hole, steel ball is put into, uncap and be placed in vacuum freeze drying at-100 ~-120 DEG C of lyophilize 20 ~ 28h, then utilize beveller to grind wheat lines sample; The SDS method of improvement is finally adopted to utilize the volley of rifle fire to extract DNA from the powder after grinding.

Further, described wheat lines is that wheat seed sowing is germinateed, the fresh true leaf after rough leaf expansion; The consumption of described every hole wheat lines sample to be extracted is 50 ~ 100mg.

Further, the length of described fresh true leaf is 4 ~ 6cm.

Further, described 96 orifice plates are the 96 conjuncted test tube plates in hole, use the 96 conjuncted test tube plates in hole, instead of single centrifuge tube, pulverize, without the need to using liquid nitrogen to blade after carrying out lyophilize.

Further, the steel ball of 1 raw spirit cleaning is put in every hole, puts into a steel ball and ensure that each sample grinds separately when avoiding additive method grinding and occur that lapping apparatus reuses the possibility causing crossed contamination in each small test tube.

Further, the described SDS method of improvement that adopts utilizes the volley of rifle fire from the powder after grinding, extract the method for DNA, comprises the following steps:

(1) by grinding after powdered sample at 2 ~ 6 DEG C, 4000rpm, after centrifugal 10min, the volley of rifle fire is utilized to add SDS extracting solution in pipe, after homogeneity, the mixed solution adding equal-volume phenol, chloroform and primary isoamyl alcohol shakes up, wherein phenol: chloroform: the volume ratio of primary isoamyl alcohol is 25: 24: 1, after-20 DEG C of refrigerator freezing 10min, then in 4 DEG C of environment, leave standstill 10min;

(2) sample weighing trim is taken out, at 2 ~ 6 DEG C, 4000rpm, centrifugal 20 ~ 25min, slowly Aspirate supernatant is in 96 orifice plates from top to down to utilize the volley of rifle fire, and to add in 96 orifice plates with supernatant volume ratio be the Virahol of the NaAc of 1: 10 and-20 DEG C of precoolings of 1: 1, covers 96 port lids mixings, put into-20 DEG C of freezing 30 ~ 50min of refrigerator-freezer, until DNA separates out;

(3) sample of freezing mistake is taken out weighing trim at 2 ~ 6 DEG C, 4000rpm, after centrifugal 10min, open 96 port lid, rapid upset 96 orifice plate topples over the whole liquid in pipe, 96 orifice plates to be upside down on dry thieving paper moisture absorption 2 ~ 3 times, by 96 orifice plate upsets upward, the ethanol wash adding with supernatant liquor isopyknic 75% precipitates once, at 2 ~ 6 DEG C, 4000rpm, centrifugal 5min, topple over rapidly whole scavenging solution, 96 orifice plates to be upside down on dry thieving paper moisture absorption 2 ~ 3 times, by 96 orifice plate upsets upward, add isopyknic absolute ethanol washing with supernatant liquor to precipitate once, at 2 ~ 6 DEG C, 4000rpm, centrifugal 5min, topple over rapidly whole scavenging solution, 96 orifice plates to be upside down on dry thieving paper moisture absorption 2 ~ 3 times, by 96 orifice plate upsets upward, at Bechtop inner drying 2 ~ 3h, add isopyknic TE or ddH with supernatant liquor ₂o.

The present invention is by pulverizing organizing blade with beveller after vacuum lyophilization, and within 1 minute, energy simultaneous grinding goes out 192 samples, compared with traditional liquid nitrogen grinding, has greatly liberated manpower and has improve working efficiency.Simultaneously refrigerated centrifuge once can centrifugal 4 × 96 i.e. 384 samples, by using 96 orifice plates and the volley of rifle fire, application of sample extraction efficiency is improved greatly, simultaneously, simplify the step that SDS method extracts DNA, only need add extracting solution extracting supernatant, all the other steps are washing impurity-removing, and one takes turns the DNA namely completing 384 samples prepares general 2 hours; Carry sample DNA completely can for 100 PCR's according to its concentration.Experiment proves, carries out DNA extraction can obtain the good DNA of quality equally at the blade of wheat during jointing stage sampling, also can meet SSR, STS, SCAR equimolecular mark and carry out pcr amplification detection, and successfully by about 10000 F ₂carry out molecular marker screening for plant, 2000 transfer-gen plants have been detected.

Accompanying drawing explanation

Fig. 1 is that agarose electrophoresis detects genomic dna.

Fig. 2 is the electrophorogram that WMC419 is marked in parent and progeny population.

Fig. 3 is the electrophorogram that GWM11 is marked in parent and progeny population.

Fig. 4 is the electrophorogram that WE173 is marked in parent and progeny population.

Fig. 5 is the PCR result of Regenerated Plantlets of Wheat Bar gene.Wherein, 3M:Marker; 1: positive control; 2: wild-type; 3 ~ 23: negative plant; It is positive plant in yellow box.

Fig. 6 is Regenerated Plantlets of Wheat carrier sequence (containing Bar and LTP) PCR result.Wherein, M:Marker; 1: positive control; 2: wild-type; 3 ~ 22: positive plant.

Fig. 7 is Regenerated Plantlets of Wheat carrier sequence NW-22PCR result.Wherein, M:Marker; 1: wild-type; 2: positive control; 3 ~ 17: negative plant; It is positive plant in yellow box.

Embodiment

Below in conjunction with embodiment, the present invention is illustrated further.

1, experiment material: the F2 of wheat susceptible variety Avocet S and carrier kind 92R137 and both hybridization is for colony (about 10000 strains); The western agriculture 1376 of wheat transgenic material and Paragonimus microrchis (about 2000 strains)

2, key instrument equipment and consumptive material: lyophilizer (CoolSafe TM 110-4L, Denmark), beveller (QIAGEN), stink cupboard, whizzer (eppendorf 5810R), UV detector NanoDrop ND2000/2000C (Thermo SCIENTIFIC), electrophoresis apparatus (Beijing 61 DYY-6), gel imaging system (Bio-rad Gel Doc), the 96 conjuncted test tube cases in hole (the emerging test apparatus instrument factory of Wuhan instrument), 96 hole PCR plate, the volley of rifle fire, steel ball etc.

3, reagent: SDS extracting solution (DS buffer) is filled a prescription: 0.1mol/L Tris-HCl (pH8.0), 10mmol/L EDTA (pH 8.0), 2% SDS (pH8.0); 3mol/L NaAC (PH5.2); Phenol: chloroform: primary isoamyl alcohol (25: 24: 1); Virahol; Ethanol (70% and 95%); 1 × TE damping fluid (10mmol/L Tris-HCl, 1mmol/LEDTA, pH8.0); Agarose (0.8%, 1.5%); Acrylamide gel (8%); Ethidium bromide; Silver Nitrate.

Embodiment 1

1, DNA extraction

(1) two F2 are germinateed for the planting seed of colony, treat young plant height 5cm, after general needs 5 ~ 7 days rough leafs are launched, get wheat spire about 5cm (dry weight is about 50mg), be divided into several sections, put into eight platoon pipes (each test tube capacity is 1ml) according to corresponding order, each 96 hole test tube cases are equipped with 12 row eight connecting legs.

(2) after sampling, putting into the cleaned steel ball (diameter 4mm) of 1 prior raw spirit with putting pearl device at each test tube, then sample being uncapped and placing in vacuum freeze drying ,-110 DEG C of dry 24h.

(3) take out test tube case, rapid lid upper tube cap and grind away lid, be fixed on test tube case on beveller, notes maintenance two lateral balance, grind, general 25 ~ 30 times/second, about 1 minute, show sample and determine.

(4) sample of milled need be carried out 4 DEG C, 4000rpm, centrifugal 10min, fall at the bottom of pipe to pulverized specimen, then be positioned in-20 DEG C of refrigerators and preserve DNA to be extracted.

(5) sample centrifugal after open pipe lid, the 300ul volley of rifle fire is utilized to add 220uL DSbuffer in pipe, after homogeneity, add the mixed solution of equal-volume (220uL) phenol, chloroform and primary isoamyl alcohol, wherein phenol: chloroform: the volume ratio of primary isoamyl alcohol is 25: 24: 1.

(6) corresponding cover lid, after firmly shaking up, oscillation action should not be too violent, otherwise may cause DNA break, at-20 DEG C of refrigerator freezings after 10 minutes, then leaves standstill 10 minutes in 4 DEG C of environment.

(7) take out sample and weigh trim, 4 DEG C, 4000rpm, centrifugal 20 ~ 25min.

(8) supernatant 100ul is slowly drawn from top to down in 96 orifice plates (band cap) with the volley of rifle fire, note the lower floor's liquid not being drawn onto separating layer, 10ul NaAc is added in advance in plate, add the Virahol of equal-volume (100ul)-20 DEG C of precoolings, cover 96 port lid, softly turn upside down, fully after mixing, put into-20 DEG C of freezing more than 30min of refrigerator-freezer, until DNA precipitating out.

(9) whizzer is put into after the sample of freezing mistake being taken out weighing trim, 4 DEG C, 4000rpm, after centrifugal 10min, carefully open 96 port lid, rapidly upset 96 orifice plates, topple over the whole liquid in pipe, 96 orifice plates to be carefully upside down on dry thieving paper moisture absorption 2 ~ 3 times, to suck unnecessary liquid, to notice that this process need be swift in motion.

(10) by 96 orifice plate upsets upward, add the alcohol of 100uL 75%, cover lid, put upside down gently for several times, 4 DEG C, 4000rpm, centrifugal 5min, topple over rapidly whole scavenging solution, and operation is with (9).

(11) abandon supernatant, add 100uL absolute ethanol washing precipitation once, 4 DEG C, 4000rpm, centrifugal 5min, all the other operations are with (9).

(12) supernatant is abandoned, the about 2 ~ 3h of Bechtop inner drying, to remove liquid unnecessary in test tube.Add 100uLTE or ddH2O.

(13) after DNA precipitation is fully dissolved, by UV spectrophotometer measuring DNA concentration, and DNA quality is detected with agarose gel electrophoresis.

2, DNA sample quality examination

(1) the ultraviolet spectro-photometric analysis method of DNA: detect the light absorption value of DNA profiling at 230nm, 260nm and 280nm place.Get 1.5 μ l DNA sample, make blank with TE or ddH2O, suppressed zero, read 260nm/230nm, 260nm/280nm value of nucleic acid solution.DNA purity is weighed by A260/A280 or A260/A230, and the ratio of the DNA A260/A280 that purity is good between 1.8 ~ 2.0, if ratio is lower than 1.8, should represents the impact that there is protein or aldehydes matter, be greater than 2.0 and show have RNA to pollute.A230 represents in sample to there are some pollutents, and as carbohydrate, salt (guanidinesalt) etc., the ratio of the DNAA260/A230 that purity is good should be greater than 2.0.This test extracting method is adopted to obtain the mean concns 500ng/ μ L of DNA, A260/A280 value average out to 2.05, A230/A260 value average out to 2.12.DNA extraction quality purity is better as can be seen here.Wherein F ₂colony's randomly drawing sample detection limit is 1000, and transfer-gen plant randomly drawing sample detection limit is 300.

(2) agarose electrophoresis detects: the DNA sample of diluting 10 times with 0.8% sepharose, the integrity of 90V, electrophoresis detection DNA.As seen from Figure 1, the genomic dna band of extraction is clear and complete, and band is brighter and do not have disperse in swimming lane, is tested by the DNA deposited after 3 months, does not have notable difference, show that DNA is without signs of degradation with result before.

As fully visible, the Wheat volatiles DNA quality purity that the present embodiment extracts is better, there is no signs of degradation.

3, pcr amplification detects: for F ₂mass screening exchanges individual plant test, and adopt 3 marks chain with gene resistant to stripe rust Yr26 to carry out gene test, wherein WMC419 and GWM11 is SSR marker, and WE173 is STS mark; The primer of each molecule marker is synthesized by Shanghai Sangon Biological Engineering Technology And Service Co., Ltd, GWM11 marks a pair positive and negative primer sequence: GGATAGTCAGACAATTCTTGTG, as shown in SED ID NO:1, GTGAATTGTGTCTTGTATGCTTCC, as shown in SED ID NO:2; WMC419 marks a pair positive and negative primer sequence: GTTTCGGATAAAACCGGAGTGC, and as shown in SED ID NO:3, ACTACTTGTGGGTTATCACCAGCC, as shown in SED ID NO:4; WE173 marks a pair positive and negative primer sequence: GGGACAAGGGGAGTTGAAGC, and as shown in SED ID NO:5, GAGAGTTCCAAGCAGAACAC, as shown in SED ID NO:6, refers to table 1; With these the 3 couples of primer pair F chosen ₂colony's DNA sample carries out pcr amplification respectively, and (PCR reaction system, in table 2; PCR program and electrophoresis detection, in table 3), and detect PCR primer, with the DNA quality of Detection and Extraction with 8% polyacrylamide gel and 1.5% sepharose.WMC419 and GWM11 is the SSR marker being positioned at gene resistant to stripe rust Yr26 both sides, when increasing to F2 colony with primer WMC419, the susceptible individual plant of major part and Susceptible parent amplify the banding pattern of a 150bp, and most of disease-resistant individual plant (containing Yr26) and disease-resistant parent amplify the banding pattern of a 140bp or 140 and 150bp parents, see Fig. 2; When increasing to F2 colony with primer GWM11, the susceptible individual plant of major part and Susceptible parent (not containing Yr26) amplify the banding pattern of 150bp and 203bp, and most of disease-resistant individual plant and disease-resistant parent (containing Yr26) amplify 140bp and 193bp or 140,150,193, parents' banding pattern that 203bp occurs, is shown in Fig. 3.WE173 is that closely linked EST-STS marks with Yr26, the susceptible individual plant of major part and Susceptible parent amplify the banding pattern of a 750bp, and most of disease-resistant individual plant and disease-resistant parent (containing Yr26) amplify one 475 or 475 and the banding pattern of 750bp parents, see Fig. 4.Utilize in embodiment 1 and extract DNA method for colony, DNA extraction has been carried out to the F2 of AvS and 92R137, offspring DNA is used for pcr amplification and obtains corresponding object fragment (Fig. 2), and successfully can carry out the screening of about 10000 F2 individual plants.For Transgenic studies, Bar, Bar+LTP, NW-22 SCAR mark special is separately utilized to detect corresponding transgene gene plant (T4) respectively, the positive plant wherein containing Bar gene can amplify the fragment of a 435bp size, sees Fig. 5; Positive plant containing Bar+LTP can amplify the fragment of a 1037bp size, sees Fig. 6; Positive plant containing NW-22 can amplify the fragment of a 718bp size, sees Fig. 7.Utilize the method extracting DNA in embodiment 1 can be successfully completed the detection of 2000 T4 for transfer-gen plant.

Experiment shows, according to the method operation in embodiment 1, can extract the DNA of thousands of samples for each person every day.

The molecule marker of the genes involved reported in table 1 document

"+" represents positive, and "-" represents negative

Table 2 PCR reaction system

Table 3 PCR program and electrophoresis detection

Claims (6)

1. a Wheat volatiles DNA extraction method, it is characterized in that, wheat lines sample to be extracted is placed in 96 orifice plates respectively, then in every hole, steel ball is put into, uncap and be placed in vacuum freeze drying at-100 ~-120 DEG C of lyophilize 20 ~ 28h, then utilize beveller to grind wheat lines sample; Finally adopt improvement SDS method utilize the volley of rifle fire from after grinding powdered sample extract DNA.

2. Wheat volatiles DNA extraction method according to claim 1, is characterized in that, described wheat lines is that wheat seed sowing is germinateed, the fresh true leaf after rough leaf expansion; The consumption of described every hole wheat lines sample to be extracted is 50mg ~ 150mg.

3. Wheat volatiles DNA extraction method according to claim 2, is characterized in that, the length of described fresh true leaf is 4 ~ 6cm.

4. Wheat volatiles DNA extraction method according to claim 1, is characterized in that, described 96 orifice plates are the 96 conjuncted test tube plates in hole.

5. Wheat volatiles DNA extraction method according to claim 1, is characterized in that, the cleaned steel ball of 1 raw spirit is put in every hole.

6. according to the Wheat volatiles DNA extraction method one of Claims 1 to 5 Suo Shu, it is characterized in that, the described SDS method of improvement that adopts utilizes the volley of rifle fire from the powder after grinding, extract the method for DNA, comprises the following steps:

(1) by grinding after powdered sample at 2 ~ 6 DEG C, 4000rpm, after centrifugal 10min, the volley of rifle fire is utilized to add SDS extracting solution in pipe, after homogeneity, the mixed solution adding equal-volume phenol, chloroform and primary isoamyl alcohol shakes up, wherein phenol: chloroform: the volume ratio of primary isoamyl alcohol is 25: 24: 1, after-20 DEG C of refrigerator freezing 10min, then in 4 DEG C of environment, leave standstill 10min;

(2) sample weighing trim is taken out, at 2 ~ 6 DEG C, 4000rpm, centrifugal 20 ~ 25min, slowly Aspirate supernatant is in 96 orifice plates from top to down to utilize the volley of rifle fire, and to add in 96 orifice plates with supernatant volume ratio be the Virahol of the NaAc of 1: 10 and-20 DEG C of precoolings of 1: 1, covers 96 port lids mixings, put into-20 DEG C of freezing 30 ~ 50min of refrigerator-freezer, until DNA separates out;

(3) sample of freezing mistake is taken out weighing trim at 2 ~ 6 DEG C, 4000rpm, after centrifugal 10min, open 96 port lid, rapid upset 96 orifice plate topples over the whole liquid in pipe, 96 orifice plates to be upside down on dry thieving paper moisture absorption 2 ~ 3 times, by 96 orifice plate upsets upward, the ethanol wash adding with supernatant liquor isopyknic 75% precipitates once, at 2 ~ 6 DEG C, 4000rpm, centrifugal 5min, topple over rapidly whole scavenging solution, 96 orifice plates to be upside down on dry thieving paper moisture absorption 2 ~ 3 times, by 96 orifice plate upsets upward, add isopyknic absolute ethanol washing with supernatant liquor to precipitate once, at 2 ~ 6 DEG C, 4000rpm, centrifugal 5min, topple over rapidly whole scavenging solution, 96 orifice plates to be upside down on dry thieving paper moisture absorption 2 ~ 3 times, by 96 orifice plate upsets upward, at Bechtop inner drying 2 ~ 3h, add isopyknic TE or ddH with supernatant liquor ₂o.