CN106148338B - Na+/ Pi cotransporter promoter and terminator and its application - Google Patents

Abstract

The present invention is by expanding circle rhodosporidium toruloides Na⁺/ Pi cotransporter genomic DNA upstream and downstream sequence, carry out biological information analysis and functional verification, acquisition can be widely used for Rhodosporidium in rhodotorula (Rhodosoporidium), lock throws saccharomyces (Sporidiobolus), gene expression in Sporobolomyces (Sporobolomyces) and Rhodotorula (Rhodotorula), genetic engineering procedure and strain improvement promoter and terminator, nucleotide sequence is respectively SEQ ID NO:1 and SEQ ID NO:2.The invention further relates to DNA expression cassettes or recombinant vector containing these elements, and construct Rhodosporidium using related elements, lock the method for throwing saccharomyces and Rhodotorula engineering strain and corresponding bacterial strain.

Description

Na+/ Pi cotransporter promoter and terminator and its application

Technical field

The invention belongs to gene engineering technology fields, and in particular to circle rhodosporidium toruloides (Rhodosporidium Toruloides promoter terminator) and application thereof, including method for transformation necessary to construction method of gene engineering strain etc..

Background technique

Microorganism is that one of widest species are distributed in nature, has brilliant biosynthesis ability, can almost close At organic chemicals all on the earth.Compared with multicellular organism, the metabolic pathway of microorganism is although relatively easy, but it is changed The production for closing object efficiently, fast, has the characteristics that reaction condition is mild, controllability is strong, is easy to be mass produced, can be used as one Excellent cell factory.

A part of microorganism can be more than under given conditions (such as nitrogen source shortage) that its cell is dry in storage intracellular in nature 20% grease is weighed, wherein based on triglycerides, the microorganism with this phenotype is known as oleaginous microorganism, including bacterium, Yeast, mould, algae etc. (Ratledge, C.and Wynn, J.P.Adv Appl Microbiol, 2002,51,1-51.).Benefit With microorganism conversion biomass resource produce grease, can develop into do not depend on substantially arable land, can continuous production, reduce agricultural dirt Dye, the new technology of comprehensive utilization of resources are to form the new production ways of fossil resources substitute of chemicals (Zhao Zong protects China Bioengineering magazine, 2005,25,8-11.).As the natural production bacterial strain or environmental improvement application bacterial strain of a certain chemicals, Its specific production performance is often and non-optimized.How to optimize or change the metabolism network and expression regulation net of industrial strain Network is current field of biotechnology gene work to improve the accumulating rate of biobased products or the quality of oriented control target product The hot and difficult issue of journey transformation.Although for some conventional yeasts genetic engineering transformation have been relatively mature (Alper H, Stephanopoulos G.Nat Rev Microbiol, 2009,7,715-723.), but for these unconventional oil-producing ferment Still in its infancy, many unconventional oleaginous yeasts do not have suitable genetic manipulation platform to female genetic manipulation.Exploitation is suitable Genetic manipulation method, it is great for the application value of these unconventional microorganisms.

Circle rhodosporidium toruloides belong to Basidiomycota heterothallism type fungi, are a kind of particularly important micro- lifes in fermentation industry Object is that raw material produces important biobased products: microbial oil, grease intracellular using the hexose and pentose that are derived from biomass Up to 60% or more (Ratledge C, Wynn J P.Adv.Appl. Microbiol.2002,51:1-51 of dry cell weight； Li Y,Zhao Z,Bai F.Enzyme Microb.Technol.2007,41(3): 312-317)；Industrial enzymes or drug close At with enzyme such as phosphodiesterase, phenylalanine lyase (Hodgins D S.J Biol.Chem.1971,246 (9): 2977- 2985；Gilbert HJ,Clarke I N,Gibson R K,et al.J Bacteriol.1985,161(1):314-320), D amino acid oxidase (Gadda G, Negri A, Pilone M S.J Biol.Chem.1994,269 (27): 17809- 17814；Liao G J,Lee Y J,Lee Y H,et al. Biotechnol.Appl.Biochem.1998,27(Pt1): 55-61) etc. and beta carotene and exocellular polysaccharide；And there is wide application in sewage treatment and bio-pharmaceuticals.Experiment knot Fruit shows that the bacterium can be simultaneously substrate using pentose and hexose, and good stress resistance can directly be with corn stover acid hydrolysis liquid Carbon source accumulates grease, and, it can be achieved that biomass is to the Efficient Conversions of biobased products, (Li Yonghong, Liu Bo, Sun Yan wait Chinese biological Engineering magazine, 2005,25 (12): 39-44).The research of R.toruloides functional gene at present mainly passes through gene cloning, different Source expression carries out (Gilbert H J, Clarke I N, Gibson R K, et al.J with saccharomyces cerevisiae function reasonableness Bacteriol.1985,161(1):314-320；Liao G J,Lee Y J,Lee Y H,et al. Biotechnol.Appl.Biochem.1998,27(Pt 1):55-61).But R. is carried out from molecular level Toruloides oil and fat accumulation mechanism, genetic development, growth metabolism and the research of bacterial strain genetic modification, it is necessary to have corresponding heredity Operating system.However for R.toruloides good for widely distributed, prospects for commercial application, due to its special sort The shortage of status and biochemical characteristic and genetic operating system, so that its genetic improvement and Advances in research on molecular mechanism are slow, mesh Preceding effective genetic operating system is based on its own glycerol 3-phosphate kinase promoter pPGK and glyceraldehyde-3-phosphate dehydrogenation Agrobacterium mediation converted system (Lin XP, Wang YN, Zhang SF, the et al.Fems Yeast of enzyme GPD promoter Res.2014,14:547–555).But the constitutive promoter used can not a certain genetic transcription of selective regulation, be not suitable for thin The overexpression of cytotoxic genes；Meanwhile metabolic engineering is also required to more promoters and termination subcomponent is available, to realize The accuracy controlling of a certain each gene expression dose of metabolic pathway.

Inducible promoter is specifically physically or chemically under the stimulation of signal, the starting of regulation downstream gene transcription and pass It closes, it is particularly important to the genetic manipulation of some cytotoxic genes.Na⁺/ Pi cotransporter PHO89 is a kind of high affine Power phosphate cotransporter, by the strict control that Phos checks and derepresses, at phosphate concn lower (0.25g/L or so) Expression up-regulation, and then expression is obstructed when phosphate concn is normal.The induction of PHO89 promoter Ppho89 is not necessarily to that inducer is added, Phosphate concn is exactly exactly Ppho89 induced activation concentration in limit phosphorus oil fermentation culture medium used in early-stage study.Very Overexpression suitable for some crucial rate-limiting enzymes in the oil and fat accumulation phase regulates and controls, for example is overexpressed ME to increase the confession of NADPH reducing power It answers.Although once someone separates the Na of wine brewing (Saccharomyces cerevisiae)⁺/ Pi cotransporter promoter, with And other phosphate starvation induction promoters operate (Hiraoka E, Murai M, Yano J, et for the genetic engineering of itself al.Journal of Fermentation and Bioengineering. 77(4):376–381.；Lee KM,DaSilva 22 (6): NA.Yeast.2005 431-440.), but has no such promoter for Rhodosporidium (Rhodosoporidium), lock throws saccharomyces (Sporidiobolus), Sporobolomyces (Sporobolomyces) and red ferment Mother belongs to the report of the genetic engineering operation of gene expression, genetic engineering procedure and strain improvement in (Rhodotorula).Meanwhile It is known to the skilled person in the art that " different microorganisms exists big in terms of genetic background, gene expression pattern, physiological and biochemical property Difference, even if being all yeast, there is also very big differences between different kinds, for example, belong to the saccharomyces cerevisiae of Ascomycota, Pichia pastoris, Ye Shi solve rouge yeast, it is necessary to construct its genetic system respectively, select autogenous promoter ".However, promoter It is essential for genetic operating system.Therefore, separation can start the Na of reporter gene expression in these rhodotorulas⁺/ Pi cotransporter promoter becomes the focus studied at present.

Terminator sequence is to give the DNA sequence dna of RNA polymerase transcription stop signals, while also determining the stabilization of mRNA The release of property, transcriptional efficiency and mRNA from transcription complex.It is commercialized the synthetic biology document of Yeast expression carrier and report In, the terminator of more options cance high-expression gene is as transcription terminator element.

Summary of the invention

In view of above-mentioned prior art bottleneck, the main object of the present invention, which is to provide, can be universally used in Rhodosporidium (Rhodosoporidium), lock throws saccharomyces (Sporidiobolus), Sporobolomyces (Sporobolomyces) and red ferment Mother belong to (Rhodotorula) in gene expression, genetic engineering procedure and strain improvement middle exogenous gene expression promoter and Terminator, and the method that these rhodotorula bacterial strains are improved using suitable transformation technology.

To achieve the purpose of the present invention, the present invention is analyzed by the genome sequence to circle rhodosporidium toruloides, is obtained Respond the Na of phosphate starvation induction⁺The promoter sequence of/Pi cotransporter (Pho89), and further pass through round pcr It is successfully separated the DNA fragmentation comprising effective promoter from circle rhodosporidium toruloides chromosomal DNA, using suitable method for transformation Circle rhodosporidium toruloides Na will be contained⁺The exogenous dna fragment of/Pi cotransporter (Pho89) promoter is directed respectively into red winter spore Saccharomyces, lock are thrown in saccharomyces, Sporobolomyces and Rhodotorula, are successfully realized the expression of foreign gene, are completed this hair It is bright.

The present invention, which has been successfully separated, to throw saccharomyces, Sporobolomyces and Rhodotorula ferment in Rhodosporidium, lock Start the circle rhodosporidium toruloides Na of reporter gene expression in mother⁺/ Pi cotransporter (Pho89) promoter, and construct it Expression vector.

Specifically, the present invention includes that following technical proposals (A) arrives (H):

(A) a kind of that there is Rhodosporidium, lock to throw saccharomyces, Sporobolomyces and Rhodotorula transcripting promoter activity DNA fragmentation, the DNA fragmentation:

(1) there is the full sequence of the DNA sequence dna as shown in SEQ ID NO:1 or comprising the DNA sequence dna from 3 '-ends Partial sequence within 500bp,

(2) having can rise within 500bp with the whole of the sequence as shown in SEQ ID NO:1 or its DNA sequence dna 3 '-end Partial sequence hybridization and keep the active sequence of transcripting promoter, or

(3) substitution within one or 50 bases carried out to deoxynucleotide sequence shown in SEQ ID NO:1, lacked It loses, be inserted into or add obtained, with 70% or more homology and have promoter living with sequence shown in SEQ ID NO:1 The sequence of property.

(B) a kind of DNA fragmentation from circle rhodosporidium toruloides, the DNA fragmentation can be used as terminator, and: (1) have The whole of the DNA sequence dna as shown in SEQ ID NO:2 or partial sequence comprising the DNA sequence dna 5 '-end；Or (2) have can Sequence that is hybridizing with the sequence as shown in (1) and keeping such as (1) described sequence active.

(C) a kind of achievable target gene throws saccharomyces, Sporobolomyces and Rhodotorula yeast in Rhodosporidium, lock The DNA molecular of middle transcription initiation and tanscription termination, it with described in above-mentioned (A) have Rhodosporidium, lock throw saccharomyces, The DNA sequence of Sporobolomyces and Rhodotorula yeast transcriptional promoter activity, or have described in above-mentioned (A) simultaneously and have Rhodosporidium, lock throw the DNA sequence dna of saccharomyces, Sporobolomyces and Rhodotorula yeast transcriptional promoter activity, and (B) The DNA fragmentation, and DNA fragmentation described in (B) is located at the downstream of DNA sequence dna described in (A), 1-10000 adjacent thereto is a The DNA fragmentation of nucleotide.

(D) the DNA expression cassette that target gene can be connect by one kind with (A)-(C) any described DNA molecular, in order to The target gene can throw expression recombination in saccharomyces, Sporobolomyces and Rhodotorula yeast in Rhodosporidium, lock DNA.The target gene is protein-encoding nucleotide or antisense nucleic acid code nucleic acid.Preferably, the cDNA sequence of the target gene With the nucleotide sequence (LsNa as shown in SEQ ID NO:4⁺/ Pi cotransporter cDNA).

(E) a kind of recombinant vector of any one carried in (A)-(D) any described DNA molecular.The carrier can To be episomal vector or integrating vector, the episomal vector such as, but not limited to, pMD18-T, pUC18, pYES2c/t Or pYX212 etc., the integrating vector be mediated by agriculture bacillus binary expression vector, such as, but not limited to, PZPK or PZP2000 etc..

(F) a kind of that DNA molecular or the carrier as described in (E) described in (D) are transferred to Rhodosporidium, locks and throws yeast Belong to, the method for transformation of Sporobolomyces and Rhodotorula bacterial strain.

(G) one kind be transferred to the DNA expression cassette as described in (D) or the recombinant vector as described in (E) Rhodosporidium, Lock throws the engineering strain of saccharomyces, Sporobolomyces and Rhodotorula.

(H)Na⁺/ Pi cotransporter (Na⁺/ Pi cotransporter) promoter, it is characterised in that: its source is circle Rhodosporidium toruloides can start target gene and throw in saccharomyces, Sporobolomyces and Rhodotorula yeast in Rhodosporidium, lock Transcript and expression, the promoter: (1) with the DNA sequence dna as shown in SEQ ID NO:1 full sequence or include the DNA Partial sequence of the sequence from 3 '-ends within 1500bp, (2) have can with the whole of the sequence as shown in SEQ ID NO:1 or It rises that the partial sequence within 1500bp hybridizes and keeps the active sequence of transcripting promoter, or (3) in its DNA sequence dna 3 '-end Substitution within one or 50 bases, missing are carried out to deoxynucleotide sequence shown in SEQ ID NO:1, is inserted into or adds Add it is obtained, with sequence shown in SEQ ID NO:1 with 70% or more homology and with promoter activity sequence；

Na⁺/ Pi cotransporter terminator, it is characterised in that: its source is circle rhodosporidium toruloides, can terminate purpose base Because throwing the transcript and expression in saccharomyces, Sporobolomyces and Rhodotorula yeast, the termination in Rhodosporidium, lock Son: (1) whole with such as SEQ ID NO:2 shown in DNA sequence dna or partial sequence comprising the DNA sequence dna 5 '-end, (2) have can hybridizing with the partial sequence of the whole of the sequence as shown in SEQ ID NO:2 or its DNA sequence dna 5 '-end and protect The active sequence of transcription terminator is held, or (3) carry out one or 50 alkali to deoxynucleotide sequence shown in SEQ ID NO:2 Substitution, missing, insertion within base or addition are obtained, with sequence shown in SEQ ID NO:2 have 50% or more homology, And the sequence with terminator activity.

Using the DNA molecular with promoter activity of the invention and there is the active DNA of transcription terminator, it can be achieved that Foreign gene or endogenous gene throw the expression in saccharomyces, Sporobolomyces and Rhodotorula yeast in Rhodosporidium, lock.

The present invention provides throw saccharomyces, Sporobolomyces and Rhodotorula yeast strain for Rhodosporidium, lock Genetically engineered promoter, terminator and carrier.Saccharomyces, Sporobolomyces and red ferment are thrown for Rhodosporidium, lock Mother belongs to yeast strain and opens a breeding new way, and therefore can provide the saccharomyces neoformans bacterial strain with industrial use.

In conclusion the present invention provides following technical proposals:

1.Na⁺/ Pi cotransporter promoter, nucleotide sequence is as shown in SEQ ID NO:1.

2. Na described in the 1st⁺/ Pi cotransporter (Pho89) promoter can be in c for constructing (Rhodosoporidium), lock throws saccharomyces (Sporidiobolus), Sporobolomyces (Sporobolomyces) and red ferment The application for the recombinant expression carrier expressed in the yeast strain of mother's category (Rhodotorula), wherein having cloned comprising the Na⁺/ Rhodosporidium, the lock of the recombinant expression carrier of Pi cotransporter (Pho89) promoter throw saccharomyces and Rhodotorula Yeast strain constitutes Rhodosporidium, lock throws saccharomyces, Sporobolomyces and Rhodotorula genetic operating system.

3. a kind of DNA expression cassette contains Na shown in SEQ ID NO:1⁺The nucleosides of/Pi cotransporter promoter Acid sequence.

4. expression cassette described in the 3rd, also contain nucleotide sequence shown in SEQ ID NO:2 as terminator, Sequence shown in middle SEQ ID NO:1 is located at the upstream of sequence shown in SEQ ID NO:2, SEQ ID NO:1 and SEQ ID It is the open reading frame of coding target gene between NO:2.

5. DNA expression cassette described in the 4th, it is characterised in that: the open reading frame of the coding target gene CDNA sequence has the nucleotide sequence as shown in SEQ ID NO:4.

6. a kind of recombinant vector comprising DNA expression cassette described in any one of 3-5.It is characterized by: the load Body is sequestered or integrating vector.

7. recombinant vector described in the 6th, the integrating vector is the binary expression vector of mediated by agriculture bacillus, or For the homologous recombination vector for carrying target gene flank 1500-4000 base homologous recombination arm, the homologous recombination vector skeleton Or the episomal vector is selected from E. coli cloning vector or yeast shuttle vector, preferably pMD18-T, pUC18, pYES2c/t Or pYX212.

8. the host cell comprising recombinant vector described in the 6th, it is characterised in that: the host cell is Escherichia coli Cell or yeast cells.

9. a kind of expression system for oleaginous yeast genetic expression, the expression system includes:

(1) changing of expressing in saccharomyces, Sporobolomyces and Rhodotorula category bacterial strain can be thrown in Rhodosporidium, lock Good carrier, the improved carrier in Rhodosporidium, lock by that can throw in saccharomyces, Sporobolomyces and Rhodotorula It is inserted into shown in promoter sequence shown in SEQ ID NO:1 and SEQ ID NO:2 in integrant expression or the plasmid of free expression Terminator sequence building obtains, and wherein promoter sequence shown in SEQ ID NO:1 is located at shown in SEQ ID NO:2 and terminates The upstream of subsequence is multiple cloning sites between sequence shown in sequence and SEQ ID NO:2 shown in SEQ ID NO:1, and And the carrier also includes selected marker；

(2) target gene open reading frame sequence can be operably inserted into improved carrier described in (1), And promoter and terminator in improved carrier described in the target gene and (1) is made to meet the connection of reading frame, and

(3) Rhodosporidium, lock throw saccharomyces, Sporobolomyces and Rhodotorula bacterial strain.

10. the 9th expression system for oleaginous yeast genetic expression, wherein improved carrier described in (1) by It can be thrown in Rhodosporidium, lock and be inserted into SEQ ID in the plasmid expressed in saccharomyces, Sporobolomyces and Rhodotorula The building of terminator sequence shown in promoter sequence shown in NO:1 and SEQ ID NO:2 obtains.

11. the 9th expression system for oleaginous yeast genetic expression, wherein (1) described plasmid be sequestered or Integrative plasmid, also, wherein the integrative plasmid be mediated by agriculture bacillus double base expression plasmid, such as PZPK or PZP2000, also, the episomal plasmids are selected from pMD18-T, pUC18, pYES2c/t or pYX212.

12. the 9th expression system for oleaginous yeast genetic expression, wherein Rhodosporidium toruloides described in (3) It selects good strains in the field for seed from circle rhodosporidium toruloides (Rhodosporidium toruloides), Bei Jiwei rhodosporidium toruloides (Rhodosporidium babjevae), the lock throw saccharomyces (Sporidiobolus) bacterial strain and throw spore ferment selected from pink lock is intended Female (Sporidiobolus pararoseus), Sporobolomyces (Sporobolomyces) bacterial strain throw spore ferment selected from pink Female (Sporobolomyces roseus), Rhodotorula (Rhodotorula) bacterial strain are selected from rhodothece rubra (Rhodotorula rubra), rhodotorula mucilaginosa (Rhodotorula mucilaqinosa), Rhodotorula marina (Rhodotorula Marina), grass rhodotorula (Rhodotorula graminis) and rhodotorula glutinis (Rhodotorula glutinis).

13. the 9th expression system for oleaginous yeast genetic expression, wherein the opening of target gene described in (2) is read Frame sequence has the nucleotide sequence as shown in SEQ ID NO:4.

It should be appreciated by those skilled in the art that term " expression system " refers to including recombinant vector, target egg to be expressed The composition system of white coding nucleotide sequence, suitable host cell or host strain etc. is used in the host cell Or the target protein is expressed in host strain.

The beneficial effects of the present invention are:

Saccharomyces is thrown for Rhodosporidium, lock and the saccharomycete of Rhodotorula provides promoter, terminator heredity turns The strong Rhodosporidium promoted from now on, lock are thrown the bacterium of saccharomyces, Sporobolomyces and Rhodotorula saccharomycete by change method Strain improvement and metabolic engineering research.

Detailed description of the invention

Detailed description of the invention

The agarose gel electrophoresis results figure of Fig. 1, PHO89 degenerate pcr product (swimming lane 1), swimming lane M are molecular weight standard.

The structural schematic diagram of Fig. 2, PZPK-PHO89p-hyg-PHO89t carrier, LB, T-DNA left margin；RB, T-DNA are right Boundary.

Fig. 3, the PCR qualification result figure that recon is obtained using HYG genetic transformation R.babjevae NCYC 2630, swimming lane M is molecular weight standard, and swimming lane 1-6 respectively indicates different Hyg resistant transformants, and WT indicates wild type.

Fig. 4, the detection of expression for indicating HYG --- Western blot analyze result figure, and swimming lane 1-3 is R.babjevae 2630 hygromycin transformant 1-3 total protein of NCYC；Swimming lane 4 is the starting strain R.babjevae as negative control 2630 total protein sample of NCYC.

Transcriptional level expression analysis --- the RT- of Fig. 5, BLE resistance Ura3 auxotrophy circle rhodosporidium toruloides recombinant bacterial strain PCR result figure, swimming lane 1-2 are BLE resistance Ura3 auxotrophy circle 10788 recombinant bacterial strain 1-2 of rhodosporidium toruloides ATCC, swimming lane 3 be control strain circle rhodosporidium toruloides ATCC 10788.

The structural schematic diagram of Fig. 6, PZPK-PHO89p-hyg-Thsp carrier, LB, T-DNA left margin；On the right of RB, T-DNA Boundary.

The structural schematic diagram of Fig. 7, pZPK-Ppho89-MCS-Thsp carrier, LB, T-DNA left margin；On the right of RB, T-DNA Boundary.

The structural schematic diagram of Fig. 8, PZPK-HYG-Ppho89-MCS-Thsp carrier, LB, T-DNA left margin；RB, T-DNA Right margin.

The structural schematic diagram of Fig. 9, pZPK-HYG-Ppho89-CpFAH-Thsp carrier, LB, T-DNA left margin；RB, T- DNA right margin.

Figure 10, the detection of expression for indicating CpFAH --- Western blot analyze result figure, and swimming lane 1-3 is to intend pink lock 3765 hygromycin transformant 1-3 total protein of shadow yeast JCM；Swimming lane 4 intends pink lock for the starting strain as negative control 3765 total protein sample of shadow yeast JCM.

The structural schematic diagram of Figure 11, pZPK-HYG-Ppho89-ME-Thsp carrier, LB, T-DNA left margin；RB, T-DNA Right margin.

Figure 12, the detection of expression for indicating RtME --- Western blot analyze result figure, and swimming lane 1-3 throws spore ferment to be pink Female 8242 hygromycin transformant 1-3 total protein of S.roseus JCM；Swimming lane 4 is pink for the starting strain as negative control 8242 total protein sample of shadow yeast S.roseus JCM.

The structural schematic diagram of Figure 13, pZPK-HYG-Ppho89-GFP-Thsp carrier, LB, T-DNA left margin；RB, T- DNA right margin.

Figure 14, the detection of expression for indicating GFP --- Western blot analyze result figure, and swimming lane 1-3 is to recombinate dark red ferment Female 2.279 hygromycin transformant 1-3 total protein of CGMCC；Swimming lane 4 is the dark red ferment of starting strain recombination as negative control Female 2.279 total protein sample of CGMCC.

Figure 15, the detection of expression for indicating GFP --- Western blot analyze result figure, and swimming lane 1-3 is the recombination red ferment of glue Female 2.22 hygromycin transformant 1-3 total protein of CGMCC；Swimming lane 4 is the starting strain recombination rhodotorula mucilaginosa as negative control 2.22 total protein sample of CGMCC.

The structural schematic diagram of Figure 16, pZPK-HYG-Ppho89-INU-Thsp carrier, LB, T-DNA left margin；RB, T- DNA right margin.

Sequence table explanation

SEQ ID NO:1 RtPHO89 promoter, from circle rhodosporidium toruloides

SEQ ID NO:2 RtPHO89 terminator, from circle rhodosporidium toruloides

The code area SEQ ID NO:3 RtPHO89

SEQ ID NO:4 RtPHO89cDNA

SEQ ID NO:5 RtPHO89 amino acid sequence

SEQ ID NO:6 HYG

SEQ ID NO:7 PHO89p-hyg-PHO89t

SEQ ID NO:8 Ura3p-ORF-URA3t

SEQ ID NO:9 BLE

SEQ ID NO:10 Ura3p-PHO89p-ble-URA3t

SEQ ID NO:11 Thsp

SEQ ID NO:12 CpFAH

SEQ ID NO:13 RtME

SEQ ID NO:14 LB sequence

SEQ ID NO:15 RB sequence

SEQ ID NO:16 GFP

Specific embodiment

Herein, " promoter " is referred to by RNA polymerase identification, in conjunction with the DNA sequence that simultaneously energy promotor gene is transcribed Column.Term " promoter " it can also be understood that are as follows: including 5 ' noncoding regions, cis-acting elements (such as enhancer) and it is other can with turn Record the nucleotide sequence that the factor combines.

The presence of promoter or intensity are usually to be indicated by promoter activity, measuring method: by reporter gene (as resisted Property gene) be connected to the downstream of the promoter, and the DNA construct is converted into corresponding host cell, examining report gene is No expression.If it is observed that being connected to the expression of promoter downstream reporter gene, so that it may think the promoter It is active in the host cell that it is converted.

Herein, " terminator " refer on chromosome provide termination signal make RNA polymerase separated with DNA template and Make the section of DNA sequence of tanscription termination.Reporter gene can be kept effective by " promoter-reporter gene-terminator " construct Express and determine the activity of terminator.

" circle rhodosporidium toruloides " in the present invention, any diploid and monoploid including belonging to " species ", wild type Bacterial strain and auxotrophic strain.In the present invention " Rhodosporidium, lock throw saccharomyces, Sporobolomyces and rhodotorula Belong to ", it is not specifically limited, the example is red including circle rhodosporidium toruloides (Rhodosporidium toruloides), Bei Jiwei Winter spore yeast (Rhodosporidium babjevae), pink lock shadow yeast (Sporidiobolus pararoseus), powder Red shadow yeast (Sporobolomyces roseus), rhodothece rubra (Rhodotorula rubra), rhodotorula mucilaginosa (Rhodotorula mucilaqinosa), Rhodotorula marina (Rhodotorula marina), grass rhodotorula (Rhodotorula graminis) and rhodotorula glutinis (Rhodotorula glutinis).

" target gene " of the invention, including saccharomyces, Sporobolomyces and red ferment can be thrown in Rhodosporidium, lock Mother belongs to albumen coded sequence, antisense RNA coding sequences and the nuclease coded sequence expressed in bacterial strain.It can be in red winter spore ferment Mother belongs to, lock throws the example for the albumen coded sequence expressed in saccharomyces, Sporobolomyces and Rhodotorula bacterial strain including derived from this Albumen or nucleic acid sequence in two class Pseudomonas, and be not limited thereto, it further include from other microorganisms, plant and animal Albumen or nucleic acid sequence.Art technology is any it should be understood that when using from other microorganisms, plant and animal Albumen coded sequence as a purpose gene (that is, external source target gene) when, for optimization Rhodosporidium, lock throw saccharomyces, Expression in Sporobolomyces and Rhodotorula bacterial strain, it usually needs throw saccharomyces, shadow yeast for Rhodosporidium, lock Belong to and the codon preference of Rhodotorula bacterial strain carries out codon optimization to the target gene.And codon optimization belongs to this The conventional technical means in field.

Promoter in the present invention: (1) there is the full sequence of the DNA sequence dna as shown in SEQ ID NO:1 or includes the DNA Partial sequence of the sequence from 3 '-ends within 1500bp, (2) have can with the whole of the sequence as shown in SEQ ID NO:1 or It rises that the partial sequence within 1500bp hybridizes and keeps the active sequence of transcripting promoter, or (3) in its DNA sequence dna 3 '-end Substitution, missing, insertion or the addition for carrying out one or more bases to deoxynucleotide sequence shown in SEQ ID NO:1 are obtained , with sequence shown in SEQ ID NO:1 with 50% or more homology and with the sequence of promoter activity.

Terminator in the present invention: (1) there is the whole of the DNA sequence dna as shown in SEQ ID NO:2 or includes the DNA sequence The partial sequence of column 5 '-end, (2) have can whole with the sequence as shown in SEQ ID NO:2 or its DNA sequence dna 5 '-end Partial sequence hybridization and keep the active sequence of transcription terminator, or (3) to deoxyribonucleoside shown in SEQ ID NO:2 Substitution, missing, insertion or the addition that acid sequence carries out one or more bases are obtained, with sequence shown in SEQ ID NO:2 With 50% or more homology and with the sequence of terminator activity.

Promoter-target gene construct, target gene-terminator construct or promoter-mesh in the present invention Gene-terminator construct, can throw saccharomyces directly or through carrier mediated conversion Rhodosporidium, lock, throw spore ferment Mother belongs to and Rhodotorula bacterial strain, can be using preferred plasmid carrier as mediation carrier in order to destination gene expression.

Below in conjunction with the accompanying drawings and embodiment the invention will be further described, it will help those skilled in the art Understand the present invention, but the invention is not limited in any way.All primer synthesis and examining order in following embodiments, such as without spy It does not mentionlet alone bright then by the completion of Dalian TakaRa company.Experimental method in following embodiments is unless otherwise specified conventional side Method.The experimental materials used in the following example is unless otherwise specified to be commercially available from conventional biochemical reagent company.

R.toruloides CGMCC 2.1389: China General Microbiological Culture Collection Center (CGMCC) is originated from Tokyo Microbe research institute of university (IFO 8766), the diploid made of IFO 0559 and IFO 0880 are with, is equal to CBS 6016 or NBRC 8766 or NRRL Y-6987.

R.toruloides ATCC 10788: Unite States Standard biology product collecting center (ATCC) is originated from CBS-KNAW Fungal biodiversity centre, be equal to IFO 0559 or JCM 3792 or CCRC 20306 or DBVPG 6740 or IAM 13469 or IGC 4416 or MUCL 30249 or NCYC 921 or NRRL Y-1091 or VKM Y-334 or PYCC 4416。

Rhodosporidium babjevae NCYC 2630 is purchased from United Kingdom National barms collection (National Collection of Yeast Cultures, NCYC).

Intend pink lock shadow yeast (Sporidiobolus pararoseus) JCM 3765 to be purchased from purchased from China commonly Microbiological Culture Collection administrative center (CGMCC).

Pink shadow yeast (Sporobolomyces roseus) JCM 8242 is purchased from Japanese Microbiological Culture Collection The heart (JCM).

Rhodothece rubra (Rhodotorula rubra) CGMCC 2.279 is purchased from barms collection (purchased from China General Microbiological Culture preservation administrative center (CGMCC).

Rhodotorula mucilaginosa CGMCC 2.22 (is purchased from China General Microbiological culture presevation pipe purchased from barms collection Reason center (CGMCC).

Rhodotorula marina (Rhodotorula marina) CGMCC 2.4203 (is purchased from purchased from barms collection China General Microbiological culture presevation administrative center (CGMCC).

Rhodotorula glutinis (Rhodotorula glutinis) NCYC 2666 is purchased from United Kingdom National barms collection (National Collection of Yeast Cultures, NCYC).

Embodiment 1: circle 2.1389 total serum IgE of rhodosporidium toruloides (Rhodosporidium toruloides) CGMCC mentions It takes

Circle rhodosporidium toruloides (R.toruloides) CGMCC 2.1389 (is purchased from China General Microbiological culture presevation pipe Reason center (China General Microbiological Culture Collection Center, CGMCC)) by inclined-plane It is inoculated into 10mLYEPD fluid nutrient medium (glucose 20.0g/L, yeast extract 10.0g/L, peptone 20.0g/L, pH 6.0) in, for 24 hours in 30 DEG C of shaking table cultures, then bacterium solution is transferred to the training of 100mL YEPD liquid respectively with the volume ratio of 1:50 It supports in base, reaches logarithmic growth phase in 30 DEG C of shaking table culture 14h.At 4 DEG C, 5000rpm is centrifuged 4min, collects thallus, uses liquid nitrogen Quick freeze thallus, grinding broken wall (Yang F, Tan HD, Zhou YJ, et al.Mol.Biotechnol.2010,47 (2): 144–151.).Total serum IgE is extracted using TakaRa company RNAiso kit, and according to its standard step.

RNA carries out 1.5% (mass/volume concentration) agarose gel electrophoresis, uses fluorescence-uv analyzer observation mirror It is fixed, it is seen that clearly two band.With ultraviolet/visible light spectrometer analysis total serum IgE sample, OD is measured₂₆₀/OD₂₈₀=1.99, table Bright total serum IgE quality is fine.Total serum IgE sample freezes in -80 DEG C, spare.

Embodiment 2: the synthesis of circle the first chain of rhodosporidium toruloides CGMCC 2.1389cDNA and pho89 degenerate pcr

To justify rhodosporidium toruloides NRRL Y-11557 total serum IgE as template, reverse transcription synthesizes the first chain of cDNA.Firstly, by 1.0 μ L total serum IgE (about 2 μ g), 1.0 μ L primer SMART IV:5 '-AAGCAGTGGTATCAACGCAGAGTGGCCATTACGGCCGGG- 3 ' and 1.0 μ L oligo dT- adapter-primer III/3':5 ' of CDS-ATTCTAGAGGCCGAGGCGGCCGACATG-d (T)_30N-1N- 3 ', 2.0 μ L DEPC handle water (pyrocarbonic acid diethyl ester handles water, is purchased from Dalian TakaRa company), are added in PCR pipe and mix, In 72 DEG C of heat preservation 2min, it is immediately placed on cooled on ice 2min, by 2.0 μ L, 5 × the first chain buffer (Clontech company), 1.0 μ L DTT (20mM), 1.0 μ L dNTP (10mM)；1.0 μ L powerscript reverse transcriptase (Clontech company) are added to body In system, mix.In 42 DEG C of extension 60min, last 4 DEG C reaction was completed, is stored in -20 DEG C, spare.

Two degenerate primer PHO89-sense:5 '-ATGCC (AGCT) ATGCA (CT) CA (AG) TA (CT) of design synthesis GA (CT) TAC-3 ' (base occurs at random in this position in bracket, is degeneracy base) and PHO89-anti:5 '-CTA (AGCT) (base occurs TG (CT) GA (AG) GG (AG) AA (AG) TG (AG) GGCGC-3 ' at random in this position in bracket, is degeneracy alkali Base), using the first chain of cDNA of reverse transcription synthesis as template, carry out the degenerate pcr amplification of PHO89 gene, 5 × PCR buffer 10.0 μ L, dNTPs (10mM) 1.0 μ L, 1.0 μ L of upstream primer (50mmol/L), 1.0 μ L of downstream primer (50mmol/L), 0.5 μ L of PrimeSTAR archaeal dna polymerase (Dalian TakaRa), the first chain of cDNA template 1.0 the μ L, ddH of synthesis₂O is added to 50 μ L, in 94 DEG C of heat preservation 3min, then in 98 DEG C of heat preservations 10s, 62 DEG C of 10s, 72 DEG C of 1min, 35 are recycled, 72 DEG C of 10min, and 4 DEG C Reaction was completed.Amplified production carries out 1% (mass/volume concentration) agarose gel electrophoresis, observes the band of 1.8kb or so (Fig. 1), using DNA QIAquick Gel Extraction Kit (purchased from the raw work in Shanghai), according to supplier's proposed steps purified pcr product.PCR product ginseng It is cloned into pMD18-T carrier (purchased from Dalian TakaRa) according to the method that Dalian TakaRa company provides, is transformed into E.coli DH5 α Competent cell, wherein by Calcium Chloride Method, (the Molecular Cloning:A Laboratory guide third edition, Pehanorm Brooker write competent cell, Huang Pei Hall etc. is translated, and Science Press publishes) preparation.It selects Amp resistant transformants and carries out Zengjing Granule, plasmid extraction.Recombinant plasmid sample Product send to Dalian TakaRa company and are sequenced, and the amino acid sequence that sequence results deduce is analyzed through Blastp, it was demonstrated that are Na⁺/Pi Cotransporter sequence (RtPHO89 amino acid sequence), as shown in SEQ ID NO:5.Na⁺/ Pi cotransporter cDNA Sequence (RtPHO89cDNA) is as shown in SEQ ID NO:4 sequence.

Embodiment 3: the amplification of circle 2.1389 genomic DNA of rhodosporidium toruloides CGMCC

The extracting genome DNA of circle rhodosporidium toruloides CGMCC 2.1389 uses bead broken wall method (fine works molecular biosciences The 13rd chapter of the experiment guide third edition is learned, Ao Sibai etc. writes, and face sub- grain husk etc. is translated, and Science Press publishes).The genome prepared DNA is measured using Nanodrop 1000, measures OD₂₆₀/OD₂₈₀=1.85, show that genomic DNA quality is fine.Concentration is 280ng/ μ L, totally 500 μ L, genome DNA sample freezes in -20 DEG C, spare.

According to the Na obtained in embodiment 2⁺/ Pi cotransporter (RtPHO89) cDNA sequence, designs 1 couple of gene spy Specific primer, PHO89-p1:5 '-atgcctatgcaccaatacgattacctc-3 ' and PHO89-p2:5 '- Ctactgcgaggggaagtgaggcgcgttgag-3 ', to justify the genomic DNA of rhodosporidium toruloides CGMCC 2.1389 as mould Plate conventionally carries out PCR amplification, obtains the PCR product (not shown) of about 2.4kb.Pcr amplification product is according to implementation The operating procedure recycling of example 2 is cloned into pMD18-T carrier, and is sequenced, and obtains as shown in sequence table SEQ ID NO:3 DNA sequence (code area RtPHO89).Through with the Na that is obtained in embodiment 2⁺/ Pi cotransporter cDNA sequence alignment, card The real genetic fragment is its Na⁺/ Pi cotransporter coding region sequence, wherein containing 10 intrones and 11 exons.

Embodiment 4: chromosome walking obtains RtPHO89 gene 5 ' flank sequence (promoter)

The present embodiment is completed using Genome Walking Kit (being purchased from Dalian TakaRa).

According to RtPHO89DNA sequence obtained in embodiment 3, designing 3 Specific Primer, (gene specific draws Object), respectively PHO89-SP1:5 '-catctttgagagataggaaggtacacg-3 ', PHO89-SP2:5 '- Cgatttactcgcgacagacgtcgcccagct-3 ' and PHO89-SP3:5 '- Cgagcagggggagaacgggcgcagtggacg-3 ' is carried out according to kit specification following operation as downstream primer.

1.1^stPCR reaction

Using the genomic DNA refined in embodiment 3 as template, first round amplification is carried out.50 μ L:10 × LA of reaction system PCR buffer II(Mg²⁺Plus, Dalian TakaRa) 5.0 μ L, dNTPs (2.5mmol/l) 8.0 μ L, LA Taq DNA polymerization 1.0 1.0 μ L, PHO89-SP1 (10 μ of μ L, AP1Primer (100 μm of ol/l, Dalian TakaRa) of enzyme (5U/ μ L, Dalian TakaRa) Mol/l) 1.0 μ L, circle rhodosporidium toruloides NRRL Y-11557 genomic DNA template (120ng/ μ L) 1.0 μ L, ddH₂O adds to 50 μL.Reaction condition: the high specific reaction of 5 high temperature anneal temperatures is first carried out, the low spy of 1 extremely low annealing temperature is then carried out Opposite sex reaction；Then hot asymmetric PCR is carried out: the high specific reaction of 2 high annealing temperature (65 DEG C) and 1 low temperature thermal oxidation The low specificity reaction alternate cycles of (44 DEG C), totally 15 times.Design parameter is as follows: 94 DEG C of 1min, 98 DEG C of 1min；94 DEG C of 30s, 65 DEG C 1min, 72 DEG C of 2min, totally 5 circulations；94 DEG C of 30s, 25 DEG C of 3min, 72 DEG C of 2min；94℃30s,65℃1min, 72℃ 2min, 94 DEG C of 30s, 65 DEG C of 1min, 72 DEG C of 2min, 94 DEG C of 30s, 44 DEG C of 1min, 72 DEG C of 2min, totally 15 recycle；72℃ 10min, reaction was completed.

2.2^ndNest-type PRC reaction

50 μ L:10 × LA PCR buffer II (Mg of reaction system²⁺Plus, Dalian TakaRa) 5.0 μ L, dNTPs (2.5mmol/l) 8.0 μ L, LA Taq archaeal dna polymerase (5U/ μ L, Dalian TakaRa) 1.0 μ L, AP1Primer (100 μm of ol/l, Dalian TakaRa) 1.0 μ L, 1^stPCR reaction product 1.0 μ L, PHO89-SP2 (10 μm of ol/l) 1.0 μ L, ddH₂O adds to 50 μ L. Reaction condition: 94 DEG C of 30s, 65 DEG C of 1min, 72 DEG C of 2min, 94 DEG C of 30s, 65 DEG C of 1min, 72 DEG C of 2min, 94 DEG C of 30s, 44 DEG C 1 Min, 72 DEG C of 2min, totally 15 recycle；72 DEG C of 10min, reaction was completed.

3.3^rdNest-type PRC reaction

50 μ L:10 × LA PCR buffer II (Mg of reaction system²⁺Plus, Dalian TakaRa) 5.0 μ L, dNTPs (2.5mmol/l) 8.0 μ L, LA Taq archaeal dna polymerase (5U/ μ L, Dalian TakaRa) 1.0 μ L, AP1Primer (100 μm of ol/l, Dalian TakaRa) 1.0 μ L, 2^ndNested PCR reaction product 1.0 μ L, PHO89-SP3 (10 μm of ol/l) 1.0 μ L, ddH₂O adds to 50 μL.Reaction condition: 94 DEG C of 30s, 65 DEG C of 1min, 72 DEG C of 2min, 94 DEG C of 30s, 65 DEG C of 1min, 72 DEG C of 2min, 94 DEG C of 30s, 44 DEG C 1 min, 72 DEG C of 2min, totally 15 recycle；72 DEG C of 10min, reaction was completed.

3^rdNested PCR reaction product cuts purpose band after 1% (mass/volume concentration) agarose gel electrophoresis, benefit It is purified with DNA fragmentation gel purification kit (being purchased from the green skies).DNA fragmentation after purification is cloned through TA and is inserted into PMD18-T carrier (is purchased from Dalian TakaRa company), converts DH5 α competent cell；Wherein competent cell presses Calcium Chloride Method (the Molecular Cloning:A Laboratory guide third edition, Pehanorm Brooker write, and Huang Peitang etc. is translated, and Science Press publishes) preparation.It is anti-to select Amp Property transformant carry out Zengjing Granule, plasmid extract.Recombinant plasmid sample send to Dalian TakaRa company and is sequenced, and obtains such as SEQ ID DNA sequence dna shown in NO:1, it was demonstrated that be expected RtPHO89 promoter sequence.

Embodiment 5: chromosome walking obtains 3 ' flank sequence (terminator) of RtPHO89 gene

The present embodiment is completed also with Genome Walking Kit (being purchased from Dalian TakaRa).

According to PHO89DNA sequence obtained in embodiment 3, designing 3 Specific Primer, (gene specific draws Object) it is respectively PHO89-SP11:5 '-taccgctctcgtgaccttgttgctgacgt-3 ', PHO89-SP22:5 '- Gcaacggcgacttccgcgccgtcaactggc-3 ' and PHO89-SP33:5 '- Ccacaccaggcatcgtcctcaacgcgcctc-3 ' is carried out according to kit specification the dyeing of 3 ' flanks as upstream primer Body step moves operation, except Specific Primer is successively changed to by PHO89-SP1, PHO89-SP2, PHO89-SP3 respectively Outside PHO89-SP11, PHO89-SP22, PHO89-SP33, the other the same as in Example 4.

3^rdNested PCR reaction product (not shown) is carried out pure using DNA fragmentation gel purification kit (being purchased from the green skies) Change, clones insertion pMD18-T carrier (being purchased from Dalian TakaRa company) through TA, convert DH5 α competent cell；Wherein competence Cell is by Calcium Chloride Method (the Molecular Cloning:A Laboratory guide third edition, Pehanorm Brooker write, and Huang Peitang etc. is translated, and Science Press publishes) Preparation.It selects Amp resistant transformants and carries out Zengjing Granule, plasmid extraction.Recombinant plasmid sample send to Dalian TakaRa company and surveys Sequence obtains the DNA sequence dna as shown in SEQ ID NO:2, it was demonstrated that is expected Na⁺The end of/Pi cotransporter encoding gene Only subsequence.

Embodiment 6:Rt PHO89 promoter-open reading frame-terminator full-length gene obtains

According to the promoter and terminator sequence obtained in embodiment 4 and embodiment 5, redesigns pair of primers and carry out The amplification of RtPHO89 " promoter-open reading frame-terminator " full-length gene.Ppho89-p1: 5'- Gagggatcttccctcgctttgacttcc-3 ', PHO89t-p2:5 '-cacccctcccgcgacaacccttcgctcc-3 '. PCR amplification is carried out as template using 2.1389 genomic DNA of circle rhodosporidium toruloides CGMCC prepared in embodiment 3.PCR system (50 μ L): 10 × Speed buffer (Dalian TakaRa) 5.0 μ L, dNTPs (10mmol/L) 1.0 μ L, upstream primer (10 μ Mol/L) 2.0 μ L, downstream primer (10 μm of ol/L) 2.0 μ L, SpeedSTAR^TM(amplification rate is fast, 1kb/ for HS archaeal dna polymerase 10s is purchased from Dalian TakaRa company) 0.5 μ L, genomic DNA template (120ng/ μ L) 2 μ L, ddH₂O adds to 50 μ L.React item Part: 98 DEG C of 1min, 98 DEG C of 10s, 65 DEG C of 1.0min, 35 circulations, 72 DEG C of 10min, 4 DEG C reaction was completed.PCR product is through 1% (matter Amount/volumetric concentration) it is purified using PCR fragment purification kit (purchased from the green skies) after agarose gel electrophoresis analysis.Piece Section clones insertion pMD18-T carrier (being purchased from Dalian TakaRa company) through TA, converts DH5 α competent cell；Wherein competence Cell is by Calcium Chloride Method (the Molecular Cloning:A Laboratory guide third edition, Pehanorm Brooker write, and Huang Peitang etc. is translated, and Science Press publishes) Preparation.It selects Amp resistant transformants and carries out Zengjing Granule, plasmid extraction.Recombinant plasmid sample send to Dalian TakaRa company and surveys Sequence, it was demonstrated that be expected Na⁺/ Pi cotransporter full length gene sequence Ppho89t, the recombinant vector are named as T- PHO89。

Embodiment 7:RF PCR cloning PCR constructs hygromycin protein expression box PHO89p-hyg-PHO89t

HYG gene (such as SEQ ID is synthesized according to HYG protein sequence commission Shanghai Sangon Biotech Company's full genome of NCBI report Shown in NO:6).Using the gene of synthesis as template, reference literature method (van den Ent, F., and Lowe, J.J Biochem Biophys Methods, 2006,67,67-74.), design RF cloning primer: HYG-RF-p1:5 '- CTCCTGCCAGCAGCCAACCGTCGTCAAGatgccggagctcac ggcgacgtcgg-3 ' and HYG-RF-p2:5 '- CCAAGGACCGGAAGACGAATGGAACCA AGctattctttcgcccgcgggcgcgt-3 ' is primer, carries out PCR amplification. Carry out the amplification of the RF first round.System (50 μ L): 5 × Prime buffer (Dalian TakaRa), 10.0 μ L, dNTPs (2.5mmol/ L) 4.0 μ L, upstream primer (10 μm of ol/l) 2.0 μ L, 2.0 μ L, PrimeSTAR HS DNA of downstream primer (10 μm of ol/l) polymerization 1.0 μ L, T-GFPuv plasmid (100ng/ μ L) of enzyme (Dalian TakaRa) 1 μ L, ddH₂O adds to 50 μ L.Reaction condition: 95 DEG C 3min, 98 DEG C of 8s, 49 DEG C of 15s, 72 DEG C of 1min, 35 circulations, 72 DEG C of 10min, 4 DEG C reaction was completed.RF I reaction product utilizes DNA fragmentation glue recovery purifying kits, -20 DEG C save backup.

RF II reaction: 4.0 μ L of 5 × Prime buffer (Dalian TakaRa) 10.0, dNTPs (2.5mmol/l) is implemented T-PHO89 plasmid (100ng/ μ L) the 1.0 μ L constructed in example 6, RF I reaction product (200ng/ μ in the present embodiment abovementioned steps L) 1.0 μ L, ddH of 5.0 μ L, PrimeSTAR HS archaeal dna polymerase (Dalian TakaRa)₂O adds to 50 μ L.Reaction condition: 95 DEG C 3min, 68 DEG C of 12min, later next 95 DEG C of 30s, 65 DEG C of 45s (- 1 DEG C/cyc), 68 DEG C of 12min, 15 circulations carry out again One wheel: 95 DEG C of 30s, 55 DEG C of 45s, 68 DEG C of 12min, 20 circulations, 72 DEG C of 10min, 4 DEG C reaction was completed.

DpnI digestion and electroporated: take 8 μ L RF II reaction products that 1 μ L DpnI (purchased from TaKaRa) and 1 μ L is added DpnI buffer takes the electroporated DH5 α impression of 2 μ L after mixing after 37 DEG C of effect 120min remove original T-PHO89 plasmid State cell, competent cell prepare (the Molecular Cloning:A Laboratory guide third edition, Pehanorm Brooker work, Huang Peitang etc. by standard method Translate, Science Press publishes), electroporated parameter: 2200-2500V, 400 Ω, 25 μ F, 0 DEG C, 4-8ms.Amp resistance is selected to turn Beggar carries out Zengjing Granule, plasmid extracts, and carries out bacterium colony using RF I reaction the primer HYG-RF-p1 and HYG-RF-p2 PCR identification identifies that positive recombinant vector send Dalian TakaRa to be sequenced, and obtains 5 ' ends and 3 ' ends are respectively PHO89 starting " PHO89p-hyg-PHO89t " expression cassette of son and PHO89 terminator, meanwhile, which is named as T-PHO89p- hyg-PHO89t.Completely " PHO89p-hyg-PHO89t " expression cassette is as shown in SEQ ID NO:7.

Phosphorus of the embodiment 8:hyg in Bei Jiwei rhodosporidium toruloides (Rhodosporidium babjevae) NCYC 2630 Hydrochlorate starvation inducing expression

Agrobacterium tumefaciems (Agrobacterium tumefaciens) under field conditions (factors) can by scab or wound into Enter host tissue, its intracorporal section of DNA is transferred in Plant Genome, it is final that host is stimulated to infect position formation crown gall Tumor.This characteristic of Agrobacterium is applied to the transformation of Plant Genome, referred to as ATMT technology earliest.Subsequent ATMT technology is extensive Applied to a variety of fungies and Yeast Genetics transformation and T-DNA insertion mutation library construction.

ATMT conversion process can substantially be divided into vector construction, Agrobacterium activation, host material preparation, cotransformation and conversion Son screens this five steps.First in the interregional suitable selected marker of insertion of the T-DNA of binary vector, and it is transferred to Agrobacterium； It is induced after Agrobacterium tumefaciens attachment activation containing binary vector with acetosyringone (AS)；Host strain dilutes after overactivation To certain concentration；Agrobacterium after activation and induction is mixed with host material, is coated on the co-cultivation for being covered with mounting medium On plate, cotransformation is carried out at a suitable temperature；The mixed bacterium of co-cultivation is transferred in screening flat board, it is most suitable to be placed in host strain It is cultivated at a temperature of suitable, until transformant occurs.

1. the building of binary vector PZPK-PHO89p-hyg-PHO89t

PZPK skeleton carrier from Dalian Chemiclophysics Inst., Chinese Academy of Sciences Zhao Zongbao researcher laboratory (Lin XP, Wang YN, Zhang SF, et al.Fems Yeast Res.2014,14:547-555), PZPK-PHO89p-hyg- The building of PHO89t carrier then uses PHO89-HYG-RF-p1:5 '-CCGAATTGAATTCGAGCTCGCTCGGTACCCGGgag Ggatcttccctcgctttgactt-3 ' and PHO89-HYG-RF-p2:5 '-GCTTGCATGCTGCAGGTCGACTCTAGA Cacccctcccgcgacaacccttcgctcc-3 ' is primer, and the T-PHO89p-hyg-PHO89t constructed using embodiment 7 is mould Plate amplification obtains " PHO89p-hyg-PHO89t " segment, uses RF cloning process (as shown in Example 7) after the recycling of PCR glue It will be between the LB and RB of " PHO89p-hyg-PHO89t " segment insertion PZPK binary vector.Carrier obtained is named as PZPK-PHO89p-hyg-PHO89t, structure are as shown in Figure 2.

2. the building of the Agrobacterium tumefaciens attachment containing PZPK-PHO89p-hyg-PHO89t plasmid

PZPK-PHO89p-hyg-PHO89t binary vector obtained is converted using electroporated method to Agrobacterium tumefaciems In (Agrobacterium tumefaciems) AGL1 (be purchased from Unite States Standard biology product collecting center (ATCC)), in containing Picking transformant on the LB plate of 50ng/ μ L kanamycins.The method that Agrobacterium-mediated Transformation uses bacterium colony PCR first is tested Card.Correct transformant is verified, plasmid therein is extracted, is converted into Escherichia coli.Binary vector is a large amount of by Escherichia coli Sequence verification is sent after enrichment.Agrobacterium strains containing sequencing correct plasmid are engineered strain, are saved backup.

Inducing expression of the 3.HYG gene in Rhodosporidium babjevae NCYC 2630

R.babjevae NCYC 2630 is purchased from United Kingdom National barms collection (National Collection Of Yeast Cultures, NCYC).R.babjevae NCYC 2630 after taking a ring to activate, is connected to 5mL YEPD (grape Sugared 20.0g/L, yeast extract 10.0g/L, peptone 20.0g/L, pH 6.0) in culture solution, 30 DEG C, 200r/min is overnight Cultivate 10h.After sterile water washing one time, it is adjusted to OD₆₀₀=0.1-0.8, it is spare.Contain PZPK-PHO89p-hyg- After the Agrobacterium activation of PHO89t plasmid, it is connected to the LB liquid of 5mL (50ng/ μ L) containing kanamycin and rifampin (50ng/ μ L) In body, 30 DEG C, 200r/min cultivates 8h.With sterile water washing one time, it is adjusted to OD₆₀₀=0.1-1.6, it is spare.

Take above-mentioned yeast and each 400 μ L of Agrobacterium dilution, mix, directly drop in induce plate (5mmol/L glucose, 0.5% glycerol, 1.45g/L potassium dihydrogen phosphate, 2.05g/L dipotassium hydrogen phosphate, 0.15g/L sodium chloride, 0.5g/L epsom salt, 66mg/L calcium chloride dihydrate, 2.48g/L green-vitriol, 0.5g/L ammonium sulfate, 40mmol/L MES (2- (N- morpholine) second sulphur Acid), 2% agar powder, 200 μm of ol/L acetosyringones) on (Bundock, P., den Dulk-Ras, A., Beijersbergen, A., et al.EMBO J., 1995,14,3206-3214.), 24-25 DEG C, cultivate 4 days.With the left side 10mL Right sterile water is washed down lawn is mixed, and 3000 r/min are centrifuged 5min, discard the liquid that upper layer mainly contains Agrobacterium, remaining Cell be resuspended with 800 μ L sterile waters, take 50-200 μ L be coated on phosphate limitation plate (50ng/ μ L hygromycin, 300 μ g/mL Cephalosporin, 30g/L glucose, 5g/L ammonium sulfate, 0.64g/L potassium sulfate, 0.08g/L disodium hydrogen phosphate dodecahydrate, 0.94g/L sodium sulphate, 1.5g/L epsom salt, agar powder 1.5g/L, PH 6.0) on, it is cultivated in 30 DEG C, until conversion Son occurs.

The PCR of 2630 hygromycin transformant of 4.R.babjevae NCYC is identified

6 hygromycin resistance R.babjevae transformants of random picking access the phosphate limit containing 50ng/ μ L hygromycin Culture medium processed (30g/L glucose, 5g/L ammonium sulfate, 0.64g/L potassium sulfate, 0.08g/L disodium hydrogen phosphate dodecahydrate, 0.94g/L sodium sulphate, 1.5g/L epsom salt pH 6.0) in, in 30 DEG C of shaking table culture 36h.Glass described in reference implementation example 3 Glass pearl broken wall method extracts recombination R.babjevae strain gene group DNA, uses HYG-RF-p1 and HYG-RF-p2 for primer, carries out PCR identification.PCR system (50 μ L): 10 × PCR buffer (Dalian TakaRa) 5.0 μ L, dNTPs (2.5mmol/l) 4.0 μ L, Upstream primer (10 μm of ol/l) 2.0 μ L, downstream primer (10 μm of ol/l) 2.0 μ L, rTaq archaeal dna polymerases (Dalian TakaRa) 1.0 μ L, genomic DNA (30ng/ μ L) 1 μ L, ddH₂O adds to 50 μ L.Reaction condition: 95 DEG C of 3min, 98 DEG C of 10s, 55 DEG C of 15s, 72 DEG C 1min, 35 circulations, 72 DEG C of 10min, 4 DEG C reaction was completed.PCR product is through 1% (mass/volume concentration) Ago-Gel electricity Swimming analysis.As a result as shown in Figure 3.As it can be seen that external source HYG segment is successfully integrated into 2630 genome of R.babjevae NCYC In.

The Western blot of 2630 hygromycin transformant of 5.R.babjevae NCYC is analyzed

In addition to directly determining that round rhodosporidium toruloides PHO89 promoter can star hygromycin using hygromycin resistance phenotype Resistant gene is outside the expression of R.babjevae NCYC 2630, since the end C- of hygromycin gene expression product carries 6 × His Tag also determines the expression of corresponding albumen using anti-His Tag antibody by Western blot analysis.Above-mentioned PCR Identify that correct 6 transformants, 3 transformants of random picking, access 10mL contain the phosphate limitation training of 50ng/ μ L hygromycin It supports in base, is centrifuged 10min collection bacterial strain in 30 DEG C of shaking table cultures 48h, 4000r/min.The sterile water washing one of the thallus of acquisition All over after, be added 400 μ L protein extract buffer (8M urea, 65mM DTT, 0.1%Triton X-100,100mM NaCl, 50mM Tris-Cl, 1mM PMSF, 1mM EGTA, 1mM EDTA, pH 7.4) it is resuspended, add the pickling glass of equal volume Pearl.Using bead broken wall method smudge cells extract total protein of cell (the 13rd chapter of the fine works molecular biology experiment guide third edition, Ao Sibai etc. writes, and face sub- grain husk etc. is translated, and Science Press publishes).After total protein of cell is separated on 12%SDS-PAGE glue, (Solarbio, Beijing, China) is transferred on nitrocellulose filter, it is (green purchased from Shanghai using the anti-His-tag antibody of mouse Skies Bioisystech Co., Ltd) and horseradish peroxidase-labeled goat anti-mouse IgG (be purchased from the green skies biotechnology in Shanghai Co., Ltd) it is used as primary antibody and secondary antibody, DAB horseradish peroxidase colour reagent box (has purchased from the green skies biotechnology in Shanghai Limit company) it develops the color, the expression (Fig. 4) of hygromycin gene can be observed.

Embodiment 9: the URA3 of round rhodosporidium toruloides ATCC 10788 is carried out using PHO89p-BLE-PHO89t expression cassette The inducing expression of gene knockout and BLE

Herein using circle rhodosporidium toruloides URA3 gene as integration site, by RF cloning process, so that " PHO89p- 5 ' and 3 ' ends of BLE-PHO89t " expression cassette carry the circle rhodosporidium toruloides URA3 homologous recombination arm of about 1500bp, The screening for carrying out transformant is marked using BLE resistance screening.

1. the acquisition of circle rhodosporidium toruloides URA3 gene

According to circle rhodosporidium toruloides URA3 (orotidine-5'-phosphate decarboxylase) gene order (NCBI accession number: KB722658.1, EU693529.1) designs special primer: URA3-P1:5 '- TGGCTCCAATGAGTCGTTGCTTCCAGCGC-3 ' and URA3-P2:5 '-CAAGGAGAGAGGCGTTAAGCCTAAAG-3 ', To justify 10788 genome of rhodosporidium toruloides ATCC as template, amplification, which obtains, contains URA3 promoter, reading frame and terminator Full-length genome sequence.After DNA QIAquick Gel Extraction Kit purified pcr product, it is cloned into pMD18-T carrier, is transformed into large intestine Bacillus (E.coli) DH5 α competent cell.It selects Amp resistant transformants and carries out Zengjing Granule, plasmid extraction.Recombinant plasmid sample Product send to Dalian TakaRa company and are sequenced, and sequence results are compared with gene order-checking result, it was demonstrated that include URA3 promoter, terminate The DNA sequence dna of son and reading frame (as shown in SEQ ID NO:8, URA3p-URA3-URA3t).The plasmid is named as T-URA3.

2.RF cloning process constructs PHO89p-BLE-PHO89t expression cassette

With pPICZ α A (being purchased from Invitrogen) for template, pair of primers BLE-RF-p1:5 '-is utilized CTCCTGCCAGCAGCCAACCGTCGTCAAGatggccaagttgaccagtgccg-3 ' and BLE-RF-p2:5 '- CCAAGGACCGGAAGACGAATGGAACCAAGtcagtcctgctcct cggccacg-3 ' carries out PCR amplification.According to implementation BLE (SEQ ID NO:9) is inserted by RF cloning process described in example 7 using T-PHO89p-hyg-PHO89t as skeleton Between pRtPHO89 and RtPHO89t, the plasmid being built into is named as T-PHO89p-BLE-PHO89t.

3.URA3-BLE knocking out the building of box

Using primer URA3-PHO89-BLE-RF-P1:5 '-CTTGTCTTCTACAGTATATCCCTAAATTcaaccggt Tgcgataatagcacaccatgc-3 ' and URA3-PHO89-BLE-RF-P2:

5 '-CTGCCCTTCACTCATCAATTACCAatctgcgcaggttgaatggtagcgg-3 ' are primer, carry out PCR Amplification.According to RF cloning process described in embodiment 3, using T-URA3 as skeleton, by " PHO89p-BLE-PHO89t " expression cassette It is inserted into RtURA3, resulting sequence (pURA3-PHO89-BLE- as shown in SEQ ID NO:10 after Takara is sequenced URA3t), the plasmid being built into is named as T-URA3-PHO89-BLE, and structure is as shown in Figure 7.Recombinant plasmid sample is sent to Dalian The sequencing of TakaRa company, sequence results are compared with gene order-checking result, it was demonstrated that the genetic fragment is that both ends have 1500 bp " URA3-PHO89-BLE-URA3 " that URA3 recombinates arm knocks out box.

A large amount of preparations of 4.URA3-PHO89-BLE-URA3 knockout box

Using T-URA3-PHO89-BLE plasmid as template, using URA3-P1 and URA3-P2 as primer, " URA3- is carried out A large amount of preparations of PHO89-BLE-URA3 " knockout box.PCR system (500 μ L): 10 × Speed buffer (Dalian TakaRa) 50.0 μ L, dNTPs (10mmol/L) 10.0 μ L, upstream primer (10 μm of ol/L) 20.0 μ L, downstream primer (10 μm of ol/L) 20.0 μ L, SpeedSTAR HS DNA polymerase (amplification rate is fast, 1kb/10s, is purchased from Dalian TakaRa company) 5.0 μ L, genome DNA template (120ng/ μ L) 15.0 μ L, ddH₂O adds to 500 μ L, dispenses after mixing.Reaction condition: 98 DEG C of 1min, 98 DEG C 10s, 65 DEG C of 60s, 35 circulations, 72 DEG C of 10min, 4 DEG C reaction was completed.

PCR product utilizes PCR fragment purification kit after the analysis of 1% (mass/volume concentration) agarose gel electrophoresis (purchased from raw work) is purified.DNA fragmentation concentration after purification is 500ng/ μ L, totally 60 μ L, and -20 DEG C save backup.

5. circle 10788 competent cell of rhodosporidium toruloides ATCC preparation

The preparation of circle 10788 competent cell of rhodosporidium toruloides ATCC: circle rhodosporidium toruloides ATCC 10788 chooses bacterium colony It is inoculated with 10ml YEPD culture medium (glucose 20.0g/L, yeast extract 10.0g/L, peptone 20.0g/L, pH6.0), 30 DEG C, 200rpm cultivates 20h；The fresh YEPD culture medium of culture 1:50 ratio switching, 100mL (500mL conical flask, liquid amount 100mL), 30 DEG C, 200rpm, 6-9h is cultivated, OD value reaches 0.6-1.2；Culture ice bath 10-30min, 4 DEG C, 4000r/min It is centrifuged 5min, abandons supernatant；0 DEG C of sterile Milli-Q is washed 1 time；0 DEG C 1mol/L sorbitol washes 2 times；Ice bath, it is spare.Take 100 μ L justifies 10788 competent cell of rhodosporidium toruloides ATCC, and " URA3-PHO89-BLE-URA3 " is added and knocks out 10 μ L (5 μ in total of box G), pre-cooling is moved into after mixing into 0 DEG C of electric shock cup, parameter: 0.8-2.0 kilovolts of voltage, 200 Ω of resistance, 25 μ F of capacitor, when Between 4-8 ms；The YEPD of 1mL sorbierite containing 1M, 30 DEG C of incubation 1-2h is added after electric shock immediately；Coating contains 1 M sorbierite YEPD- Zecine plate (μ of 50ng/ containing bleomycin L), 30 DEG C of cultures 5 days or more, sub- appearance to be transformed.

6. the bacterium colony PCR of transformant is identified

Blasticidin resistance transformant is inoculated with 10ml YEPD fluid nutrient medium.It is mentioned referring to bead broken wall method in embodiment 3 Genomic DNA is taken, PCR identification is carried out using BLE-RF-p1 and BLE-RF-p2.PCR system (25 μ L): 10 × PCR buffer (Dalian TakaRa) 2.5 μ L, dNTPs (2.5mmol/l) 2.0 μ L, upstream primer (10 μm of ol/l) 1.0 μ L, downstream primer (10 μ Mol/l) 21.0 μ L, rTaq DNA polymerase (Dalian TakaRa), 0.5 μ L, genomic DNA (20ng/ μ L) 1 μ L, ddH₂O is added to 25 μL.Reaction condition: 95 DEG C of 3min, 95 DEG C of 30s, 55 DEG C of 30s, 72 DEG C of 1min, 35 circulations, 72 DEG C of 10min, 4 DEG C terminate instead It answers.PCR product is analyzed through 1% (mass/volume concentration) agarose gel electrophoresis.The results show that all round rhodosporidium toruloides The amplifiable external source BLE genetic fragment out of 10788 recombinant bacterial strain of ATCC, and control strain circle rhodosporidium toruloides ATCC 10788 Then without corresponding PCR product (not shown).

Phenotype verifying further is carried out to the correct transformant of above-mentioned identification.5 '-FOA resistant phenotypes analysis the results show that This uracil auxotrophy circle rhodosporidium toruloides engineered strain is in limit phosphorus culture medium (0.1%5 '-FOA, the Portugal for containing 5 '-FOA Grape sugar 70g/L, (NH₄)₂SO₄0.1g/L, yeast powder 0.75g/L, KH₂ PO₄0.06g/L, MgSO₄·7H₂O 1.5g/L, pH 6.0) on can normal growth, and the R. toruloides ATCC 10788 of wild type is then in the culture medium for containing 5 '-FOA It can not grow.

Therefore, from genotype to phenotype, lacking for circle 10788 recombinant bacterial strain URA3 gene of rhodosporidium toruloides ATCC is verified It loses.

The expression analysis (transcriptional level expression analysis, RT-PCR) of 7.Ble gene

In addition to directly determining that round rhodosporidium toruloides PHO89 promoter can star Bo Lai using bleomycin resistance phenotype Expression (expression that bleomycin resistance phenotype be decided by Lay mycin resistant gene) of the mycin resistant gene in circle rhodosporidium toruloides Outside, the expression of the transcriptional level of bleomycin resistance gene ble is also had detected using RT-PCR method.

The 2 plants of bacterium colony PCR identifications of random picking and the correct blasticidin resistance transformant of phenotypic analysis are inoculated with 10mL phosphorus Hydrochlorate limits culture medium (30g/L glucose, 5g/L ammonium sulfate, 0.64g/L potassium sulfate, 0.08 g/L, 12 hypophosphite monohydrate hydrogen two Sodium, 0.94g/L sodium sulphate, 1.5g/L epsom salt pH 6.0), Fiber differentiation 48h.Cell is extracted referring to 1 method of embodiment Total serum IgE carries out reverse transcription (RT) referring to 2 method of embodiment and utilizes BLE-p1 using synthesized the first chain of cDNA as template: ATGGCCAAGTTGACCAGTGCCG and BLE-p2:TCAGTCCTGCTCCTCGGC CACG is that primer carries out PCR amplification.PCR body It is (25 μ L): 10 × Ex Taq buffer (Dalian TakaRa) 2.5 μ L, dNTPs (10mmol/l) 0.5 μ L, upstream primer 0.25 μ L of BLE-p1 (10 μm of ol/l) 1.0 μ L, downstream primer BLE-p2 (10 μm of ol/l) 1.0 μ L, Ex Taq archaeal dna polymerase, The first chain of cDNA template 1.0 μ L, ddH₂O adds to 25 μ L.Reaction condition: 98 DEG C of 1min, 98 DEG C of 10s, 65 DEG C of 60s, 35 are followed Ring, 72 DEG C of 10min, 4 DEG C reaction was completed.The results show that all round 10788 recombinant bacterial strains of rhodosporidium toruloides ATCC are amplifiable 0.3kb BLE genetic fragment out, and control strain circle rhodosporidium toruloides ATCC 10788 is then without corresponding PCR product (Fig. 5).

Embodiment 10: the building of double expression boxes PHO89 promoter vector

The building of the mono- expression cassette carrier of 1.pZPK-Ppho89-hyg-Thsp

Using the R.toruloides CGMCC2.1389 genomic DNA prepared in embodiment 3 as template, primer is utilized HSPt-H1:CGAAAGAACACCACCATCACCATCACTAGacgattccgcccc gtctcacctcgcat and HSPt-H2: GCATGCTGCAGGTCGACTCTAGAGGATCC cgcgcacttctctgcactgcatctttg, amplification obtain Thsp terminator Sequence (SEQ ID NO:11), PCR product use RF cloning process (such as after purification through DNA plastic recovery kit (purchased from raw work) Shown in embodiment 7) by Thsp terminate sub-piece displacement PZPK-PHO89p-hyg-PHO89t carrier Tpho89 terminator, Carrier obtained is named as PZPK-PHO89p-hyg-Thsp, and structure is as shown in Figure 6.

2. the introducing of multiple cloning sites and the building of the mono- expression cassette carrier of pZPK-Ppho89-MCS-Thsp

Select pZPK-pPGK-hyg-Tnos carrier (Lin XP, Wang YN, Zhang SF, et al.Fems Yeast Res.2014,14:547-555) and the PZPK-PHO89p-HYG-Thsp carrier of previous step building in 3 enzymes not containing Enzyme site EcoR V, Nco I, Spe I design multiple cloning sites MCS (Multiple Cloning Site).It is cloned with reference to RF The long strand primer PHO89- that principle, directly design two are completely reversed complementation and V containing EcoR, Nco I, Spe I restriction enzyme site HSPt-H1:5 '-gcagccaaccgtcgtcaagGATATCCCATGGACTAGTacgattccgccccgtctca -3 ' and PHO89-HSPt-H1:5 '-tgagacggggcggaatcgtACTAGTCCATGGGATATC cttgacgacggttggctgc-3 ' As big primer (mega-primer), equimolar is with pZPK-pPGK-hyg-Tnos carrier than RFII reaction system is added Carrier is sent out, MCS segment is replaced the PZPK- that previous step constructs by directly progress RF II clone (as shown in Example 7) The hyg ORF of PHO89p-HYG-Thsp carrier, constructed carrier are named as pZPK-Ppho89-MCS-Thsp.Structure such as Fig. 7 It is shown.

3. the building of the double expression boxes inducible expression carrier based on Ppho89 promoter

Using pZPK-Ppho89-MCS-Thsp carrier as template, primer PHO89-HSPt-p1:5 '-is utilized AGCTTGAGCTTGGATCAGATTGTCGTTTCGAGGGATCTTCCCTCGCTTT GAC-3 ' and PHO89-HSPt-p1:5 '- CAAACACTGATAGTTTAAACTGAAGGCGGCGCGCACTTCTCTGCACTG CATC-3 ' carries out " Ppho89-MCS-Thsp " The amplification of expression cassette, PCR product are (strictly according to the facts using RF cloning process after purification through DNA glue recovery purifying kit (purchased from raw work) Apply shown in example 7) Thsp terminates to sub-piece is equidirectional is inserted in pZPK-pPGK-hyg-Tnos carrier (Lin XP, Wang YN, Zhang SF, et al.Fems Yeast Res.2014,14:547-555) " pPGK-hyg-Tnos " expression cassette and RB Between, there is the interval sequence of 100bp or so between " pPGK-hyg-Tnos " expression cassette (abbreviation HYG) and " Ppho89-MCS-Thsp " Column, carrier obtained are named as PZPK-HYG-Ppho89-MCS-Thsp, and structure is as shown in Figure 8." the pPGK- of the carrier Hyg-Tnos " expression cassette is for screening recon, and " Ppho89-MCS-Thsp " is then for the insertion clone of target gene and induction Expression.

Embodiment 11: expression of the fatty acid hydroxylase in lock Sporobolomyces S.pararoseus JCM 3765

Ricinoleic acid (12-hydroxy-octadeca-cis-9-enoic acid:C18:1-OH) is a kind of very valuable The essential industry raw material of value.Existing source is mainly that plant is squeezed, but resource is restricted.From pathogenic epiphyte --- Ergot (Claviceps purpurea) oleate hydroxylase gene (CpFAH, Genbank registration number: EU661785) is in micro- life Expression in object can provide a new approach for the supply of ricinoleic acid.Oleate hydroxylase base is carried out using Ppho89 promoter Because of the inducing expression of CpFAH, to realize the purpose of the synthetic castor oil acid in circle rhodosporidium toruloides.

The building of 1.CpFAH phosphate starvation induction expression vector

This gene, sequence are synthesized according to the raw work full genome in CpFAH (EU661785) gene commission Shanghai reported on NCBI As shown in SEQ ID NO:12 (CpFAH).Primer CpFAH-NcoI-E1:5 '- CggCCATGGACatggcttccgctactcctgcaatg-3 ' and CpFAH-NcoI-E2:5 '- CCGACTAGTctaGTGGTGGTGGTGGTGGTGctgagtcttcattgaaat-3 ' is primer, carries out PCR amplification.PCR amplification Product utilization DNA glue recovery purifying kit (purchased from raw work) is purified, and carries out double digestion using Nco I, Spe I, and The pZPK-HYG-Ppho89-MCS-Thsp into same Nco I, Spe I processing is connected, promoter Ppho89 and termination are inserted in Between sub- Thsp, the phosphate starvation induction expression vector pZPK-HYG-Ppho89- of success structuring fatty acid hydroxylase CpFAH-Thsp, structure are as shown in Figure 9.The C-terminal for recombinantly expressing fatty acid hydroxylase introduces 6 × His Tag, can be used for Western blot operation.

2. the building of the Agrobacterium tumefaciens attachment containing pZPK-HYG-Ppho89-CpFAH-Thsp carrier

Constructed pZPK-HYG-Ppho89-CpFAH-Thsp carrier is converted using electroporated method to Agrobacterium AGL1 In, in picking transformant on the LB plate containing 50ng/ μ L kanamycins.Kalamycin resistance Agrobacterium-mediated Transformation uses first The method of bacterium colony PCR is verified.Correct transformant is verified, AGL1/ZPK-HYG-Ppho89-CpFAH-Thsp is named as, It saves backup.

3.CpFAH is integrated into lock 3765 chromosome of Sporobolomyces S.pararoseus JCM through ATMT

Intend pink lock shadow yeast (S.pararoseus) JCM3765 purchased from China General Microbiological culture presevation management The heart (CGMCC).S.pararoseus JCM 3765 after taking a ring to activate, is inoculated in 5mL YEPD (glucose 20.0g/L, ferment Female extract 10.0g/L, peptone 20.0g/L, pH 6.0) in, 25 DEG C, 200r/min is incubated overnight.With sterile water washing one After, it is adjusted to OD₆₀₀=1-2, it is spare.

Step 2 obtain recombinational agrobacterium AGL1/ZPK-HYG-Ppho89-CpFAH-Thsp be inoculated in 5 mL contain card that In the LB liquid of mycin (100ng/ μ L) and rifampin (80ng/ μ L), 250 DEG C, 200r/min overnight incubation.With sterile washing It washs one time, is adjusted to OD₆₀₀=1-3, it is spare.

Take it is above-mentioned intend pink lock shadow yeast JCM 3765 and each 200 μ L of Agrobacterium dilution, mix, directly drip in induction Plate (5mmol/L glucose, 0.5% glycerol, 1.45g/L potassium dihydrogen phosphate, 2.05g/L dipotassium hydrogen phosphate, 0.15g/L chlorination Sodium, 0.5g/L epsom salt, 66mg/L calcium chloride dihydrate, 2.48 g/L green-vitriols, 0.5g/L ammonium sulfate, 40mmol/L MES (2- (N- morpholine) ethanesulfonic acid), 2% agar powder, 200 μm of ol/L acetosyringones) surface filter membrane on, 25 DEG C, culture 2 It.Filter membrane is transferred to induction screening flat board (50ng/ μ L hygromycin, 300 μ g/mL cephalos from IM induction plate by aseptic nipper Rhzomorph, 30g/L glucose, 5g/L ammonium sulfate, 0.64g/L potassium sulfate, 0.08g/L disodium hydrogen phosphate dodecahydrate, 0.94g/L sulphur Sour sodium, 1.5g/L epsom salt, agar powder 1.5g/L, PH 6.0) on, 48h is cultivated in 30 DEG C of inversions, until transformant occurs.

4. intending the bacterium colony PCR identification of the pink lock hygromycin resistant transformed son of shadow yeast JCM 3765

6 3765 transformant of geneticin resistant S.pararoseus JCM access 50mL of random picking contain 50ng/ μ Limit phosphorus induced medium (50ng/ μ L hygromycin, 30g/L glucose, the 5g/L ammonium sulfate, 0.64g/L sulfuric acid of L Geneticin Potassium, 0.08g/L disodium hydrogen phosphate dodecahydrate, 0.94g/L sodium sulphate, 1.5g/L epsom salt, PH 6.0) on, with reference to reality It applies bead broken wall method described in example 3 and extracts genomic DNA, use CpFAH-NcoI-E1 and CpFAH-NcoI-E2 for primer, Carry out PCR identification.The results show that CpFAH is successfully integrated into 3765 genome (not shown) of S.pararoseus JCM.

5. the fermenting experiment that pink lock shadow yeast JCM 3765 produces ricinoleic acid is intended in recombination

3 bacterium colony PCR identifications of picking correctly intend pink 3765 transformant single colonie of lock shadow yeast JCM and are connected to 5ml In YEPD culture medium (glucose 20.0g/L, yeast extract 10.0g/L, peptone 20.0g/L, pH 6.0).Culture for 24 hours, with The inoculum concentration of 1:50 is connected to limit phosphorus induced medium (the 50ng/ μ L hygromycin, 30g/L grape that 50mL contains 50ng/ μ L hygromycin Sugar, 5g/L ammonium sulfate, 0.64g/L potassium sulfate, 0.08g/L disodium hydrogen phosphate dodecahydrate, 0.94g/L sodium sulphate, 1.5g/L seven Water magnesium sulfate, PH 6.0) in, as secondary seed.After secondary seed culture for 24 hours, take 5mL that the limit phosphorus Fiber differentiation of 45mL is added In base.Terminate fermentation after cultivating 96h.40mL zymocyte liquid is taken to be placed in 50mL round bottom centrifuge tube, 8000r/min room temperature is centrifuged 5min Thallus is collected, is washed with deionized 2 times, 105 DEG C are dried for 24 hours to constant weight.It is cooling in drier after taking-up, then weigh note The ratio of 6ml 4mol/L hydrochloric acid is added in record in 1g dry mycelium after weighing, 4mL 4mol/L hydrochloric acid is added in every pipe, and 78 DEG C of water-baths disappear Change 1h, the chloroform/methanol (1:1, v/v) of 2 times of volumes is added after cooling, sufficiently oscillation mixes, and is centrifuged after extracting 1h, takes chloroform layer It is put into a new centrifuge tube.Water phase is extracted once again with isometric chloroform, is sufficiently centrifuged after oscillation, chloroform layer is taken to be put into Merge in above-mentioned new centrifuge tube, and isometric 0.1% sodium chloride solution is added, oscillation is centrifuged after mixing.With syringe will under Layer organic phase carefully extracts and injects in preprepared glass funnel that (funnel fills in degreasing cotton in advance, and is added appropriate Anhydrous sodium sulfate), it is flowed into substantially to organic solution in funnel in the glass oil bottle of lower section, suitable chloroform is added and rinses funnel 4 Time, it is flowed into the oil bottle of lower section together, extraction has the chloroform of grease to carry out Grease Collection using Rotary Evaporators, will have collected grease Oil bottle be put into baking oven drying for 24 hours.

Esterification is carried out to bacterium oil: weighing the grease to be measured of 70.0mg, the CH containing 5%KOH is added₃OH solution 0.5mL, It is heated to reflux 50min, BF is then added₃Methanol solution (V_{BF3 diethyl ether solution}: V_CH3OH=4:10) 0.7mL, continues the 10min that flows back. 1mL deionized water and 0.7mL n-hexane are added after cooling, organic phase is sucked out after mixing, is used for after deionized water is washed twice Gas chromatographic analysis.

6. the detection that pink lock shadow yeast JCM 3765 produces ricinoleic acid is intended in recombination

The transesterification obtained sample of step 7 is dissolved in n-hexane, using document (Meesapyodsuk, D., and Qiu, X.Plant Physiol., 2008,147,1325-1333.) method in is detected, and standard items are ricinoleic acid first Ester (CAS:141-24-2), negative control are the transesterification product of grease that wild type intends pink lock shadow yeast JCM 3765.As a result It has been shown that, be transferred to CpFAH gene intend truly have ricinoleic acid to generate in pink lock shadow yeast JCM 3765, content be 280 μ g/ Ml, total amount account for 62% or more of overall free fatty acid content.

7. CpFAH expression analysis --- Western blot in pink lock shadow yeast JCM 3765 is intended in recombination

Determine that round rhodosporidium toruloides Ppho89 promoter can star oil in addition to directly producing phenotype by ricinoleic acid Sour '-hydroxylase gene is outside the expression of lock Sporobolomyces, since the end C- of oleate hydroxylase gene expression product carries 6 × His Tag also passes through the expression of immunoblotting assay oleate hydroxylase gene using anti-His Tag antibody.PCR in above-mentioned steps 4 Identify that correct 6 transformants, random picking 3 access limit phosphorus induced medium (the 50ng/ μ L hygromycin, 30g/L of 10mL Glucose, 5g/L ammonium sulfate, 0.64g/L potassium sulfate, 0.08g/L disodium hydrogen phosphate dodecahydrate, 0.94g/L sodium sulphate, 1.5g/L epsom salt, PH 6.0) in, 10min collection bacterial strain is centrifuged in 30 DEG C of shaking table cultures 48h, 4000r/min.Thallus After sterile water washing one time, protein extract buffer (8M urea, 65mM DTT, the 0.1%Triton X- of 400 μ L is added 100,100mM NaCl, 50mM Tris-Cl, 1mM PMSF, 1mM EGTA, 1mM EDTA, pH 7.4) it is resuspended, by embodiment 8 Step 5 carry out SDS-PAGE and Western blot analysis, the expression (Figure 10) of oleate hydroxylase can be observed.

Embodiment 12: expression of the malate dehydrogenase in Sporobolomyces Sporobolomyces roseus

Malate dehydrogenase (Malic enzyme, ME) is the main generation enzyme of NADPH, provides reducing power for oil synthesis.I Carry out the oil fermentation of pink shadow yeast (S.roseus) JCM 8242 using phosphorus restriction strategy and when metabolic components are analysed is sent out Existing, when limiting phosphorus chemostat cultivation, pink shadow yeast JCM 8242 can accumulate 42% grease intracellular, and metabolic components analysis result mentions Show that NADPH has lowered up to ten thousand times compared with the rich medium chemostat culture of phosphorus abundance.If be overexpressed when phosphorus is limited and cultivated Malate dehydrogenase increases the supply of NADPH, and the fat content intracellular of bacterial strain theoretically can be improved.

1. the building of circle rhodosporidium toruloides malate dehydrogenase RtME phosphate starvation induction expression vector

It is special according to Scaffold sequence (NCBI accession number: KB722664.1), design where circle rhodosporidium toruloides ME gene Different primer: ME-P1:5 '-atgcccgcacactttgccccctcccagc-3 ' and ME-P2:5 '- Atgcccgcacactttgccccctcccagccc-3 ', it is total with the circle rhodosporidium toruloides CGMCC 2.1389 that embodiment 1 obtains RNA is template, carries out RT-PCR by method shown in embodiment 2, amplification obtains the full length cDNA sequence containing ME.It is returned using DNA After receiving kits PCR product, it is cloned into pMD18-T carrier, it is thin to be transformed into Escherichia coli (E.coli) DH5 α competence Born of the same parents.It selects Amp resistant transformants and carries out Zengjing Granule, plasmid extraction.Recombinant plasmid sample send to Dalian TakaRa company and is sequenced, Sequence results are compared with gene order-checking result, it was demonstrated that include ME encoding gene overall length, sequence such as SEQ ID NO:13 institute Show, (RtME).The plasmid is named as T-ME.

Design primer ME-NcoI-E1:5 '-cggCCATGGACatgcccgcacactttgccccctccca Gcccctcca-3 ' and ME-NcoI-E2:5 '-CCGACTAGTctaGTGATGGTGATGGTGGTG ctgcgcctgctgct-3 ', Using T-ME as template, PCR amplification is carried out.Pcr amplification product is carried out pure using DNA glue recovery purifying kit (purchased from raw work) Change, and carry out double digestion using Nco I, Spe I, and connects the pZPK-HYG-Ppho89- into same Nco I, Spe I processing MCS-Thsp is inserted between promoter Ppho89 and terminator Thsp, successfully constructs the phosphate starvation induction of malate dehydrogenase Expression vector pZPK-HYG-Ppho89-ME-Thsp, shown (pZPK-HYG-Ppho89-ME-Thsp), structure such as Figure 11 institute Show.The C-terminal for recombinantly expressing fatty acid hydroxylase introduces 6 × His Tag, can be used for Western blot operation.

2. the building of the Agrobacterium tumefaciens attachment containing pZPK-HYG-Ppho89-ME-Thsp carrier

Constructed pZPK-HYG-Ppho89-ME-Thsp carrier is converted using electroporated method into Agrobacterium AGL1, In picking transformant on the LB plate containing 50ng/ μ L kanamycins.Kalamycin resistance Agrobacterium-mediated Transformation uses bacterium first The method for falling PCR is verified.Correct transformant is verified, AGL1/ZPK-HYG-Ppho89-ME-Thsp is named as, is saved It is spare.

3.ME is integrated into pink 8242 chromosome of shadow yeast JCM of Sporobolomyces through ATMT

Pink shadow yeast (Sporobolomyces roseus) JCM 8242 is purchased from Japanese Microbiological Culture Collection The heart (JCM).S.roseus JCM 8242 after taking a ring to activate, being inoculated in 5ml YEPD, (glucose 20.0g/L, yeast extract Object 10.0g/L, peptone 20.0g/L, pH6.0) in, 25 DEG C, 200r/min is incubated overnight.After sterile water washing one time, adjust It saves to OD₆₀₀=1-2, it is spare.

The recombinational agrobacterium AGL1/ZPK-HYG-Ppho89-ME-Thsp that step 2 obtains is inoculated in 5mL and contains card that is mould In the LB liquid of plain (100ng/ μ L) and rifampin (80ng/ μ L), 250 DEG C, 200r/min overnight incubation.With sterile water washing One time, it is adjusted to OD₆₀₀=1-3, it is spare.

Above-mentioned pink shadow yeast JCM 8242 and each 200 μ L of Agrobacterium dilution is taken, is mixed, by 13 step 3 of embodiment ATMT operation is carried out, until transformant occurs.

4. the bacterium colony PCR of the hygromycin resistant transformed son of pink shadow yeast JCM 8242 is identified

6 8242 transformant of geneticin resistant S.roseus JCM access 50ml of random picking contain 50 ng/ μ L something lost Pass mycin limit phosphorus induced medium (50ng/ μ L hygromycin, 30g/L glucose, 5g/L ammonium sulfate, 0.64g/L potassium sulfate, 0.08g/L disodium hydrogen phosphate dodecahydrate, 0.94g/L sodium sulphate, 1.5g/L epsom salt, PH 6.0) on, reference implementation Bead broken wall method described in example 3 extracts genomic DNA, uses ME-NcoI-E1 and ME-NcoI-E2 for primer, carries out PCR mirror It is fixed.The results show that ME encoding gene is successfully integrated into 8242 genome (not shown) of S.roseus JCM.

5. recombinating pink 8242 oil fermentation of shadow yeast S.roseus JCM

3 bacterium colony PCR of picking identify correctly pink 8242 transformant single colonie of shadow yeast JCM, by 11 step of embodiment Method shown in rapid 5 is fermented, grease intracellular extracts and analysis.The results show that compared with wild strain S.roseus JCM 8242, the fat content intracellular of recombination S.roseus JCM 8242 for being overexpressed round rhodosporidium toruloides malate dehydrogenase is mentioned by 42% Height increases 62% to 68%.

6. recombinating ME expression analysis --- Western blot in S.roseus JCM 8242

Determine that round rhodosporidium toruloides Ppho89 promoter can star circle in addition to directly increasing performance by oil and fat accumulation Rhodosporidium toruloides malate dehydrogenase (RtME) gene is outside the expression of lock Sporobolomyces, since the end C- of RtME expression product is taken Band 6 × His Tag also passes through the expression of immunoblotting assay ME using anti-His Tag antibody.PCR reflects in above-mentioned steps 4 Fixed correct 6 transformants, random picking 3 access limit phosphorus induced medium (the 50ng/ μ L hygromycin, the Portugal 30g/L of 10mL Grape sugar, 5g/L ammonium sulfate, 0.64 g/L potassium sulfate, 0.08g/L disodium hydrogen phosphate dodecahydrate, 0.94g/L sodium sulphate, 1.5g/L Epsom salt, PH 6.0) in, 10min collection bacterial strain is centrifuged in 30 DEG C of shaking table cultures 48h, 4000r/min.Thallus is with sterile After water washing one time, be added 400 μ L protein extract buffer (8M urea, 65mM DTT, 0.1%Triton X-100, 100mM NaCl, 50mM Tris-Cl, 1mM PMSF, 1mM EGTA, 1mM EDTA, pH 7.4) it is resuspended, by the step of embodiment 8 Rapid 5 carry out SDS-PAGE and Western blot analysis, and the expression (Figure 12) of RtME can be observed.

Phosphorus of the embodiment 13:GFP in Rhodotorula rhodothece rubra CGMCC 2.279 derepresses inducing expression

It is unintelligible in view of rhodothece rubra genetic background, own promoter can not be separated and terminate subcomponent progress target gene Expression, this technology invention establishes rhodothece rubra heredity using circle rhodosporidium toruloides Ppho89 promoter and Thsp terminator Operation system realizes inducing expression of the GFP in rhodothece rubra CGMCC 2.279.

The building of 1.GFP phosphate starvation induction expression vector

According to the amino acid sequence (AFA52654.1) of the GFP reported on NCBI, by circle rhodosporidium toruloides codon preference Property optimize, the raw work full genome in commission Shanghai synthesizes its gene, and sequence is as shown in SEQ ID NO:16 (GFP).Primer GFP- NcoI-E1:5 '-cggCCATGGACatgtcgaagggtgaggagcttttc-3 ' and GFP-NcoI-E2:5 '- CCGACTAGTctaGTGGTGGTGGTGGTGGTGcttgtagagttcgtccatgccgtg-3 ' is primer, carries out PCR amplification. Pcr amplification product is purified using DNA glue recovery purifying kit (purchased from raw work), and double using Nco I, Spe I progress Digestion, and the pZPK-HYG-Ppho89-MCS-Thsp into same Nco I, Spe I processing is connected, it is inserted in promoter Between Ppho89 and terminator Thsp, the phosphate starvation induction expression vector pZPK-HYG- of green fluorescent protein is successfully constructed Ppho89-GFP-Thsp, structure are as shown in figure 13.The end C for recombinantly expressing green fluorescent protein introduces 6 × His Tag, can use It is operated in Western blot.

2. the building of the Agrobacterium tumefaciens attachment containing pZPK-HYG-Ppho89-GFP-Thsp carrier

Constructed pZPK-HYG-Ppho89-GFP-Thsp carrier is converted using electroporated method into Agrobacterium AGL1, In picking transformant on the LB plate containing 50ng/ μ L kanamycins.Kalamycin resistance Agrobacterium-mediated Transformation uses bacterium first The method for falling PCR is verified.Correct transformant is verified, AGL1/ZPK-HYG-Ppho89-GFP-Thsp is named as, is saved It is spare.

3.GFP being integrated into 2.279 chromosome of rhodothece rubra CGMCC through ATMT

Rhodothece rubra (Rhodotorula rubra) CGMCC 2.279 is purchased from barms collection (purchased from China General Microbiological Culture preservation administrative center (CGMCC).Rhodothece rubra CGMCC 2.279 after taking a ring to activate, is inoculated in In 5ml YEPD (glucose 20.0g/L, yeast extract 10.0g/L, peptone 20.0g/L, pH6.0), 25 DEG C, 200r/min It is incubated overnight.After sterile water washing one time, it is adjusted to OD₆₀₀=1-2, it is spare.

The recombinational agrobacterium AGL1/ZPK-HYG-Ppho89-GFP-Thsp that step 2 obtains is inoculated in 5ml and contains card that is mould In the LB liquid of plain (100ng/ μ L) and rifampin (80ng/ μ L), 250 DEG C, 200r/min overnight incubation.With sterile water washing One time, it is adjusted to OD₆₀₀=1-3, it is spare.

Take above-mentioned rhodothece rubra CGMCC 2.279 and each 200 μ L of Agrobacterium dilution, mix, by 13 step 3 of embodiment into Row ATMT operation, until transformant occurs.

4. the bacterium colony PCR of the hygromycin resistant transformed son of rhodothece rubra CGMCC 2.279 is identified

6 2.279 transformant of geneticin resistant rhodothece rubra CGMCC access 50ml of random picking contain 50ng/ μ L Geneticin limit phosphorus induced medium (50ng/ μ L hygromycin, 30g/L glucose, 5g/L ammonium sulfate, 0.64g/L potassium sulfate, 0.08g/L disodium hydrogen phosphate dodecahydrate, 0.94g/L sodium sulphate, 1.5g/L epsom salt, PH 6.0) on, reference implementation Bead broken wall method described in example 3 extracts genomic DNA, uses GFP-NcoI-E1 and GFP-NcoI-E2 for primer, carries out PCR Identification.The results show that GFP gene is successfully integrated into 2.279 genome (not shown) of rhodothece rubra CGMCC.

5. the Fluirescence observation of the hygromycin resistant transformed son of rhodothece rubra CGMCC 2.279

3 bacterium colony PCR of picking identify that the correct hygromycin resistant transformed sub- single colonie of rhodothece rubra CGMCC 2.279 is connected to In 5mL YEPD culture medium (glucose 20.0g/L, yeast extract 10.0g/L, peptone 20.0g/L, pH 6.0).Culture For 24 hours, with the inoculum concentration of 1:50 be connected to limit phosphorus induced medium that 50mL contains 50ng/ μ L hygromycin (50ng/ μ L hygromycin, 30g/L glucose, 5g/L ammonium sulfate, 0.64 g/L potassium sulfate, 0.08g/L disodium hydrogen phosphate dodecahydrate, 0.94g/L sulfuric acid Sodium, 1.5g/L epsom salt, PH6.0) in, as secondary seed.After secondary seed culture for 24 hours, 5mL is taken to be added 45mL's It limits in phosphorus induced medium.Terminate fermentation after cultivating 48h.Take 10 μ L point of bacterium solution in glass slide, covered is placed on fluorescence Microscope carries out green fluorescence observation, excitation wavelength 498nm, and launch wavelength 516 nm, GFP recombination rhodothece rubra can be observed green Color fluorescence, and compare wild type rhodothece rubra CGMCC 2.279 then (not shown) occurs in unstressed configuration.

6. recombinating GFP expression analysis --- Western blot in rhodothece rubra CGMCC 2.279

Exist in addition to directly determining that round rhodosporidium toruloides Ppho89 promoter can star GFP by green fluorescence phenotype It is also anti-using anti-His Tag since the end C- of recombination GFP carries 6 × His Tag outside the expression of Rhodotorula rhodothece rubra Body passes through the expression of immunoblotting assay GFP.PCR identifies that correct 6 transformants, random picking 3 connect in above-mentioned steps 4 Enter 10mL limit phosphorus induced medium (50ng/ μ L hygromycin, 30g/L glucose, 5g/L ammonium sulfate, 0.64g/L potassium sulfate, 0.08g/L disodium hydrogen phosphate dodecahydrate, 0.94g/L sodium sulphate, 1.5g/L epsom salt, PH 6.0) in, in 30 DEG C of shaking tables 48h is cultivated, 4000r/min is centrifuged 10min and collects bacterial strain.After thallus sterile water washing one time, the albumen that 400 μ L are added is mentioned Take buffer (8M urea, 65mM DTT, 0.1%Triton X-100,100mM NaCl, 50mM Tris-Cl, 1mM PMSF, 1mM EGTA, 1mM EDTA, pH 7.4) it is resuspended, SDS-PAGE and Western blot points are carried out by the step 5 of embodiment 8 Analysis, can be observed the expression (Figure 14) of GFP.

Phosphorus of the embodiment 14:GFP in Rhodotorula rhodotorula mucilaginosa CGMCC 2.22 derepresses inducing expression

It is unintelligible in view of rhodotorula mucilaginosa (Rhodotorula mucilaqinosa) genetic background, itself starting can not be separated Son and terminate subcomponent carry out target gene expression, this technology invention using circle rhodosporidium toruloides Ppho89 promoter and Thsp terminator establishes rhodothece rubra genetic manipulation system, realizes induction table of the GFP in rhodotorula mucilaginosa CGMCC 2.22 It reaches.

1.GFP is integrated into 2.22 chromosome of rhodotorula mucilaginosa CGMCC through ATMT

The recombination agriculture bar AGL1/ZPK-HYG-Ppho89-GFP-Thsp that 13 step 2 of embodiment obtains is inoculated in 5ml and contains In the LB liquid of kanamycins (100ng/ μ L) and rifampin (80ng/ μ L), 250 DEG C, 200r/min overnight incubation.With sterile Water washing one time, it is adjusted to OD₆₀₀=1-3, it is spare.

Rhodotorula mucilaginosa CGMCC 2.22 (is purchased from China General Microbiological culture presevation pipe purchased from barms collection Reason center (CGMCC).Take a ring activate after rhodotorula mucilaginosa CGMCC 2.22, be inoculated in 5ml YEPD (glucose 20.0g/L, Yeast extract 10.0g/L, peptone 20.0g/L, pH 6.0) in, 25 DEG C, 200r/min is incubated overnight.With sterile water washing After one time, it is adjusted to OD₆₀₀=1-2, it is spare.

Take above-mentioned rhodotorula mucilaginosa CGMCC 2.22 and each 200 μ L of Agrobacterium dilution, mix, by 13 step 3 of embodiment into Row ATMT operation, until transformant occurs.

2. the bacterium colony PCR of the hygromycin resistant transformed son of rhodotorula mucilaginosa CGMCC 2.22 is identified

6 2.279 transformant of geneticin resistant rhodothece rubra CGMCC access 50ml of random picking contain 50ng/ μ L Geneticin limit phosphorus induced medium (50ng/ μ L hygromycin, 30g/L glucose, 5g/L ammonium sulfate, 0.64g/L potassium sulfate, 0.08g/L disodium hydrogen phosphate dodecahydrate, 0.94g/L sodium sulphate, 1.5g/L epsom salt, PH 6.0) on, reference implementation Bead broken wall method described in example 3 extracts genomic DNA, uses GFP-NcoI-E1 and GFP-NcoI-E2 for primer, carries out PCR Identification.The results show that GFP gene is successfully integrated into 2.22 genome (not shown) of rhodotorula mucilaginosa CGMCC.

3. the Fluirescence observation of the hygromycin resistant transformed son of rhodotorula mucilaginosa CGMCC 2.22

3 bacterium colony PCR of picking identify the correct hygromycin resistant transformed sub- single colonie of rhodotorula mucilaginosa CGMCC 2.22 by real It applies 13 step 5 of example and carries out strain culturing and micro- sem observation, green fluorescence can be observed in GFP recombination rhodotorula mucilaginosa, and compares wild Then there is (not shown) to raw type rhodotorula mucilaginosa CGMCC 2.22 in unstressed configuration.

4. recombinating GFP expression analysis --- Western blot in rhodotorula mucilaginosa CGMCC 2.22

Exist in addition to directly determining that round rhodosporidium toruloides Ppho89 promoter can star GFP by green fluorescence phenotype It is also available since the end C- of recombination GFP carries 6 × His Tag outside the expression of Rhodotorula rhodotorula mucilaginosa CGMCC 2.22 Anti- His Tag antibody passes through the expression of immunoblotting assay GFP.PCR identifies correct 6 transformants in above-mentioned steps 3, with Machine picking 3, access 10mL limit phosphorus induced medium (50ng/ μ L hygromycin, 30g/L glucose, 5g/L ammonium sulfate, 0.64g/L potassium sulfate, 0.08g/L disodium hydrogen phosphate dodecahydrate, 0.94g/L sodium sulphate, 1.5g/L epsom salt, PH 6.0) in, 10min collection bacterial strain is centrifuged in 30 DEG C of shaking table cultures 48h, 4000r/min.After thallus sterile water washing one time, Protein extract buffer (8M urea, 65mM DTT, 0.1%Triton the X-100,100mM NaCl, 50mM of 400 μ L is added Tris-Cl, 1mM PMSF, 1mM EGTA, 1mM EDTA, pH 7.4) it is resuspended, SDS-PAGE is carried out by the step 5 of embodiment 8 It is analyzed with Western blot, the expression (Figure 15) of GFP can be observed.

Embodiment 15: expression of the fatty acid hydroxylase in Rhodotorula Rhodotorula marina

Oleate hydroxylase gene (CpFAH, Genbank registration number: EU661785) from ergot is opened in Ppho89 Synthesis of the ricinoleic acid by the sea in rhodotorula is realized under mover starting.

1.CpFAH is integrated into 2.4203 chromosome of Rhodotorula marina CGMCC through ATMT

The AGL1/ZPK-HYG-Ppho89-CpFAH-Thsp recombinational agrobacterium that 11 step 2 of embodiment obtains, is inoculated in 5mL In the LB liquid of (100ng/ μ L) and rifampin (80ng/ μ L) containing kanamycin, 250 DEG C, 200r/min overnight incubation.With nothing Bacterium water washing one time, it is adjusted to OD₆₀₀=1-3, it is spare.

Rhodotorula marina (Rhodotorula marina) CGMCC 2.4203 (is purchased from purchased from barms collection China General Microbiological culture presevation administrative center (CGMCC).Rhodotorula marina CGMCC 2.4203 after taking a ring to activate, connects Kind is in 5ml YEPD (glucose 20.0g/L, 10.0 g/L of yeast extract, peptone 20.0g/L, pH6.0), and 25 DEG C, 200r/min is incubated overnight.After sterile water washing one time, it is adjusted to OD₆₀₀=1-2, it is spare.

Above-mentioned quasi- Rhodotorula marina CGMCC 2.4203 and each 200 μ L of Agrobacterium dilution is taken, by 13 step 3 of embodiment ATMT operation is carried out, until transformant occurs.

2. the bacterium colony PCR of the hygromycin resistant transformed son of Rhodotorula marina CGMCC 2.4203 is identified

6 2.4203 transformant of geneticin resistant Rhodotorula marina CGMCC access 50mL of random picking contain 50ng/ Limit phosphorus induced medium (50ng/ μ L hygromycin, 30g/L glucose, the 5 g/L ammonium sulfate, 0.64g/L sulfuric acid of μ L Geneticin Potassium, 0.08g/L disodium hydrogen phosphate dodecahydrate, 0.94g/L sodium sulphate, 1.5g/L epsom salt, PH 6.0) on, with reference to reality It applies bead broken wall method described in example 3 and extracts genomic DNA, use CpFAH-NcoI-E1 and CpFAH-NcoI-E2 for primer, Carry out PCR identification.The results show that CpFAH is successfully integrated into 2.4203 genome (not shown) of Rhodotorula marina CGMCC.

3. recombinating the fermenting experiment that Rhodotorula marina CGMCC 2.4203 produces ricinoleic acid

3 bacterium colony PCR of picking identify that correct 2.4203 transformant single colonie of Rhodotorula marina CGMCC is connected to 5mL In YEPD culture medium (glucose 20.0g/L, yeast extract 10.0g/L, peptone 20.0g/L, pH 6.0).It cultivates for 24 hours, Limit phosphorus induced medium (the 50ng/ μ L hygromycin, the Portugal 30g/L that 50ml contains 50ng/ μ L hygromycin are connected to the inoculum concentration of 1:50 Grape sugar, 5g/L ammonium sulfate, 0.64g/L potassium sulfate, 0.08g/L disodium hydrogen phosphate dodecahydrate, 0.94g/L sodium sulphate, 1.5g/L Epsom salt, PH 6.0) in, as secondary seed.After secondary seed culture for 24 hours, take 5mL that the limit phosphorus induction training of 45mL is added It supports in base.Terminate fermentation after cultivating 96h.40mL zymocyte liquid is taken to be placed in 50mL round bottom centrifuge tube, the centrifugation of 8000r/min room temperature 5min collects thallus, is washed with deionized 2 times, 105 DEG C are dried for 24 hours to constant weight.It is carried out after taking-up by method shown in embodiment 11 Grease extracts and bacterium oil is transesterification.

4. recombinating the detection that Rhodotorula marina CGMCC 2.4203 produces ricinoleic acid

The transesterification obtained sample of step 7 is dissolved in n-hexane, using document (Meesapyodsuk, D., and Qiu, X.Plant Physiol., 2008,147,1325-1333.) method in is detected, and standard items are ricinoleic acid first Ester (CAS:141-24-2), negative control are the transesterification product of grease of wild type Rhodotorula marina CGMCC 2.4203.As a result it shows Show, be transferred in the Rhodotorula marina of CpFAH gene and ricinoleic acid is truly had to generate, content is 292 μ g/mL, and total amount accounts for overall free 63% or more of content of fatty acid.

5. recombinating CpFAH expression analysis --- Western blot in Rhodotorula marina CGMCC 2.4203

Determine that round rhodosporidium toruloides Ppho89 promoter can star oil in addition to directly producing phenotype by ricinoleic acid Sour '-hydroxylase gene is by the sea outside the expression of rhodotorula CGMCC 2.4203, due to the end C- of oleate hydroxylase gene expression product 6 × His Tag is carried, also passes through the expression of immunoblotting assay oleate hydroxylase gene using anti-His Tag antibody.It is above-mentioned PCR identifies that correct 6 transformants, random picking 3 access limit phosphorus induced medium (the 50ng/ μ L tide of 10ml in step 4 Mycin, 30g/L glucose, 5 g/L ammonium sulfate, 0.64g/L potassium sulfate, 0.08g/L disodium hydrogen phosphate dodecahydrate, 0.94g/L Sodium sulphate, 1.5g/L epsom salt, PH 6.0) in, 10min collection is centrifuged in 30 DEG C of shaking table cultures 48h, 4000r/min Bacterial strain.After thallus sterile water washing one time, be added 400 μ L protein extract buffer (8M urea, 65mM DTT, 0.1% Triton X-100,100mM NaCl, 50mM Tris-Cl, 1mM PMSF, 1mM EGTA, 1mM EDTA, pH 7.4) weight It is outstanding, SDS-PAGE and Western blot analysis is carried out by the step 5 of embodiment 8, the expression of oleate hydroxylase can be observed (not shown).

Embodiment 16: expression of the inulinase in Rhodotorula grass rhodotorula CGMCC 2.4202

Inulin is polyfructosan, and there are about 30000 various plants to contain Inulin polysaccharide in nature, and the world of inulin produces per year Amount is the second largest plant carbohydrates for being only second to starch up to 350000 tons.In the industry and as biomass material It is witloof and jerusalem artichoke using more production inulin plant.These biomass are generated by exoinulinase processing can be by a variety of micro- lifes The fructose and a small amount of glucose that object utilizes.This technology invention is terminated using circle rhodosporidium toruloides Ppho89 promoter and Thsp Son establishes grass rhodotorula genetic manipulation system, realizes exoinulinase in grass rhodotorula (Rhodotorula Graminis) the inducing expression in CGMCC 2.4202.

1. the building of inulinase phosphate starvation induction expression vector

According to kluyveromyces marxianus exoinulinase amino acid sequence in 2007100159198.8 patent of ZL, according to Circle rhodosporidium toruloides codon preference optimizes, and the raw work in commission Shanghai carries out full genome synthesis, sequence such as SEQ ID NO: (INU) shown in 17.Design primer INU-NcoI-E1:5 '-cggCCATGGACatgcgcttcgcgtactccctcttgctc-3 ' And INU-NcoI-E2:5 '-CCGACTAGTctaGTGATGGTGATGGTGGTGgaggttgaactgggtgacgttg-3 ', with Fully synthetic INU gene is template, carries out PCR amplification.Pcr amplification product utilizes DNA glue recovery purifying kit (purchased from raw work) It is purified, and carries out double digestion using Nco I, Spe I, and connect the pZPK-HYG- into same Nco I, Spe I processing Ppho89-MCS-Thsp is inserted between promoter Ppho89 and terminator Thsp, and the phosphate for successfully constructing inulinase is hungry Inducible expression carrier pZPK-HYG-Ppho89-INU-Thsp is starved, structure is as shown in figure 16.Recombinantly express fatty acid hydroxylase The end C introduces 6 × His Tag, can be used for Western blot operation.

2. the building of the Agrobacterium tumefaciens attachment containing pZPK-HYG-Ppho89-INU-Thsp carrier

Constructed pZPK-HYG-Ppho89-INU-Thsp carrier is converted using electroporated method into Agrobacterium AGL1, In picking transformant on the LB plate containing 50ng/ μ L kanamycins.Kalamycin resistance Agrobacterium-mediated Transformation uses bacterium first The method for falling PCR is verified.Correct transformant is verified, AGL1/ZPK-HYG-Ppho89-INU-Thsp is named as, is saved It is spare.

3.INU is integrated into 2.4202 chromosome of grass rhodotorula CGMCC through ATMT

Grass rhodotorula CGMCC 2.4202 is purchased from Japanese Culture Collection (JCM).After taking a ring to activate Grass rhodotorula CGMCC 2.4202, be inoculated in 5ml YEPD (glucose 20.0g/l, yeast extract 10.0g/l, albumen Peptone 20.0g/l, pH 6.0) in, 25 DEG C, 200r/min is incubated overnight.After sterile water washing one time, it is adjusted to OD₆₀₀=1-2, It is spare.

The recombinational agrobacterium AGL1/ZPK-HYG-Ppho89-INU-Thsp that step 2 obtains is inoculated in 5mL and contains card that is mould In the LB liquid of plain (100ng/ μ L) and rifampin (80ng/ μ L), 250 DEG C, 200r/min overnight incubation.With sterile water washing One time, it is adjusted to OD₆₀₀=1-3, it is spare.

Above-mentioned grass rhodotorula CGMCC 2.4202 and each 200 μ L of Agrobacterium dilution is taken, is mixed, by 13 step of embodiment 3 carry out ATMT operation, until transformant occurs.

4. the bacterium colony PCR of the hygromycin resistant transformed son of grass rhodotorula CGMCC 2.4202 is identified

6 2.4202 transformant of geneticin resistant grass rhodotorula CGMCC access 50ml of random picking contain 50ng/ Limit phosphorus induced medium (50ng/ μ L hygromycin, 30g/L glucose, the 5 g/L ammonium sulfate, 0.64g/L sulfuric acid of μ L Geneticin Potassium, 0.08g/L disodium hydrogen phosphate dodecahydrate, 0.94g/L sodium sulphate, 1.5g/L epsom salt, PH 6.0) on, with reference to reality It applies bead broken wall method described in example 3 and extracts genomic DNA, use INU-NcoI-E1 and INU-NcoI-E2 for primer, carry out PCR identification.The results show that ME encoding gene is successfully integrated into 2.4202 genome (not shown) of grass rhodotorula CGMCC.

5. carrying out recombination grass rhodotorula oil fermentation by carbon source of inulin

3 bacterium colony PCR of picking identify that correct 2.4202 transformant single colonie of grass rhodotorula CGMCC is connected to 5ml In YEPD culture medium (glucose 20.0g/l, yeast extract 10.0g/l, peptone 20.0g/l, pH 6.0).It cultivates for 24 hours, Limit phosphorus induced medium (the 50ng/ μ L hygromycin, the Portugal 25g/L that 50ml contains 50ng/ μ L hygromycin are connected to the inoculum concentration of 1:50 Grape sugar, 5g/L ammonium sulfate, 0.64g/L potassium sulfate, 0.08g/L disodium hydrogen phosphate dodecahydrate, 0.94g/L sodium sulphate, 1.5g/L Epsom salt, PH 6.0) in, as secondary seed.After secondary seed culture for 24 hours, the inulin limit phosphorus for taking 5mL that 45ml is added is lured Lead culture medium (50ng/ μ L hygromycin, 25g/L inulin (purchased from sigma), 5g/L ammonium sulfate, 0.64 g/L potassium sulfate, 0.08g/L Disodium hydrogen phosphate dodecahydrate, 0.94g/L sodium sulphate, 1.5g/L epsom salt, PH 6.0) in.Terminate hair after cultivating 96h Ferment.40ml zymocyte liquid is taken to be placed in 50ml round bottom centrifuge tube, 8000r/min room temperature is centrifuged 5min and collects thallus, uses deionized water Washing 2 times, 105 DEG C are dried for 24 hours to constant weight.Grease extraction is carried out by the step 5 of embodiment 11 later.The results show that wild strain Grass rhodotorula CGMCC 2.4202 is being the grease intracellular that 21% can be accumulated when sole carbon source carries out fermentation 96h using inulin, And being overexpressed the recombination grass rhodotorula of exoinulinase using inulin is that grease intracellular contains when sole carbon source carries out fermentation 96h Amount is then 52%, can convert inulin directly as grease intracellular.

6. recombinating INU expression analysis --- Western blot in grass rhodotorula CGMCC 2.4202

In addition to directly determining that round rhodosporidium toruloides Ppho89 promoter can star circumscribed chrysanthemum using phenotype by inulin Powder enzyme is outside the expression of Rhodotorula, since the end C- of recombination INU expression product carries 6 × His Tag, also using anti-His Tag antibody passes through the expression of immunoblotting assay ME.PCR identifies correct 6 transformants, random picking 3 in above-mentioned steps 4 It is a, access limit phosphorus induced medium (50ng/ μ L hygromycin, 30g/L glucose, the 5g/L ammonium sulfate, 0.64g/L sulfuric acid of 10ml Potassium, 0.08g/L disodium hydrogen phosphate dodecahydrate, 0.94g/L sodium sulphate, 1.5g/L epsom salt, PH 6.0) in, in 30 DEG C Shaking table culture 48h, 4000r/min are centrifuged 10min collection bacterial strain.After thallus sterile water washing one time, the egg of 400 μ L is added White Extraction buffer (8M urea, 65mM DTT, 0.1%Triton X-100,100mM NaCl, 50mM Tris-Cl, 1mM PMSF, 1mM EGTA, 1mM EDTA, pH 7.4) it is resuspended, SDS-PAGE and Western is carried out by the step 5 of embodiment 8 Blot analysis, can be observed the expression (not shown) of INU.

Phosphorus of the embodiment 17:GFP in Rhodotorula rhodotorula glutinis derepresses inducing expression

This technology invention establishes rhodotorula glutinis using circle rhodosporidium toruloides Ppho89 promoter and Thsp terminator (Rhodotorula glutinis) genetic manipulation system, realizes inducing expression of the GFP in rhodotorula glutinis NCYC 2666.

1.GFP is integrated into 2666 chromosome of rhodotorula glutinis NCYC through ATMT

The recombination agriculture bar AGL1/ZPK-HYG-Ppho89-GFP-Thsp that 13 step 2 of embodiment obtains is inoculated in 5ml and contains In the LB liquid of kanamycins (100ng/ μ L) and rifampin (80ng/ μ L), 250 DEG C, 200r/min overnight incubation.Use sterile water Washing one time, is adjusted to OD₆₀₀=1-3, it is spare.

Rhodotorula glutinis NCYC 2666 is purchased from United Kingdom National barms collection (National Collection Of Yeast Cultures, NCYC).Rhodotorula glutinis NCYC 2666 after taking a ring to activate, is inoculated in 5ml YEPD (glucose 20.0g/l, yeast extract 10.0g/l, peptone 20.0g/l, pH 6.0) in, 25 DEG C, 200r/min is incubated overnight.With nothing After bacterium water washing one time, it is adjusted to OD₆₀₀=1-2, it is spare.

Take above-mentioned rhodotorula glutinis NCYC 2666 and each 200 μ L of Agrobacterium dilution, mix, by 13 step 3 of embodiment into Row ATMT operation, until transformant occurs.

2. the bacterium colony PCR of the hygromycin resistant transformed son of rhodotorula glutinis NCYC 2666 is identified

6 2666 transformant of geneticin resistant rhodotorula glutinis NCYC access 50ml of random picking contain 50ng/ μ L something lost Pass mycin limit phosphorus induced medium (50ng/ μ L hygromycin, 30g/L glucose, 5g/L ammonium sulfate, 0.64g/L potassium sulfate, 0.08g/L disodium hydrogen phosphate dodecahydrate, 0.94g/L sodium sulphate, 1.5g/L epsom salt, PH 6.0) on, reference implementation Bead broken wall method described in example 3 extracts genomic DNA, uses GFP-NcoI-E1 and GFP-NcoI-E2 for primer, carries out PCR Identification.The results show that GFP gene is successfully integrated into 2666 genome (not shown) of rhodotorula glutinis NCYC.

3. the Fluirescence observation of the hygromycin resistant transformed son of rhodotorula glutinis NCYC 2666

3 bacterium colony PCR of picking identify that the correct hygromycin resistant transformed sub- single colonie of rhodotorula glutinis NCYC 2666 is connected to In 5ml YEPD culture medium (glucose 20.0g/L, yeast extract 10.0g/L, peptone 20.0g/l, pH 6.0).Culture For 24 hours, with the inoculum concentration of 1:50 be connected to limit phosphorus induced medium that 50ml contains 50ng/ μ L hygromycin (50ng/ μ L hygromycin, 30g/L glucose, 5g/L ammonium sulfate, 0.64g/L potassium sulfate, 0.08g/L disodium hydrogen phosphate dodecahydrate, 0.94g/L sulfuric acid Sodium, 1.5g/L epsom salt, PH 6.0) in, as secondary seed.After secondary seed culture for 24 hours, 5mL is taken to be added 45mL's It limits in phosphorus induced medium.Terminate fermentation after cultivating 48h.Take 10 μ L point of bacterium solution in glass slide, covered is placed on fluorescence Microscope carries out green fluorescence observation, excitation wavelength 498nm, and launch wavelength 516nm, GFP recombinate rhodotorula glutinis NCYC 2666 Green fluorescence can be observed, and compare wild type rhodotorula glutinis NCYC 2666 then (not shown) occurs in unstressed configuration.

4. recombinating GFP expression analysis --- Western blot in rhodotorula mucilaginosa CGMCC 2.22

Exist in addition to directly determining that round rhodosporidium toruloides Ppho89 promoter can star GFP by green fluorescence phenotype It is also available since the end C- of recombination GFP carries 6 × His Tag outside the expression of Rhodotorula rhodotorula mucilaginosa CGMCC 2.22 Anti- His Tag antibody passes through the expression of immunoblotting assay GFP.PCR identifies correct 6 transformants in above-mentioned steps 4, with Machine picking 3, access 10mL limit phosphorus induced medium (50ng/ μ L hygromycin, 30g/L glucose, 5g/L ammonium sulfate, 0.64g/L potassium sulfate, 0.08g/L disodium hydrogen phosphate dodecahydrate, 0.94g/L sodium sulphate, 1.5g/L epsom salt, PH 6.0) in, 10min collection bacterial strain is centrifuged in 30 DEG C of shaking table cultures 48h, 4000r/min.After thallus sterile water washing one time, Protein extract buffer (8M urea, 65mM DTT, 0.1%Triton the X-100,100mM NaCl, 50mM of 400 μ L is added Tris-Cl, 1mM PMSF, 1mM EGTA, 1mM EDTA, pH 7.4) it is resuspended, SDS-PAGE is carried out by the step 5 of embodiment 8 It is analyzed with Western blot, the expression (not shown) of GFP can be observed.

Claims (9)

1.Na⁺/ Pi cotransporter promoter, it is characterised in that: its nucleotide sequence is as shown in SEQ ID NO:1.

2. a kind of DNA expression cassette, it is characterised in that: it contains Na shown in SEQ ID NO:1⁺/ Pi cotransporter promoter Nucleotide sequence.

3. expression cassette according to claim 2, it is characterised in that: the expression cassette also contains shown in SEQ ID NO:2 Nucleotide sequence as terminator, wherein sequence shown in SEQ ID NO:1 is located at the upper of sequence shown in SEQ ID NO:2 It swims, is the open reading frame of coding target gene between SEQ ID NO:1 and SEQ ID NO:2.

4. DNA expression cassette according to claim 3, it is characterised in that: the open reading frame of the coding target gene CDNA sequence have the nucleotide sequence as shown in SEQ ID NO:4.

5. a kind of recombinant vector comprising DNA expression cassette described in any one of claim 2-4, it is characterised in that: the load Body is sequestered or integrating vector.

6. recombinant vector according to claim 5, it is characterised in that: the integrating vector is the double of mediated by agriculture bacillus First expression vector, or to carry the homologous recombination vector of target gene flank 1500-4000 base homologous recombination arm, it is described same Source recombinant vector skeleton or the episomal vector are selected from E. coli cloning vector or yeast shuttle vector.

7. recombinant vector according to claim 6, it is characterised in that: the homologous recombination vector skeleton or the sequestered PMD18-T, pUC18, pYES2c/t or the pYX212 of carrier in E. coli cloning vector or yeast shuttle vector.

8. a kind of host cell comprising the recombinant vector described in claim 5, it is characterised in that: the host cell is large intestine Bacilli-cell or yeast cells.

9. a kind of expression system for oleaginous yeast genetic expression, it is characterised in that: the expression system includes:

(1) improvement expressed in saccharomyces, Sporobolomyces and Rhodotorula bacterial strain can be thrown in Rhodosporidium, lock to carry Body, the improved carrier is by that can be inserted into SEQ ID in integrant expression or the plasmid of free expression in above-mentioned saccharomyces The building of terminator sequence shown in promoter sequence shown in NO:1 and SEQ ID NO:2 obtains, wherein shown in SEQ ID NO:1 Promoter sequence be located at the upstream of terminator sequence shown in SEQ ID NO:2, sequence and SEQ shown in SEQ ID NO:1 It is multiple cloning sites between sequence shown in ID NO:2, and the carrier also includes selected marker；With

(2) target gene open reading frame sequence can operably be inserted into improved carrier described in (1), and make Promoter and terminator in improved carrier described in the target gene and (1) meet the connection of reading frame, and

(3) Rhodosporidium, lock throw saccharomyces, Sporobolomyces and Rhodotorula bacterial strain.