CN105779445B - Fructose-1,6-diphosphonic acid aldolase promoter and terminator and its application - Google Patents

Abstract

The present invention is by expanding Lipomyces starkeyi fructose 1,6 bisphosphate aldolase genomic DNA upstream and downstream sequences, carry out biological information analysis and functional verification, acquisition can be widely used in oleaginous yeast gene expression in saccharomyces oleaginosus category (Lipomyces) and Trichosporon (Trichosporon), genetic engineering procedure and strain improvement promoter and terminator, nucleotide sequence is respectively SEQ ID NO：1 and SEQ ID NO：2.The invention further relates to DNA expression cassettes or recombinant vector containing these elements, and utilize related elements structure saccharomyces oleaginosus category or method and the corresponding bacterial strain of Trichosporon engineering strain.

Description

Fructose-1,6-diphosphonic acid aldolase promoter and terminator and its application

Technical field

The invention belongs to gene engineering technology fields, and in particular to Lipomyces starkeyi (Lipomyces starkeyi) Promoter terminator and application thereof, including method for transformation necessary to construction method of gene engineering strain etc..

Background technology

Microorganism is that one of widest species are distributed in nature, has remarkable biosynthesis ability, can almost close At organic chemicals all on the earth.Compared with multicellular organism, the metabolic pathway of microorganism is although relatively easy, but it is changed The production for closing object efficiently, fast, has the characteristics that reaction condition is mild, controllability is strong, is easy to large-scale production, can be used as one Excellent cell factory.

(such as nitrogen source shortage) can be more than that its cell is dry in intracellular storage to a part of microorganism under given conditions in nature 20% grease is weighed, wherein based on triglycerides, the microorganism with this phenotype is known as oleaginous microorganism, including bacterium, Yeast, mould, algae etc., wherein oleaginous yeast include Lipomyces, Trichosporon, Rhodotorula, Candida, Certain bacterial strains (Ratledge, C.and Wynn, J.P.Adv Appl in Cryptococcu and Yarrowia categories Microbiol, 2002,51,1-51.).Grease is produced using microorganism conversion biomass resource, can develop into and not depend on substantially Arable land, can continuous production, reduce agricultural pollution, the new technology of comprehensive utilization of resources, be to be formed chemicals fossil resources substitute The new production ways of product (Zhao Zong guarantor's Chinese biological engineering magazines, 2005,25,8-11.).However these bacterial strains that place one's entire reliance upon Intrinsic metabolic pathway, produces intensity and industrial requirement is often not achieved in performance.It is advanced optimized using technique for gene engineering Or change their metabolism network and expression regulation network, accelerate the accumulating rate or oriented control target product of biobased products Type is one of the important channel for building excellent industrial applications bacterial strain.Although the genetic engineering for some conventional yeasts changes Make it is more mature (Alper, H., and Stephanopoulos, G.Nat Rev Microbiol, 2009,7,715- 723.), but starting state is still in for the genetic manipulation of these unconventional saccharomyces oleaginosus, many yeast do not have suitable base Because of operating platform.Suitable genetic manipulation method is developed, it is great for the application value of these unconventional microorganisms.

Lipomyces starkeyi (Lipomyces starkeyi) in saccharomyces oleaginosus category (Lipomyces) is one plant excellent Oleaginous yeast, it can accumulate more than 60% or more dry cell weight grease (Zhao, X., Kong, X. L., Hua, Y.Y., Et al.Eur J Lipid Sci Tech, 2008,110,405-412.).It not only has substrate utilization scope wide (Angerbauer, C., Siebenhofer, M., Mittelbach, M., et al.Bioresour Technol, 2008,99, 3051-3056；Liu, J.X., Yue, Q.Y., Gao, B.Y, et al.Bioresour Technol, 2012,106,69- 73.) the features such as, Modulatory character is strong (the microbiologies such as Wu Shuan, Hua Yanyan, Zhong Chongbin are notified to, 2008,35,200-203.), It can also degrade and utilize the noxious materials such as herbicide (Nishimura, K., Yamamoto, M., Nakagomi, T., et Al.Appl MicrobiolBiot, 2002,58,848-852.), it is one plant of bacterial strain with good prospects for commercial application.But Up to now, it has no the promoter sequence report for being suitable for Lipomyces starkeyi, also has no suitable for Lipomyces starkeyi Genetic operating system, these all constrain the strain improvement of targeting.

Trichosporon cutaneum (Trichosporon cutaneum) in Trichosporon (Trichosporon) generally exists Some industrial wastewaters, the waste liquid containing aldehydes matter and oil plant are nearby found, and have very strong phenolic compound capacity of decomposition And heavy metal adsorption (Anderson, J.J., and Dagley, S.J Bacteriol, 1980,141,534-543； Yotova, L., Tzibranska, I., Tileva, F., et al.J.Ind.Microbiol.Biotechnol., 2009,36, 367-372.)；Substrate utilization scope it is wide (Yuan Jinyun, Ai Zuozuo, Zhang Zhibin, et al. bioengineering journals, 2011,27,453- 460.), at the same can synchronize using pentose and hexose accumulation more than 40% or more own wt grease (Hu, C., Wu, S., Wang, Q., et al.Biotechnol Biofuels, 2011,4,25.).And from some industry wherein separated With enzyme, as nitric oxidereductase (Zhang, L., Takaya, N., Kitazume, T., et al.Eur J Biochem, 2001,268,3198-3204.), zytase (Liu, W., Zhu, W.M., Lu, Y.L., et al.Process Biochem, 1998,33,331-336.) etc. imply the good commercial application potentiality of this kind of bacterial strain.But up to now, it has no and is suitable for skin The promoter sequence of shape trichosporon cutaneum is reported, also has no the endogenesis promoter suitable for Lipomyces starkeyi, these are all restricted The strain improvement of targeting.

Although once someone detaches bis- phosphorus of fructose -1,6- of circle rhodosporidium toruloides (Rhodosporidium toruloides) Sour aldolase promoter has no the promoter for skin shape for the genetic engineering operation (ZL2010101897232) of itself The report of the other extraordinary such as genetic engineerings such as Ascomycota Lipomyces starkeyi operations outside trichosporon cutaneum and Basidiomycota Road.However, promoter is essential for genetic operating system.Therefore, separation can be in Lipomyces starkeyi and skin Starting the ester of Harden Young aldolase promoter of reporter gene expression in shape trichosporon cutaneum becomes the focus studied at present.

Invention content

In view of above-mentioned prior art bottleneck, the main object of the present invention, which is to provide, can be universally used in Lipomyces starkeyi or skin The promoter and terminator of exogenous gene expression in shape trichosporon cutaneum, and using suitable transformation technology to this two yeast-like fungis kind The method improved.

To achieve the purpose of the present invention, the present inventor is analyzed by the genome sequence to Lipomyces starkeyi, Key enzyme --- the DNA sequence dna of ester of Harden Young aldolase of glycolysis metabolism approach is obtained, and further passes through PCR Technology has been successfully separated the DNA fragmentation for including effective promoter from Lipomyces starkeyi chromosomal DNA, is turned using suitable Exogenous dna fragment containing ester of Harden Young aldolase promoter pLsFBA is directed respectively into this Da Shi grease by change method In yeast or trichosporon cutaneum, it is successfully realized the expression of foreign gene, completes the present invention.

The present invention, which has been successfully separated, to start reporter gene expression in Lipomyces starkeyi and trichosporon cutaneum Lipomyces starkeyi ester of Harden Young aldolase promoter, and construct its expression vector.

Specifically, the present invention includes that following embodiments (A) arrive (H)：

(A) the present invention relates to one kind having Lipomyces starkeyi or the active DNA of trichosporon cutaneum transcripting promoter Segment, the DNA fragmentation：

(1) there is such as SEQ ID NO：The full sequence of DNA sequence dna shown in 1 or comprising the DNA sequence dna from 3 '-ends Partial sequence within 1500bp,

(2) having can be with such as SEQ ID NO：The whole of sequence shown in 1 or its DNA sequence dna 3 '-end are risen within 1500bp Partial sequence hybridization and keep the active sequence of transcripting promoter, or

(3) to SEQ ID NO：Deoxynucleotide sequence shown in 1 carries out the substitution of one or more bases, missing, inserts Enter or add to be obtained, with SEQ ID NO：Sequence shown in 1 is with 50% or more homology and with the sequence of promoter activity Row.

(B) the present invention relates to a kind of DNA fragmentation from Lipomyces starkeyi, the DNA fragmentation can be used as terminator, And：(1) there is such as SEQ ID NO：The whole of DNA sequence dna shown in 2 or the partial sequence for including the DNA sequence dna 5 '-end； Or (2) have sequence that is can hybridizing with the sequence as shown in (1) and keeping such as (1) described sequence active.

(C) the present invention relates to one kind can completing target gene transcription initiation in Lipomyces starkeyi or trichosporon cutaneum With the DNA molecular of tanscription termination, it with described in above-mentioned (A) with Lipomyces starkeyi or trichosporon cutaneum transcription open The DNA sequence dna of promoter activity, or having simultaneously described in above-mentioned (A), there is Lipomyces starkeyi or trichosporon cutaneum to transcribe The DNA sequence dna of promoter activity, and the DNA fragmentation described in (B), and the DNA fragmentation described in (B) is located at the DNA sequence dna described in (A) Downstream, the DNA fragmentation of 1-10000 nucleotide adjacent thereto.

(D) the present invention relates to one kind expressing the DNA that target gene is connect with any DNA molecular described in (A)-(C) Box, the recombinant DNA that can be expressed in Lipomyces starkeyi or trichosporon cutaneum in order to the target gene.The target base Because of protein-encoding nucleotide or antisense nucleic acid code nucleic acid.Preferably, the cDNA sequence of the target gene has such as SEQ ID NO：Nucleotide sequence shown in 4 (Ls ester of Harden Youngs aldolase cDNA).

(E) the present invention relates to the recombinant vectors of any one in the DNA molecular described in a kind of carrying (A)-(D).Institute It can be episomal vector or integrating vector, the episomal vector to state carrier such as, but not limited to, pMD18-T, pUC18, PYES2c/t or pYX212 etc., the integrating vector are agriculture bacillus mediated binary expression vector, such as, but not limited to, PZPK or pPZP200 etc..

(F) the present invention relates to by the DNA molecular as described in (D) or the carrier as described in (E) be transferred to saccharomyces oleaginosus category or The method for transformation of Trichosporon bacterial strain.

(G) the present invention relates to the grease ferment for being transferred to the DNA expression cassettes as described in (D) or the recombinant vector as described in (E) Mother belongs to or the engineering strain of Trichosporon.

(H) ester of Harden Young aldolase (pLs ester of Harden Youngs aldolase) according to the present invention starts Son, it is characterised in that：Its source is Lipomyces starkeyi, can start target gene in saccharomyces oleaginosus category or Trichosporon bacterium Transcript and expression in strain, the promoter：(1) there is such as SEQ ID NO：The full sequence of DNA sequence dna shown in 1 or comprising Partial sequence of the DNA sequence dna from 3 '-ends within 1500bp, (2) have can be with such as SEQ ID NO：Sequence shown in 1 it is complete The partial sequence within 1500bp the hybridizes and holding active sequence of transcripting promoter is played in portion or its DNA sequence dna 3 '-end, Or (3) to SEQ ID NO：Deoxynucleotide sequence shown in 1 carries out the substitution of one or more bases, missing, is inserted into or adds Add and obtained, with SEQ ID NO：Sequence shown in 1 is with 50% or more homology and with the sequence of promoter activity；

Ls ester of Harden Youngs aldolase t terminators of the present invention, it is characterised in that：Its source is this Da Shi Saccharomyces oleaginosus can terminate transcript and expression of the target gene in saccharomyces oleaginosus category or Trichosporon bacterial strain, the terminator： (1) there is such as SEQ ID NO：The whole of DNA sequence dna shown in 2 or the partial sequence for including the DNA sequence dna 5 '-end, (2) tool Having can be with such as SEQ ID NO：The whole of sequence shown in 2 or the partial sequence of its DNA sequence dna 5 '-end hybridize and holding turns The sequence of terminator activity, or (3) are recorded to SEQ ID NO：Deoxynucleotide sequence shown in 2 carries out one or more bases What substitution, missing, insertion or addition were obtained, with SEQ ID NO：Sequence shown in 2 is with 50% or more homology and with eventually Only sub active sequence.

Using the DNA molecular with promoter activity of the present invention and with the active DNA of transcription terminator, it can be achieved that The expression of foreign gene or endogenous gene in saccharomyces oleaginosus category or Trichosporon bacterial strain.

The present invention provides the promoter genetically engineered for saccharomyces oleaginosus category or Trichosporon bacterial strain, terminators And carrier.A breeding new way is opened for saccharomyces oleaginosus category or Trichosporon bacterial strain, and therefore can be provided with work The saccharomyces neoformans bacterial strain of industry purposes.

In conclusion the present invention provides following technical proposals：

1. ester of Harden Young aldolase promoter, nucleotide sequence such as SEQ ID NO：Shown in 1.

2. the ester of Harden Young aldolase promoter described in the 1st can be in saccharomyces oleaginosus category for building (Lipomyces) or in the yeast strain of Trichosporon (Trichosporon) application for the recombinant expression carrier expressed, The saccharomyces oleaginosus category or silk of the recombinant expression carrier comprising the ester of Harden Young aldolase promoter are wherein cloned Spore Saccharomyces cerevisiae bacterial strain constitutes saccharomyces oleaginosus category or Trichosporon genetic operating system.

3. a kind of DNA expression cassettes contain SEQ ID NO：Ester of Harden Young aldolase promoter shown in 1 Nucleotide sequence.

4. the expression cassette described in the 3rd also contains SEQ ID NO：Nucleotide sequence shown in 2 as terminator, Middle SEQ ID NO：Sequence shown in 1 is located at SEQ ID NO：The upstream of sequence shown in 2, SEQ ID NO：1 and SEQ ID NO：It is the open reading frame of coding target gene between 2.

5. the DNA expression cassettes described in the 4th, it is characterised in that：The open reading frame of the coding target gene CDNA sequence has such as SEQ ID NO：Nucleotide sequence shown in 4.

6. a kind of includes the recombinant vector of the DNA expression cassettes described in any one of 3-5.

7. the recombinant vector described in the 6th, it is characterised in that：The carrier is sequestered or integrating vector.

8. the recombinant vector described in the 7th, wherein the integrating vector is agriculture bacillus mediated binary expression vector, example Such as pZPK or pPZP200, or to carry the homologous recombination vector of target gene flank 1500-4000 base homologous recombination arms, The homologous recombination vector skeleton or the episomal vector are selected from the large intestines such as pMD18-T, pUC18, pYES2c/t or pYX212 Bacillus cloning vector or yeast shuttle vector.

9. including the host cell of the recombinant vector described in any one of 6-8.

10. the host cell described in the 9th, the host cell is Bacillus coli cells or yeast cells.

11. a kind of expression system for oleaginous yeast genetic expression, the expression system include：

(1) improved carrier that can be expressed in saccharomyces oleaginosus category or Trichosporon bacterial strain, the improved carrier are logical SEQ ID NO can be inserted into saccharomyces oleaginosus category or Trichosporon in integrant expression or the plasmid of free expression by crossing：1 Shown in promoter sequence and SEQ ID NO：Terminator sequence structure shown in 2 obtains, wherein SEQ ID NO：It is opened shown in 1 Promoter sequences are located at SEQ ID NO：The upstream of terminator sequence shown in 2, SEQ ID NO：Sequence shown in 1 and SEQ ID NO：It is multiple cloning sites between sequence shown in 2, and the carrier also includes selected marker；

(2) target gene open reading frame sequence can be operably inserted into the improved carrier described in (1), And make the target gene in the improved carrier described in (1) promoter and terminator connect with meeting reading frame, and

(3) saccharomyces oleaginosus category or Trichosporon bacterial strain.

12. the 11st expression system for oleaginous yeast genetic expression, wherein improved carrier described in (1) by SEQ ID NO are inserted into the plasmid that can be expressed in saccharomyces oleaginosus category or Trichosporon：Promoter sequence shown in 1 and SEQ ID NO：Terminator sequence structure shown in 2 obtains.

13. the 12nd expression system for oleaginous yeast genetic expression, wherein the plasmid is sequestered or whole Mould assembly plasmid, also, the wherein described integrative plasmid is agriculture bacillus mediated double base expression plasmid, such as pZPK or pPZP200, Also, the episomal plasmids are selected from pMD18-T, pUC18, pYES2c/t or pYX212.

14. the 11st expression system for oleaginous yeast genetic expression, wherein the saccharomyces oleaginosus category bacterial strain described in (3) Selected from oil-producing saccharomyces oleaginosus (Lipomyces lipofer), Lipomyces starkeyi (Lipomyces starkeyi), tangerine woods oil Fat yeast (Lipomyces kononenkoae), the Trichosporon bacterial strain are selected from oil-producing trichosporon cutaneum (Trichosporon Oleaginosus), trichosporon cutaneum (Trichosporon cutaneum), Trichosporon fermentans (Trichosporon Fermentans), gonimoblast spore yeast (Trichosporon porosum), Bai Shi trichosporon bacterias (Trichosporon ) or mamillary trichosporon cutaneum (Trichosporon capitatum) beigelii.

15. the 11st expression system for oleaginous yeast genetic expression, wherein the target gene opening described in (2) is read Frame sequence has such as SEQ ID NO：Nucleotide sequence shown in 4.

It should be appreciated by those skilled in the art that term " expression system " refers to including recombinant vector, target egg to be expressed The composition system of white coding nucleotide sequence, suitable host cell or host strain etc. is used in the host cell Or the target protein is expressed in host strain.

The beneficial effects of the invention are as follows：

Promoter, terminator genetic transforming method are provided for the saccharomycete of saccharomyces oleaginosus category and Trichosporon, will be had Make every effort to promote strain improvement and the metabolic engineering research into saccharomyces oleaginosus category and Trichosporon saccharomycete from now on.

Description of the drawings

Fig. 1 shows the agarose gel electrophoresis of LsFBA degenerate pcrs product (swimming lane 1) as a result, swimming lane M is molecular weight mark It is accurate.

Fig. 2 indicate pLsFBA promoter dna fragments (swimming lane 1) agarose gel electrophoresis as a result, swimming lane M be molecular weight Standard.

Fig. 3 indicate LsFBAt terminators DNA fragmentation (swimming lane 1) agarose gel electrophoresis as a result, swimming lane M be molecular weight Standard.

Fig. 4 indicates the structural schematic diagram of plasmid FBAHYG, LB, T-DNA left margins；RB, T-DNA right margin.

Fig. 5 indicates to reflect using PCR after HYG genetic transformation oil-producings saccharomyces oleaginosus (Lipomyces lipofer) CBS 944 It is fixed that as a result, swimming lane M is molecular weight standard, swimming lane 1-6 indicates that different Hyg resistant transformants, WT indicate wild type respectively ,+be Positive control ,-indicate negative control.

Fig. 6 indicates the detection of expression of HYG genes --- Western blot analyses, swimming lane 1-3 are agrobacterium mediation converted 944 hygromycin transformant 1-3 total proteins of oil-producing saccharomyces oleaginosus CBS；Swimming lane 4 is the starting strain oil-producing as negative control 944 total protein samples of saccharomyces oleaginosus CBS.

Fig. 7 indicates the structural schematic diagram of plasmid URA3-FBABLE.

Lipomyces starkeyi (Lipomyces starkeyi) NRRL Y- are knocked out Fig. 8 shows BLE selection markers are used The conversion tablet of 11557URA3 genes.

Fig. 9 indicates the transcriptional level expression point of BLE resistance Ura3 auxotrophy Lipomyces starkeyi recombinant bacterial strains Analysis --- RT-PCR is as a result, swimming lane 1-2 is BLE resistance Ura3 auxotrophy Lipomyces starkeyi NRRL Y-11557 recombinations Bacterial strain 1-2, swimming lane 3 are control strain Lipomyces starkeyi NRRL Y-11557.

Figure 10 indicates the structural schematic diagram of FBAKAN-CpFAH.

Figure 11 indicates that recombination saccharomyces oleaginosus belongs to oleate hydroxylase Western blot analyses, swimming lane 1-3 in CBS 7729 and is It recombinates saccharomyces oleaginosus and belongs to 7729 bacterial strain 1-3 total proteins of CBS；Swimming lane 4 is the starting strain saccharomyces oleaginosus category as negative control 7729 total protein samples of CBS.

Figure 12 is indicated using BLE selection markers conversion oil-producing trichosporon cutaneum (Trichosporon oleaginosus) PCR qualification results after ATCC 20509, swimming lane M are molecular weight standard, and swimming lane 1-6 indicates different Hyg resistant transformants respectively, WT indicates wild type ,+it is positive control.

Figure 13 shows the genomic dna sequence (base number 1456) of ester of Harden Young aldolase and corresponding exon Encoding amino acid sequence.

Sequence table explanation

SEQ ID NO：1 LsFBA promoters derive from Lipomyces starkeyi (Lipomyces starkeyi)

SEQ ID NO：2 LsFBA terminators derive from Lipomyces starkeyi

SEQ ID NO：3 LsFBA reading frames

SEQ ID NO：4 LsFBA cDNA

SEQ ID NO：5 LsFBA amino acid sequences

SEQ ID NO：6 HYG

SEQ ID NO：7 pLsFBA-HYG-LsFBAt

SEQ ID NO：8 pURA3-URA3-URA3t

SEQ ID NO：9 BLE

SEQ ID NO：10 pURA3-FBABLE-URA3t

SEQ ID NO：11 Kanmx

SEQ ID NO：12 CpFAH

SEQ ID NO：13 FBAKAN-CpFAH

SEQ ID NO：14 LB sequences

SEQ ID NO：15 RB sequences

SEQ ID NO：16 pLsFBA-orf-LsFBAt

Specific implementation mode

Herein, " promoter " is referred to by RNA polymerase identification, in conjunction with the DNA sequences that simultaneously energy promotor gene is transcribed Row.Term " promoter " may also be understood to be：Including 5 ' noncoding regions, cis-acting elements (such as enhancer) and it is other can with turn Record the nucleotide sequence that the factor combines.

The presence of promoter or intensity are typically to be indicated by promoter activity, assay method：By reporter gene (as resisted Property gene) be connected to the downstream of the promoter, and the DNA construct is converted into corresponding host cell, examining report gene is No expression.If it is observed that being connected to the expression of promoter downstream reporter gene, so that it may to think the promoter It is active in the host cell that it is converted.

Herein, " terminator " refer on chromosome provide termination signal make RNA polymerase detached with DNA templates and Make the section of DNA sequence of tanscription termination.Reporter gene can be kept effective by " promoter-reporter gene-terminator " construct Express and determine the activity of terminator.

" Lipomyces starkeyi " in the present invention, including belong to any diploid and monoploid of " species ", it is wild Type bacterial strain and auxotrophic strain." saccharomyces oleaginosus category or Trichosporon " in the present invention, is not specifically limited, the example Fungi including belonging to the category, in addition to Lipomyces starkeyi or trichosporon cutaneum, also just like oil-producing saccharomyces oleaginosus (Lipomyces lipofer), tangerine woods saccharomyces oleaginosus (Lipomyces kononenkoae), saccharomyces oleaginosus category (Lipomyces Sp.) other species or Trichosporon fermentans (Trichosporon fermentans), gonimoblast spore yeast (Trichosporon porosum), oil-producing trichosporon cutaneum (Trichosporon oleaginosus), Bai Shi trichosporon bacterias (Trichosporon beigelii), mamillary trichosporon cutaneum (Trichosporon capitatum).

" target gene " of the present invention, including the albumen that can be expressed in saccharomyces oleaginosus category or Trichosporon bacterial strain are compiled Code sequence, antisense RNA coding sequences and nuclease coded sequence.It can be expressed in saccharomyces oleaginosus category or Trichosporon bacterial strain The example of albumen coded sequence include albumen or nucleic acid sequence in this two classes Pseudomonas, and be not limited thereto, also Include from other microorganisms, the albumen of plant and animal or nucleic acid sequence.Art technology is arbitrary it should be understood that when making With the albumen coded sequence from other microorganisms, plant and animal as a purpose gene (that is, external source target gene) when, be Optimize the expression in saccharomyces oleaginosus category or Trichosporon bacterial strain, it usually needs be directed to saccharomyces oleaginosus category or Trichosporon bacterium The codon preference of strain carries out codon optimization to the target gene.And codon optimization belongs to the ordinary skill in the art Means.

Promoter in the present invention：(1) there is such as SEQ ID NO：The full sequence of DNA sequence dna shown in 1 includes the DNA Partial sequence of the sequence from 3 '-ends within 1500bp, (2) have can be with such as SEQ ID NO：The whole of sequence shown in 1 or It rises that the partial sequence within 1500bp hybridizes and keeps the active sequence of transcripting promoter, or (3) in its DNA sequence dna 3 '-end To SEQ ID NO：Substitution, missing, insertion or the addition that deoxynucleotide sequence shown in 1 carries out one or more bases are obtained , with SEQ ID NO：Sequence shown in 1 is with 50% or more homology and with the sequence of promoter activity.

Terminator in the present invention：(1) there is such as SEQ ID NO：The whole of DNA sequence dna shown in 2 includes the DNA sequences The partial sequence of row 5 '-end, (2) have can be with such as SEQ ID NO：The whole of sequence shown in 2 or its DNA sequence dna 5 '-end Partial sequence hybridization and keep the active sequence of transcription terminator, or (3) to SEQ ID NO：Deoxyribonucleoside shown in 2 What substitution, missing, insertion or the addition of the one or more bases of acid sequence progress were obtained, with SEQ ID NO：Sequence shown in 2 With 50% or more homology and with the sequence of terminator activity.

The construct of promoter-target gene in the present invention, the construct of target gene-terminator or promoter-mesh Gene-terminator construct, can directly or through carrier mediated conversion fat saccharomyces or Trichosporon bacterial strain, in order to Destination gene expression, can be using preferred plasmid carrier as mediation carrier.

The promoter of the present invention can be detached according to following aspect from Lipomyces starkeyi.

The invention will be further described with reference to the accompanying drawings and embodiments, it will help those skilled in the art Understand the present invention, but the invention is not limited in any way.All primer synthesis and examining order in following embodiments, such as without spy It does not mentionlet alone bright then by the completion of Dalian TakaRa companies.

Embodiment 1：The extraction of Lipomyces starkeyi (Lipomyces starkeyi) NRRLY-11557 total serum IgEs

Lipomyces starkeyi (L.starkeyi) NRRL Y-11557 (are studied into Culture Collection Center purchased from american agriculture (NRRL), Bacterial Foodborne Pathogens＆Mycology Research, 1815N. University Street IL 61604.Peoria, Illinois) by inclined plane inoculating to 50ml YEPD fluid nutrient mediums (glucose 20.0g/ L, yeast extract 10.0g/l, peptone 20.0g/l, pH 6.0) in, for 24 hours in 30 DEG C of shaking table cultures, then with 1: 50 volume Bacterium solution is transferred in 100ml YEPD fluid nutrient mediums by ratio respectively, reaches exponential phase in 30 DEG C of shaking table culture 12h.4 At DEG C, 5000rpm centrifuges 4min, collects thalline, with liquid nitrogen quick freeze thalline, grinds broken wall.Use TakaRa companies RNAiso kits, and extract total serum IgE according to its standard step.

RNA carries out 1.5% agarose gel electrophoresis, uses fluorescence-uv analyzer observation identification, it is seen that clearly two Band.With ultraviolet/visible light spectrometer analysis total serum IgE sample, OD is measured₂₆₀/OD₂₈₀=2.01, show that total serum IgE quality is fine.Always RNA sample freezes in -80 DEG C, spare.

Embodiment 2：Lipomyces starkeyi NRRL the first chains of Y-11557cDNA synthesize and FBA degenerate pcrs

Using Lipomyces starkeyi NRRL Y-11557 total serum IgEs as template, reverse transcription synthesizes the first chains of cDNA.First, will 1.0 μ l total serum IgEs (about 2 μ g), 1.0 μ l primer SMART IV： 5′-AAGCAGTGGTATCAACGCAGAGTGGCCATTACGGCCG GG-3 ' and 1.0 μ l oligo dT- adapter-primers CDSIII/3 '：5′-ATTCTAGAGGCCGAGGCGGCCGACATG-d(T)_30N-1N-3 ', 2.0 μ l DEPC processing water (pyrocarbonic acid diethyl ester handles water, is purchased from Dalian TakaRa companies), is added in PCR pipe Mixing keeps the temperature 2min in 72 DEG C, is immediately placed on cooled on ice 2min, and by 2.0 μ l, 5 × the first chain buffer solutions, (Clontech is public Department), 1.0 μ l DTT (20mM), 1.0 μ l dNTP (10mM), 1.0 μ l powerscript reverse transcriptase (Clontech companies) It is added in system, mixing.In 42 DEG C of extension 60min, last 4 DEG C reaction was completed, is stored in -20 DEG C, spare.

Two degenerate primer FBA-sense of design synthesis：5′- ATGCCC(AGCT)CC(AGCT)(CT)CA(AGCT)TGA (CT) GT (ACT) CTCTC-3 ' (base occurs at random in this position in bracket, is degeneracy base) and FBA-anti：5′- TTA (AGCT) AC (AG) (AGCT) A (AG) CCAGCAGCC-3 ' (base occurs at random in this position in bracket, is degeneracy base), with The first chains of cDNA of reverse transcription synthesis are template, and the degenerate pcr for carrying out FBA genes expands, 10 × PCR buffer solutions, 5.0 μ l, 1.0 μ l of dNTPs (10mM), 1.0 μ l of sense primer (50 mmol/l), downstream primer (50mmol/l) 1.0ul, rTaq enzyme (Dalian TakaRa) 0.5 μ l, the first chains of cDNA template 1.0 the μ l, ddH of synthesis₂O40.5 μ l keep the temperature 3min, then in 94 DEG C in 94 DEG C 30s, 57 DEG C of 45s, 72 DEG C of 1min, 35 cycles, 72 DEG C of 10min, 4 DEG C reaction was completed.Amplified production carries out 1% (mass/volume Concentration) agarose gel electrophoresis, it observes the band (Fig. 1) of 1.2kb or so, (green cloud is purchased from using DNA QIAquick Gel Extraction Kits It), according to supplier's proposed steps purified pcr product.PCR product is cloned into reference to the method that Dalian TakaRa companies provide PMD18-T carriers (are purchased from Dalian TakaRa), are transformed into E.coli DH5 α competent cells, and wherein competent cell presses chlorination It is prepared by calcium method (the Molecular Cloning:A Laboratory guide third edition, Pehanorm Brooker write, and Huang Peitang etc. is translated, and Science Press publishes).It selects Amp resistant transformants carry out Zengjing Granule, plasmid extraction.Recombinant plasmid sample send to Dalian TakaRa companies and is sequenced, sequence knot The amino acid sequence that fruit deduces is analyzed through Blastp, it was demonstrated that is ester of Harden Young aldolase sequence (LsFBA amino acid Sequence), such as SEQ ID NO：Shown in 5.Ester of Harden Young aldolase cDNA sequence (LsFBA cDNA) such as SEQ ID NO：Shown in 4 sequences.

Embodiment 3：The amplification of Lipomyces starkeyi NRRLY-11557 genomic DNAs

The extracting genome DNA of Lipomyces starkeyi NRRLY-11557 uses bead broken wall method (fine works molecular biosciences The 13rd chapter of the experiment guide third edition, the works such as Ao Sibai are learned, face sub- grain husk etc. is translated, and Science Press publishes).The genome prepared DNA is measured using Nanodrop 1000, measures OD₂₆₀/OD₂₈₀=1.85, show that genomic DNA quality is fine.It is a concentration of 120ng/ μ l, totally 500 μ l, genome DNA sample freezes in -20 DEG C, spare.

According to the ester of Harden Young aldolase cDNA sequence obtained in embodiment 2,1 pair of gene specific of design draws Object, FBA-p1：5 '-ATGCCCTCCGTCACTGACGTTCTCTC-3 ' and FBA-p2： 5’-TTAGACAGAGCCAGCAGCCTGG AAATC-3 ' conventionally carries out PCR expansions using the genomic DNA of Lipomyces starkeyi NRRL Y-11557 as template Increase, obtains the PCR product (not shown) of about 1.6kb.Pcr amplification product is recycled according to the operating procedure of embodiment 2, is cloned into PMD18-T carriers, and be sequenced, it obtains such as sequence table SEQ ID NO：DNA sequences shown in 3 (LsFBA reading frames). Through with the ester of Harden Young aldolase cDNA sequence alignments that are obtained in embodiment 2, it was demonstrated that the genetic fragment is its fructose- 1,6- bisphosphate aldolase genomic dna sequence (gDNA), wherein containing 6 intrones and 7 exons.

Embodiment 4：Chromosome walking obtains LsFBA gene 5 ' flank sequences (promoter)

The present embodiment is completed using Genome Walking Kit (being purchased from Dalian TakaRa).

According to the FBA DNA sequence dnas obtained in embodiment 3,3 Specific Primer (gene-specific primer) are designed Respectively FBA-SP1：5 '-GCGAAAAAGCGGCCGAGCAAGAG-3 ', FBA-SP2：5’- GCCGCTTGCGGTGCAGAAAAAAGCCC-3 ' and FBA-SP3：5'-ATCGCCGACGATGACACCGGATTTG-3 ', as under Primer is swum, following operation is carried out according to kit specification.

1.1^stPCR reacts

Using the genomic DNA refined in embodiment 3 as template, first round amplification is carried out.50 μ l of reaction system： 10×LA PCR buffer II(Mg²⁺Plus, Dalian TakaRa) 5.0 8.0 μ l, LA Taq DNA polymerizations of μ l, dNTPs (2.5mmol/l) 1.0 1.0 μ l, FBA-SP1 (10 μ of μ l, AP1Primer (100 μm of ol/l, Dalian TakaRa) of enzyme (5U/ μ l, Dalian TakaRa) Mol/1) 1.0 μ l, Lipomyces starkeyi NRRLY-11557 genomic DNA template (120ng/ μ l) 1.0 μ l, ddH₂O is added to 50μl.Reaction condition：Then the high specific reaction for first carrying out 5 high temperature anneal temperatures carries out 1 extremely low annealing temperature Low specificity is reacted；Then hot asymmetric PCR is carried out：The high specific reaction of 2 high annealing temperature (65 DEG C) and 1 low annealing The low specificity reaction alternate cycles of temperature (44 DEG C), totally 15 times.Design parameter is as follows：94 DEG C of 1 min, 98 DEG C of 1min；94℃ 30s, 65 DEG C of 1min, 72 DEG C of 2min, totally 5 recycle；94 DEG C of 30 s, 25 DEG C of 3min, 72 DEG C of 2min；94 DEG C of 30s, 65 DEG C of 1min, 72 DEG C of 2min, 94 DEG C of 30 s, 65 DEG C of 1min, 72 DEG C of 2min, 94 DEG C of 30s, 44 DEG C of 1min, 72 DEG C of 2min, totally 15 recycle；72℃ 10min, reaction was completed.

2.2^ndNest-type PRC reacts

50 μ l of reaction system：10×LA PCR buffer II(Mg²⁺Plus, Dalian TakaRa) 5.0 μ l, dNTPs 1.0 μ l, AP1 Primer (100 μm of ol/ of (2.5mmol/l) 8.0 μ l, LA Taq archaeal dna polymerases (5U/ μ l, Dalian TakaRa) L, Dalian TakaRa) 1.0 μ l, 1^stPCR reaction products 1.0 μ l, FBA-SP2 (10 μm of ol/l) 1.0 μ l, ddH₂O adds to 50 μ l. Reaction condition：94 DEG C of 30s, 65 DEG C of 1min, 72 DEG C of 2min, 94 DEG C of 30s, 65 DEG C of 1min, 72 DEG C of 2min, 94 DEG C of 30s, 44 DEG C 1min, 72 DEG C of 2 min, totally 15 recycle；72 DEG C of 10min, reaction was completed.

3.3^rdNest-type PRC reacts

50 μ l of reaction system：10×LA PCR buffer II(Mg²⁺Plus, Dalian TakaRa) 50 μ l, dNTPs 1.0 μ l, AP1 Primer (100 μm of ol/ of (2.5mmol/l) 8.0 μ l, LA Taq archaeal dna polymerases (5U/ μ l, Dalian TakaRa) L, Dalian TakaRa) 1.0 μ l, 2^ndNest-type PRC reaction product 1.0 μ l, FBA-SP3 (10 μm of ol/l) 1.0 μ l, ddH₂O adds to 50 μl.Reaction condition：94 DEG C of 30s, 65 DEG C of 1min, 72 DEG C of 2min, 94 DEG C of 30s, 65 DEG C of 1min, 72 DEG C of 2min, 94 DEG C of 30s, 44 DEG C 1min, 72 DEG C of 2 min, totally 15 recycle；72 DEG C of 10min, reaction was completed.

3^rdNest-type PRC reaction product cuts purpose band (such as after 1% (mass/volume concentration) agarose gel electrophoresis Shown in Fig. 2), it is purified using DNA fragmentation gel purification kit (being purchased from the green skies).DNA fragmentation after purification is through TA grams Grand insertion pMD18-T carriers (being purchased from Dalian TakaRa companies), convert DH5 α competent cells；Wherein competent cell presses chlorine Change calcium method (the Molecular Cloning:A Laboratory guide third edition, Pehanorm Brooker write, and Huang Peitang etc. is translated, and Science Press publishes) to prepare.It chooses Amp resistant transformants are selected to carry out Zengjing Granule, plasmid extraction.Recombinant plasmid sample send to Dalian TakaRa companies and is sequenced, and obtains Such as SEQ ID NO：DNA sequence dna shown in 1, it was demonstrated that be expected pLsFBA gene orders.

Embodiment 5：Chromosome walking obtains 3 ' flank sequence (terminator) of LsFBA genes

The present embodiment is completed also with Genome Walking Kit (being purchased from Dalian TakaRa).

According to the FBA DNA sequence dnas obtained in embodiment 3,3 Specific Primer (gene-specific primer) are designed Respectively FBA-SP11：5 '-GCATACGATCTCTTCTAATAATTGCC-3 ', FBA-SP22：5’- CGATCCCCGTGTCTGGGTTCGCGAG-3 ' and FBA-SP33：5 '-CTATGTCGGAGCGTGTCAAGGTTGCC-3 ', as Sense primer is carried out according to kit specification the operation of 3 ' flank chromosome walkings, except Specific Primer are respectively by FBA- SP1, FBA-SP2, FBA-SP3 are changed to FBA-SP11 successively, outside FBA-SP22, FBA-SP33, the other the same as in Example 4.

3^rdNest-type PRC reaction product (as shown in Figure 3) is carried out using DNA fragmentation gel purification kit (being purchased from the green skies) Purifying clones through TA and is inserted into pMD18-T carriers (being purchased from Dalian TakaRa companies), converts DH5 α competent cells；Wherein experience By Calcium Chloride Method, (the Molecular Cloning:A Laboratory guide third edition, Pehanorm Brooker write state cell, and Huang Peitang etc. is translated, and Science Press goes out Version) it prepares.It selects Amp resistant transformants and carries out Zengjing Granule, plasmid extraction.Recombinant plasmid sample is sent to Dalian TakaRa companies Sequencing, obtains such as SEQ ID NO：DNA sequence dna shown in 2, it was demonstrated that be expected ester of Harden Young aldolase terminator (LsFBAt) gene order.

Embodiment 6：LsFBA promoter-open reading frame-terminator full-length genes obtain

According to the promoter and terminator sequence obtained in embodiment 4 and embodiment 5, redesigns pair of primers and carry out The amplification of LsFBA " promoter-open reading frame-terminator " full-length gene.pFBA-p2： 5’- TTTCTTGAAGGAGACGACTGGCAG-3 ', FBAt-p2： 5’-GTATACATGCATGGATTTTGACCG-3’.With embodiment 3 The L.starkeyi NRRL Y-11557 genomic DNAs of middle preparation are that template carries out PCR amplification.PCR system (50 μ l)：10× Speed buffer (Dalian TakaRa) 5.0 μ l, dNTPs (10mmol/l) 1.0 μ l, sense primer (10 μm of ol/l) 2.0 μ l, Downstream primer (10 μm of ol/l) 2.0 μ l, SpeedSTAR^TM(amplification rate is fast, 1kb/10s, is purchased from Dalian for HS archaeal dna polymerases TakaRa companies) 0.5 μ l, genomic DNA template (120ng/ μ l) 2 μ l, ddH₂O adds to 50 μ l.Reaction condition：98 DEG C of 1min, 98 DEG C of 10s, 65 DEG C of 1.0min, 35 cycles, 72 DEG C of 10min, 4 DEG C reaction was completed.(mass/volume is dense through 1% for PCR product Degree) it is purified using PCR fragment purification kit (purchased from the green skies) after agarose gel electrophoresis analysis.Segment is through TA grams Grand insertion pMD18-T carriers (being purchased from Dalian TakaRa companies), convert DH5 α competent cells；Wherein competent cell presses chlorination It is prepared by calcium method (the Molecular Cloning:A Laboratory guide third edition, Pehanorm Brooker write, and Huang Peitang etc. is translated, and Science Press publishes).It selects Amp resistant transformants carry out Zengjing Granule, plasmid extraction.Recombinant plasmid sample send to Dalian TakaRa companies and is sequenced, it was demonstrated that is Expected pLsFBAt (ester of Harden Young aldolase) full length gene sequence, the recombinant vector are named as T-FBA.

Embodiment 7：RF PCR cloning PCRs build hygromycin protein expression box FBAHYG

According to HYG protein sequences commission Shanghai Sangon Biotech Company full genome synthesis HYG genes (such as SEQ ID of NCBI reports NO：Shown in 6).Using the gene of synthesis as template, reference literature method (van den Ent, F., and Lowe, J.J Biochem Biophys Methods, 2006,67,67-74.), design RF cloning primers： HYG-RF-p1：5'- ATCGTCATATTCGTGGTCTCTGACAATGCCGGA GCTCACGGCGACGTCGG-3 ' and HYG-RF-p2：5'- TTAGAATCCCAACAT TAACGGGAGCTATTCTTTCGCCCGCGGGCGCGT-3 ' are primer, carry out PCR amplification.Carry out RF The first round expands.System (50 μ l)：5 × Prime buffer (Dalian TakaRa) 10.0 μ l, dNTPs (2.5mmol/l) 4.0 μ L, sense primer (10 μm of ol/l) 2.0 μ l, downstream primer (10 μm of ol/l) 2.0 μ l, PrimeSTAR^TMHS archaeal dna polymerases are (big Even TakaRa) 1.0 μ l, T-GFPuv plasmid (100 ng/ μ l) 1 μ l, ddH₂O adds to 50 μ l.Reaction condition：95 DEG C of 3min, 98 DEG C 8s, 49 DEG C of 15 s, 72 DEG C of 1min, 35 cycles, 72 DEG C of 10min, 4 DEG C reaction was completed.RF I reaction products utilize DNA fragmentation glue Recovery purifying kits, -20 DEG C save backup.

RF II reactions：5 × Prime buffer (Dalian TakaRa) 10.0 μ l, dNTPs (2.5mmol/l) 4.0 μ l, it is real Apply the 1.0 μ l of T-FBA plasmids (100ng/ μ l) built in example 5, RF I reaction products (200ng/ μ in the present embodiment abovementioned steps L) 5.0 μ l, PrimeSTAR^TMHS archaeal dna polymerases (Dalian TakaRa) 1.0 μ l, ddH₂O adds to 50 μ l.Reaction condition：95℃ 3min, 68 DEG C of 12min, later next 95 DEG C of 30s, 65 DEG C of 45s (- 1 DEG C/cyc), 68 DEG C of 12min, 15 cycles carry out again One wheel：95 DEG C of 30s, 55 DEG C of 45s, 68 DEG C of 12min, 20 cycles, 72 DEG C of 10min, 4 DEG C reaction was completed.

DpnI digest and it is electroporated：It takes 8 μ l RF II reaction products that 1 μ l DpnI are added and (is purchased from New England Biolabs) and 1 μ l DpnI buffer, after acting on 120min removal original T-FBA plasmids after mixing at 37 DEG C, 2 μ l is taken to shock by electricity DH5 α competent cells are converted, competent cell prepares (the Molecular Cloning:A Laboratory guide third edition, Pehanorm Brooker by standard method Write, Huang Peitang etc. is translated, and Science Press publishes), electroporated parameter：2200-2500V, 400 Ω, 25 μ F, 0 DEG C, 4-8ms.It chooses It selects Amp resistant transformants to carry out Zengjing Granule, plasmid extraction, and utilizes RF I reaction the primers HYG-RF-p1 and HYG- RF-p2 carries out bacterium colony PCR identifications, identifies that positive recombinant vector send Dalian TakaRa to be sequenced, and obtains 5 ' ends and 3 ' ends point Not Wei FBA promoters and FBA terminators FBAHYG expression cassettes, meanwhile, which is named as T-FBAHYG.Completely FBAHYG expression cassettes such as SEQ ID NO：(pLsFBA-HYG-LsFBAt) shown in 7.

Embodiment 8：Oil-producing saccharomyces oleaginosus (Lipomyces lipofer) CBS 944 is carried out using FBAHYG expression cassettes

Agrobacterium tumefaciems (Agrobacterium tumefaciens) is a kind of Gram-negative bacteria, under field conditions (factors) Host tissue can be entered by scab or wound, its internal section of DNA is transferred in Plant Genome, host is finally stimulated Develop it is abnormal, infecting position formed crown gall nodule, cause root knot.This characteristic of Agrobacterium is applied to plant gene earliest The transformation of group, referred to as ATMT technologies.Subsequent ATMT technologies are widely used in a variety of fungies and Yeast Genetics transformation.

ATMT conversion processes can substantially be divided into vector construction, Agrobacterium activation, host material preparation, cotransformation and conversion Son screens this five steps.First in the interregional suitable selected markers of insertion of the T-DNA of binary vector, and it is transferred to Agrobacterium； It is induced with acetosyringone (AS) after Agrobacterium tumefaciens attachment activation containing binary vector；Host strain dilutes after overactivation To certain concentration；Agrobacterium after activation and induction is mixed with host material, is coated on the co-cultivation for being covered with mounting medium On tablet, cotransformation is carried out at a suitable temperature；The mixed bacterium of co-cultivation is transferred in screening flat board, it is most suitable to be placed in host strain It is cultivated at suitable temperature, until transformant occurs.

1. the structure of the binary vector pZPK-FBAHYG containing FBAHYG expression cassettes

PZPK is that laboratory is voluntarily built according to common molecular cloning process.Construction method is as follows：

With 5 '-GTGGAACGAAAACTCACGTTAAGGGATTTTGGTCATGAGCCATATTC of pZPK-RF-P1 AACGGGA-3 ' and pZPK-RF-P2：5’- GATTGTAACGATGACAGAGCGTTGCTGCCTGTGATTAGAAAAACTCAT CGAGCA-3 ' is that primer obtains kanamycins (KAN) resistant gene piece from amplification on pET24b (+) (being purchased from Novegen companies) Section then utilizes RF cloning process (as shown in Example 3) by pPZP200 carriers (purchased from the collection of Unite States Standard biology product The heart (ATCC)) on streptomysin/spectinomycin (aadA) resistant gene replace with KAN, the carrier obtained is named as PZPK.

The structure of pZPK-FBAHYG carriers then uses FBAHYG-RF-P1： 5’-GAATTGAATTCGAGCTCGCTCGGTA CCCGGTTGCGATAATAGCACAC CATGC-3 ' and FBAHYG-RF-P2： 5’-GCTTGCATGCTGCAGGTCGACTCTAGA TCTGCGCAGGTTGAATGGTA GCGG-3 ' are primer, are obtained as template amplification using the T-FBAHYG that embodiment 7 is built FBAHYG segments are inserted into pZPK double bases by FBAHYG segments after the recycling of PCR glue using RF cloning process (as shown in Example 7) Between the LB and RB of carrier.The carrier obtained is named as pZPK-FBAHYG, and structure is as shown in Figure 4.

2. the structure of the Agrobacterium tumefaciens attachment containing pZPK-FBAHYG plasmids

The pZPK-FBAHYG binary vectors obtained are converted using electroporated method to Agrobacterium tumefaciems In (Agrobacterium tumefaciems) AGL1 (be purchased from Unite States Standard biology product collecting center (ATCC)), in containing Picking transformant on the LB tablets of 50ng/ μ l kanamycins.Agrobacterium-mediated Transformation uses the method for bacterium colony PCR to be tested first Card.Correct transformant is verified, plasmid therein is extracted, in conversion to Escherichia coli.Binary vector is a large amount of by Escherichia coli Sequence verification is sent after enrichment.Agrobacterium strains containing sequencing correct plasmid are engineered strain,

Expression of the 3.FBAHYG genes in 944 yeast of oil-producing saccharomyces oleaginosus CBS

Oil-producing saccharomyces oleaginosus CBS 944 is purchased from barms collection (CBS, Centraalbureau Voor collection).It takes 944 yeast of oil-producing saccharomyces oleaginosus CBS after the activation of one ring, is connected to 5ml YEPD (glucose 20.0g/l, yeast extract 10.0g/l, peptone 20.0g/l, pH 6.0) in culture solution, 30 DEG C, 200r/min is incubated overnight.With sterile water washing one time Afterwards, it is adjusted to OD₆₀₀=0.1-0.8, it is spare.Containing pZPK-FBAHYG plasmids Agrobacterium activation after, be connected to 5ml contain card that In the LB liquid of mycin (50ng/ μ l) and rifampin (50ng/ μ l), 30 DEG C, 200r/min overnight incubations.With sterile water washing One time, it is adjusted to OD₆₀₀=0.1-1.6, it is spare.

Take above-mentioned yeast and each 400 μ l of Agrobacterium dilution, mixing, directly drop in induction tablet (5mmol/l glucose, 0.5% glycerine, 1.45g/l potassium dihydrogen phosphates, 2.05g/l dipotassium hydrogen phosphates, 0.15g/l sodium chloride, seven water sulfuric acid of 0.5g/l Magnesium, 66mg/l calcium chloride dihydrates, 2.48g/l green-vitriols, 0.5g/l ammonium sulfate, 40mmol/l MES (2- (N- morpholines) Ethanesulfonic acid), 2% agar powder, 200 μm of ol/L acetosyringones) on (Bundock, P., den Dulk-Ras, A., Beijersbergen, A., et al.EMBO J., 1995,14,3206-3214.), 24-25 DEG C, cultivate 4 days.With the left sides 10ml Right sterile water is washed down lawn is mixed, and 3000 r/min centrifuge 5min, discard the liquid that upper layer mainly contains Agrobacterium, remaining Cell be resuspended with 800 μ l sterile waters, take 50-200 μ l to be coated on screening flat board (the L hygromycin of μ containing 50ng/ and 300 μ g/mL heads The YEPD of spore rhzomorph) on, it is cultivated in 30 DEG C, until transformant occurs.

4. the PCR of 944 hygromycin transformants of oil-producing saccharomyces oleaginosus CBS is identified

6 hygromycin resistance oil-producing saccharomyces oleaginosus transformants of random picking, access the YEPD containing 50ng/ μ L hygromycin In (glucose 20.0g/l, yeast extract 10.0g/l, peptone 20.0g/l, pH 6.0) liquid, in 30 DEG C of shaking table cultures 24h.Bead broken wall method described in reference implementation example 3 extracts 944 genomic DNAs of oil-producing saccharomyces oleaginosus CBS, using HYG-RF- P1 and HYG-RF-p2 is primer, carries out PCR identifications.PCR system (50 μ l)：5 × Prime buffer (Dalian TakaRa) 10.0 μ l, dNTPs (2.5mmol/l) 4.0 μ l, sense primer (10 μm of ol/l) 2.0 μ l, downstream primer (10 μm of ol/l) 2.0 μ L, PrimeSTAR^TM1.0 μ l of HS archaeal dna polymerases (Dalian TakaRa), genomic DNA (20ng/ μ l) 1 μ l, ddH₂O adds to 50 μl.Reaction condition：95 DEG C of 3min, 98 DEG C of 8s, 49 DEG C of 15s, 72 DEG C of 1min, 35 cycles, 72 DEG C of 10min, 4 DEG C reaction was completed. PCR product is analyzed through 1% (mass/volume concentration) agarose gel electrophoresis.The results are shown in Figure 5.As it can be seen that external source HYG segments It is successfully integrated into 944 genomes of oil-producing saccharomyces oleaginosus CBS.

5. the Western blot analyses of 944 hygromycin transformants of oil-producing saccharomyces oleaginosus CBS

In addition to directly determining that Lipomyces starkeyi FBA promoters can start hygromycin using hygromycin resistance phenotype Resistant gene is outside the expression of oil-producing saccharomyces oleaginosus, since the ends C- of hygromycin gene expression product carry 6 × His Tag also determines the expression of gene using anti-His Tag antibody by Western blot analyses.Above-mentioned PCR identifications are correct 6 transformants, 3 transformants of random picking, access 10ml contains in the YEPD liquid of 50ng/ μ L hygromycin, in 30 DEG C of shaking tables 48h is cultivated, 4000r/min centrifuges 10min and collects bacterial strain.After the thalline of acquisition sterile water washing one time, the glass of 400ul is added Glass pearl breaks bacterium buffer solution (20mmol/lTris-HCl, 10mmol/l magnesium chloride, 1mmol/l EDTA, 5% glycerine, 1mmol/l DTT, 0.3mmol/l ammonium sulfate, 1mmol/l PMSF) it is resuspended, add the pickling glass pearl of equal volume.It is broken using bead Wall approach smudge cells extract total protein of cell (the 13rd chapter of the fine works molecular biology experiment guide third edition, the works such as Ao Sibai, Yan Zi Grain husk etc. is translated, and Science Press publishes).After total protein of cell is detached on 12%SDS-PAGE glue, it is transferred to cellulose nitrate On plain film (Solarbio, Beijing, China), the green skies biotechnology in Shanghai (is purchased from using the anti-His-tag antibody of mouse Co., Ltd) and horseradish peroxidase-labeled goat anti-mouse IgG (being purchased from the green skies Bioisystech Co., Ltd in Shanghai) As primary antibody and secondary antibody, DAB horseradish peroxidase colour reagents box (be purchased from the green skies Bioisystech Co., Ltd in Shanghai) into Row colour developing, can be observed the expression (Fig. 6) of hygromycin gene.

Embodiment 9：The URA3 gene knockouts of Lipomyces starkeyi NRRL Y-11557 are carried out using FBABLE expression cassettes And BLE protein expressions

Herein using Lipomyces starkeyi URA3 genes as integration site, pass through RF cloning process so that FBABLE 5 ' and 3 ' ends carry the Lipomyces starkeyi URA3 homologous recombination arms of about 1500bp, utilize BLE resistance screenings Label carries out the screening of transformant.

1. the acquisition of Lipomyces starkeyi URA3 genes

According to Lipomyces starkeyi NRRL Y-11557 gene order-checkings as a result, searching out URA3 (orotidine- 5 '-phosphate decarboxylase) gene, designs special primer：URA3-P1： 5’-TGGCTCCAATGAGTCGTTGC TTCCAGCGC-3 ' and URA3-P2：5 '-CAAGGAGAGAGGCGTTAAGCCTAAAG-3 ', with Lipomyces starkeyi NRRL Y-11557 genomes are template, and amplification obtains the full-length genome sequence containing URA3 promoters, reading frame and terminator. After DNA QIAquick Gel Extraction Kit purified pcr products, pMD18-T carriers are cloned into, are transformed into Escherichia coli (E.coli) DH5 α senses By state cell.It selects Amp resistant transformants and carries out Zengjing Granule, plasmid extraction.Recombinant plasmid sample is sent to Dalian TakaRa public affairs Department's sequencing, sequence results are compared with gene order-checking result, it was demonstrated that include URA3 promoters, the DNA of terminator and reading frame Sequence (such as SEQ ID NO：Shown in 8, pURA3-URA3-URA3t).The plasmid is named as T-URA3.

2.RF cloning process builds FBABLE expression cassettes

With pPICZ α A (being purchased from Invitrogen) for template, pair of primers BLE-RF-p1 is utilized： 5’- GGTTTTCGTCGTCTCACTACATTGATCATGGCCAAGTTGACCAGTGCC G-3 ' and BLE-RF-p2： 5’- GTTCCCACGATTTTAGATGGATTCCATCAGTCCTGCTCCTCGGCCAC G-3 ' carry out PCR amplification.According to embodiment 3 Described in RF cloning process, using T-FBA as skeleton, by BLE (SEQ ID NO：9) it is inserted between pLsFBA and LsFBAt, structure The plasmid built up is named as T-FBABLE.

3.URA3-FBABLE knocking out the structure of box

Using primers F BABLE-RF-P1： 5'-CTTGTCTTCTACAGTATATCCCTAAATTCAACCGGTTGCGATAA TAGCA CACCATGC-3 ' and FBABLE-RF-P2： 5'-CTGCCCTTCACTCATCAATTACCAATCTGCGCAGGTTGAAT GGTAGCG G-3 ' are primer, carry out PCR amplification.According to the RF cloning process described in embodiment 3, using T-FBABLE as bone FBABLE is inserted into LsURA3 by frame, and the sequence of gained is after Takara is sequenced such as SEQ ID NO：(pURA3- shown in 10 FBABLE-URA3t), the plasmid being built into is named as T-URA3-FBABLE, and structure is as shown in Figure 7.Recombinant plasmid sample send to Dalian TakaRa companies are sequenced, and sequence results are compared with gene order-checking result, it was demonstrated that the genetic fragment is two sections and carries The FBABLE of 1500bp URA3 recombination arms knocks out box.

4.URA3-FBABLE knocking out the preparation of box

Using T-URA3-FBABLE plasmids as template, using URA3-P1 and URA3-P2 as primer, carries out URA3-FBABLE and strike Except a large amount of preparations of box.PCR system (500 μ l)：10 × Speed buffer (Dalian TakaRa) 50.0 μ l, dNTPs (10mmol/l) 10.0 μ l, sense primer (10 μm of ol/l) 20.0 μ l, downstream primer (10 μm of ol/l) 20.0 μ l, SpeedSTAR^TMHS archaeal dna polymerases (amplification rate is fast, 1 kb/10s, is purchased from Dalian TakaRa companies) 5.0 μ l, genomic DNA Template (120ng/ μ l) 15.0 μ l, ddH₂O adds to 500 μ l, is dispensed after mixing.Reaction condition：98 DEG C of 1min, 98 DEG C of 10s, 65 DEG C 60s, 35 cycles, 72 DEG C of 10min, 4 DEG C reaction was completed.

PCR product utilizes PCR fragment purification kit after the analysis of 1% (mass/volume concentration) agarose gel electrophoresis (being purchased from the green skies) is purified.A concentration of 300ng/ μ l of DNA fragmentation after purification, totally 50 μ l, -20 DEG C save backup.

5. prepared by Lipomyces starkeyi NRRL Y-11557 competent cells

The preparation of Lipomyces starkeyi NRRL Y-11557 competent cells：Lipomyces starkeyi NRRL Y-11557 (bacterial strain chooses colony inoculation 10ml YEPD culture mediums (glucose 20.0g/l, yeast extract 10.0g/l, peptone 20.0g/ L, pH 6.0), 30 DEG C, 200rpm, cultivate 20h；The fresh YEPD culture mediums of 1: 50 ratio of culture switching, (500ml is bored 100ml Shape bottle, liquid amount 100ml), 30 DEG C, 200rpm, 6-9h is cultivated, OD values reach 0.6-1.2；Culture ice bath 10-30min, 4 DEG C, 4000r/min centrifuges 5min, abandons supernatant；0 DEG C of sterile Milli-Q is washed 1 time；0 DEG C of 1mol/l sorbitol washes 2 times；Ice Bath, it is spare.100 μ l Lipomyces starkeyi NRRL Y-11557 competent cells are taken, 10 μ of URA3-FBABLE expression cassettes is added L (3 μ g in total) is moved into after mixing and is cooled in 0 DEG C of electric shock cup in advance, parameter：0.8-2.0 kilovolts of voltage, 200 Ω of resistance, capacitance 25 μ F, time 4-10ms；1mlYEPD, 30 DEG C of incubation 1-2h is added after electric shock immediately；It is coated with YEPD tablets and (contains bleomycin 50ng/ μ l), 30 DEG C of cultures 5 days or more.The results are shown in Figure 8.

6. the bacterium colony PCR identifications of transformant

Blasticidin resistance transformant is inoculated with 10ml YEPD fluid nutrient mediums (μ l of 50ng/ containing bleomycin).With reference to implementation Bead broken wall method extracts genomic DNA in example 3, and PCR identifications are carried out using BLE-RF-p1 and BLE-RF-p2.PCR system (25μl)：10 × Speed buffer (Dalian TakaRa) 2.5 μ l, dNTPs (10mmol/l) 0.5 μ l, sense primer (10 μ Mol/l) 1.0 μ l, downstream primer (10 μm of ol/l) 1.0 μ l, SpeedSTAR^TM(amplification rate is fast, 1kb/ for HS archaeal dna polymerases 10s is purchased from Dalian TakaRa companies) 0.25 μ l, genomic DNA template (100ng/ μ l) 1.0 μ l, ddH₂O adds to 25 μ l.Instead Answer condition：98 DEG C of 1min, 98 DEG C of 10s, 65 DEG C of 60s, 35 cycles, 72 DEG C of 10min, 4 DEG C reaction was completed.The results show that all Lipomyces starkeyi NRRL Y-11557 recombinant bacterial strains it is amplifiable go out external source BLE genetic fragments, and control strain this Da Shi Saccharomyces oleaginosus NRRL Y-11557 are then without corresponding PCR product.

Phenotype verification further is carried out to the correct transformant of above-mentioned identification.As a result it shows：All recons are in YEPD liquid On body culture medium, bacterial strain normal growth.By same transformant colony inoculation on the SD culture mediums without uracil, without bacterium It falls to be formed.Visible conversion obtains new phenotype, i.e.,：Uracil auxotrophy.5 '-FOA resistant phenotype analysis results show, This uracil auxotrophy Lipomyces starkeyi engineered strain is in culture medium (0.1%5 '-FOA, the grape for containing 5 '-FOA Sugared 70g/L, (NH₄)₂SO₄0.1 g/L, yeast powder 0.75g/L, KH₂PO₄0.4g/L, MgSO₄·7H₂O 1.5g/L, pH 6.0) cultivated on, can normal growth, and the L.starkeyi NRRL Y-11557 of wild type are then in the culture containing 5'-FOA It can not be grown in base.

Therefore, from genotype to phenotype, Lipomyces starkeyi NRRL Y-11557 recombinant bacterial strain URA3 genes are verified Missing.

The expression analysis (transcriptional level expression analysis, RT-PCR) of 7.Ble genes

In addition to directly determining that Lipomyces starkeyi FBA promoters can start rich Lay using bleomycin resistance phenotype In the expression of Lipomyces starkeyi, (bleomycin resistance phenotype is decided by the table of Lay mycin resistant gene to mycin resistant gene Up to) outside, the expression of the transcriptional level of bleomycin resistance gene ble is also had detected using RT-PCR method.

The 2 plants of bacterium colony PCR identifications of random picking and the correct blasticidin resistance transformant inoculation of phenotypic analysis 10mlYEPD fluid nutrient mediums (μ l of 50ng/ containing bleomycin).Cell total rna is extracted with reference to 1 method of embodiment, with reference to embodiment 2 methods carry out reverse transcription (RT) and utilize BLE-p1 using synthesized the first chains of cDNA as template： ATGGCCAAGTTGACCAGTGCCG and BLE-p2：TCAGTCCTGCTCCTCGGCCACG is that primer carries out PCR amplification.PCR bodies It is (25 μ l)：10 × Ex Taq buffer (Dalian TakaRa) 2.5 μ l, dNTPs (10mmol/l) 0.5 μ l, sense primer 1.0 μ l, Ex Taq DNA polymerases of BLE-p1 (10 μm of ol/l) 1.0 μ l, downstream primer BLE-p2 (10 μm of ol/l), 0.25 μ l, The first chains of cDNA template 1.0 μ l, ddH₂O adds to 25 μ l.Reaction condition：98 DEG C of 1min, 98 DEG C of 10s, 65 DEG C of 60s, 35 are followed Ring, 72 DEG C of 10min, 4 DEG C reaction was completed.The results show that all Lipomyces starkeyi NRRLY-11557 recombinant bacterial strains can expand Increase and 0.3kb BLE genetic fragments, and control strain Lipomyces starkeyi NRRL Y-11557 are then without corresponding PCR product (figure 9)。

Embodiment 10：Fatty acid hydroxylase and geneticin resistant albumen are at saccharomyces oleaginosus category (Lipomyces sp.) Expression in CBS 7729

Ricinoleic acid (12-hydroxy-octadeca-cis-9-enoic acid：C18：It is 1-OH) a kind of very valuable The essential industry raw material of value.Existing source is mainly that plant is squeezed, but resource is restricted.From pathogenic epiphyte --- Ergot (Claviceps purpurea) oleate hydroxylase gene (CpFAH, Genbank registration number：EU661785) in micro- life Expression in object can provide a new approach for the supply of ricinoleic acid.It is that screening is marked to utilize genetic resistance genes herein Note starts the expression of oleate hydroxylase gene C pFAH with FBA promoters, and castor-oil plant is synthesized in Lipomyces starkeyi to realize The purpose of oleic acid.

1.FBAKAN knocks out the structure of box

Using primer KAN-RF-P1： 5’-GTTTTCGTCGTCTCACTACATTGATCATGGGTAAGGAAAAGACTCAC G -3 ' and KAN-RF-p2： 5’-GCGGTTCCCACGATTTTAGATGGATTCCATTAGAAAAACTCATCGAG CATC-3’ PCR amplifications are carried out with pFA6-kanmx4 (being purchased from EUROSCARF) for skeleton for primer, amplified production send Takara to be sequenced, As a result such as SEQ ID NO：(Kanmx) shown in 11.It, will using T-FBA as template according to the RF cloning process described in embodiment 3 FBAKAN is inserted into FBA, and the plasmid being built into is named as T-FBAKAN.

The structure of 2.FBACpFAH expression cassettes

This gene, sequence are synthesized according to CpFAH (EU661785) gene commission Shanghai life work full genome reported on NCBI Such as SEQ ID NO：(CpFAH) shown in 12.Primer CpFAH-RF-p1： 5’-GTTTTCGTCGTCTCACTACATTGATCATGGC TTCCGCTACTCCTGCAAT G-3 ' and CpFAH-RF-p2： 5’-GGTTCCCACGATTTTAGATGGATTCCACTACTGAGT CTTCATTGAAA TGGG-3 ' are primer, carry out PCR amplification.According to the RF cloning process described in embodiment 3, it is with T-FBA Skeleton, between oleate hydroxylase gene C pFAH is inserted into promoter pLsFBA and terminator LsFBAt, the plasmid being built into is ordered Entitled T-FBACpFAH.

The structure of 3.FBAKAN-CpFAH carriers

With FBAKAN-KpnI：5 '-ATCGggtaccCGGTTGCGATAATAGCACA CCATG-3 ' and FBAKAN-PstI： 5 '-ACTGctgcagTCTGCGCAGGTTGAATGG TAG-3 ' are primer, and T-FBAKAN is template, and amplification, which obtains, carries KpnI With the FBAKAN sequences of PstI restriction enzyme sites, purified using PCR fragment purification kit (being purchased from the green skies).After purification A concentration of 200ng/ μ l of DNA fragmentation, totally 50 μ l, -20 DEG C save backup.

With FBACpFAH-PstI：5'-ATCGctgcagCGGTTGCGATAATAGCACACCATGC-3 ' and FBACpFAH- XbaI：5'-ACTGtctagaTCTGCGCAGGTTGAATGGTAGCG-3 ' is primer, and T-FBACpFAH is template, and amplification obtains The FBACpFAH sequences with PstI and XbaI enzyme cutting site are obtained, PCR fragment purifications kit (being purchased from the green skies) is utilized to carry out Purifying.A concentration of 220ng/ μ l of DNA fragmentation after purification, totally 50 μ l, -20 DEG C save backup.

PZPK carriers after above-mentioned two segment and KpnI and XbaI enzyme cutting are mixed with the ratio of molar ratio 1: 1: 1, are added Enter the DNA connection reagent Solution I (DNA ligation kit is purchased from Takara companies, article No. 6022) of equal volume, React 10 μ l of total volume.After 16 DEG C connect 2h, converted to DH5 α competent cells by thermal shock, competent cell presses standard side Method is prepared (the Molecular Cloning:A Laboratory guide third edition, Pehanorm Brooker write, and Huang Peitang etc. is translated, and Science Press publishes).Select Kan Resistant transformants carry out Zengjing Granule, plasmid extraction.Recombinant plasmid sample (plasmid construct is as shown in Figure 10) is sent to Dalian TakaRa companies are sequenced, and sequence results are compared with gene order-checking result, sequence such as SEQ ID NO：(FBAKAN- shown in 13 CpFAH).It confirms to include FBAKAN and FBACpFAH segments.

4. the structure of the Agrobacterium tumefaciens attachment containing FBAKAN-CpFAH carriers

Constructed FBAKAN-CpFAH carriers are converted using electroporated method into Agrobacterium AGL1, in containing 50ng/ μ Picking transformant on the LB tablets of l kanamycins.Kalamycin resistance Agrobacterium-mediated Transformation first use bacterium colony PCR method into Row verification.Correct transformant is verified, plasmid therein is extracted after Zengjing Granule, in conversion to Escherichia coli.Binary vector is logical It crosses after Escherichia coli are largely enriched with and send sequence verification.Agrobacterium strains containing sequencing correct plasmid be then be recombinational agrobacterium bacterium Strain.

Expression of the 5.FBAKAN-CpFAH expression cassettes in saccharomyces oleaginosus belongs to 7729 yeast of CBS

Saccharomyces oleaginosus belongs to CBS 7729 and is purchased from barms collection (CBS, Centraalbureau Voor collection).It takes 1715 yeast of L.starkeyi CICC after the activation of one ring, is connected to 5ml YEPD (glucose 20.0g/l, yeast extract 10.0g/l, peptone 20.0g/l, pH 6.0) in, 25 DEG C, 200r/min is incubated overnight.After sterile water washing one time, adjust It saves to OD₆₀₀=1-2, it is spare.After Agrobacterium activation, it is connected to 5ml and contains kanamycins (100ng/ μ l) and rifampin (80ng/ μ L) in LB liquid, 250 DEG C, 200r/min overnight incubations.With sterile water washing one time, it is adjusted to OD₆₀₀=1-3, it is spare.

Above-mentioned yeast and each 200 μ l of Agrobacterium dilution are taken, mixing, directly drop are in induction tablet ((5mmol/l grapes Sugar, 0.5% glycerine, 1.45g/l potassium dihydrogen phosphates, 2.05g/l dipotassium hydrogen phosphates, 0.15g/l sodium chloride, seven water sulphur of 0.5g/l Sour magnesium, 66mg/l calcium chloride dihydrates, 2.48g/l green-vitriols, 0.5g/l ammonium sulfate, 40mmol/l MES (2-N- morphines Quinoline) ethanesulfonic acid), 2% agar powder, 200 μm of ol/L acetosyringones)) on, it 28 DEG C, cultivates 2 days.With the sterile water of 10ml or so Mixing lawn is washed down, 3000r/min centrifuges 10min, discards the liquid that upper layer mainly contains Agrobacterium, and remaining cell is used 1ml sterile waters are resuspended, and take and are coated on screening flat board (YEPD of the l Geneticins of μ containing 50ng/ and 300 μ g/ml cephalosporins) in right amount On, it is cultivated in 25 DEG C, until transformant occurs.

6. saccharomyces oleaginosus belongs to the bacterium colony PCR identifications of 7729 transformants of CBS

6 7729 transformants of geneticin resistant saccharomyces oleaginosus CBS access 50ml of random picking contain 50 ng/ μ l heredity It is cultivated in the YEPD liquid of mycin, bead broken wall method described in reference implementation example 3 extracts genomic DNA, using FBAKAN- RF-P1 and FBAKAN-RF-P2, CpFAH-RF-p1 and CpFAH-RF-p2 are primer, carry out PCR identifications.The results show that external source Gene KAN and CpFAH are successfully integrated into 7729 genomes of saccharomyces oleaginosus CBS.

7. recombinating saccharomyces oleaginosus belongs to the fermenting experiment that CBS 7729 produces ricinoleic acid

3 bacterium colony PCR identifications of picking are correct, and correctly transformant on tablet after activating 2-3 days, picking size basic one The single bacterium colony of cause is connected in the YEPD culture mediums that 5ml contains 50ng/ μ l Geneticins.Culture for 24 hours, is connect with 1: 50 inoculum concentration In the YEPD culture mediums that 50ml contains 50ng/ μ L Geneticins, as secondary seed.After secondary seed culture for 24 hours, take 5mL is added in the YEPD fermentation mediums of 45ml.A pH is adjusted in fermentation process per 12h.Terminate after culture 120h.Take 40ml Zymocyte liquid is placed in 50ml round bottom centrifuge tubes, and 8000r/min room temperatures centrifuge 5min and collect thalline, are washed with deionized 2 times, 105 DEG C are dried for 24 hours to constant weight.It is cooling in drier after taking-up, record is then weighed, is added by 1g dry myceliums after weighing The ratio of 6ml4mol/l hydrochloric acid, often pipe addition 4ml4mol/l hydrochloric acid, 78 DEG C of water-baths digest 1h, 2 times of volumes of addition after cooling Chloroform/methanol (1: 1, v/v) fully vibrates mixing, is centrifuged after extracting 1h, chloroform layer is taken to be put into a new centrifuge tube.Water It is mutually extracted again with isometric chloroform once, is fully centrifuged after oscillation, take chloroform layer to be put into above-mentioned new centrifuge tube and merge, and Isometric 0.1% sodium chloride solution is added, is centrifuged after vibrating mixing.Lower layer's organic phase is carefully extracted and injected with syringe In preprepared glass funnel (funnel fills in degreasing cotton in advance, and appropriate anhydrous sodium sulfate is added), wait for having in funnel Machine solution is flowed into substantially in the glass oil bottle of lower section, and suitable chloroform is added and rinses funnel 4 times, is flowed into together in the oil bottle of lower section, Extraction has the chloroform of grease to carry out Grease Collection using Rotary Evaporators, and the oil bottle for having collected grease is put into baking oven drying for 24 hours.

Esterification is carried out to bacterium oil：The grease to be measured for weighing 70.0mg, is added 5% KOH/CH₃OH solution 0.5ml, add Heat reflux 50min, is then added BF₃Methanol solution (V_{BF3 diethyl ether solutions}∶V_CH3OH=4: 10) 0.7ml, continue the 10min that flows back.It is cold But 1ml deionized waters and 0.7ml n-hexanes are added afterwards, organic phase is sucked out after mixing, gas is used for after deionized water is washed twice Analysis of hplc.

8. recombinating the detection that saccharomyces oleaginosus CBS 7729 produces ricinoleic acid

The transesterification obtained sample of step 7 is dissolved in n-hexane, using document (Meesapyodsuk, D., and Qiu, X.Plant Physiol., 2008,147,1325-1333.) method in is detected, and standard items are ricinoleic acid first Ester (CAS：141-24-2), negative control is the transesterification product of grease of wild type saccharomyces oleaginosus CBS 7729.The results show that being transferred to Ricinoleic acid is truly had to generate in the saccharomyces oleaginosus CBS 7729 of CpFAH genes, content is 155 μ g/ml, and total amount accounts for overall free fat 52% or more of fat acid content.

9, expression analysis --- the Western blot of oleate hydroxylase in saccharomyces oleaginosus CBS 7729 are recombinated

Determine that Lipomyces starkeyi FBA promoters can start oleic acid in addition to directly producing phenotype by ricinoleic acid '-hydroxylase gene is outside the expression in saccharomyces oleaginosus category, since the ends C- of oleate hydroxylase gene expression product carry 6 × His Tag, the expression for also passing through immunoblotting assay oleate hydroxylase gene using anti-His Tag antibody.PCR in above-mentioned steps 6 Identify correct 6 transformants, random picking 3, access 10ml contains in the YEPD liquid of 50ng/ μ L Geneticins, in 30 DEG C shaking table culture 48h, 4000 r/min centrifuge 10min and collect bacterial strain.After the thalline of acquisition sterile water washing one time, it is added The bead of 400ul breaks bacterium buffer solution, and (20mmol/l Tris-HCl, 10mmol/l magnesium chlorides, 1mmol/l EDTA, 5% is sweet Oil, 1mmol/l DTT, 0.3mmol/l ammonium sulfate, 1mmol/l PMSF) it is resuspended, add the pickling glass pearl of equal volume. Using bead broken wall method smudge cells extraction total protein of cell (the 13rd chapter of the fine works molecular biology experiment guide third edition, Austria The works such as Si Bai, face sub- grain husk etc. are translated, and Science Press publishes).After total protein of cell is detached on 12%SDS-PAGE glue, turn It moves on on nitrocellulose filter and (is purchased from Shanghai bio-engineering corporation), the green skies in Shanghai (are purchased from using the anti-His-tag antibody of mouse Bioisystech Co., Ltd) and horseradish peroxidase-labeled goat anti-mouse IgG (purchased from the green skies biotechnology in Shanghai it is limited Company) it is used as primary antibody and secondary antibody, DAB horseradish peroxidase colour reagents box (to be purchased from the green limited public affairs of skies biotechnology in Shanghai Department) it develops the color, the expression (Figure 11) of oleate hydroxylase gene can be observed.

Embodiment 11：Tangerine woods saccharomyces oleaginosus (Lipomyces kononenkoae) ATCC is carried out using FBAHYG expression cassettes 44833 conversion

Tangerine woods saccharomyces oleaginosus ATCC 44833 (be purchased from Unite States Standard biology product collecting center (ATCC)) by inclined plane inoculating to In 50ml YEPD fluid nutrient mediums, for 24 hours, then with 1: 50 volume ratio bacterium solution is transferred to respectively in 30 DEG C of shaking table cultures In 100ml YEPD fluid nutrient mediums, exponential phase is reached in 30 DEG C of 12 h of shaking table culture.3000g centrifuges 5min and collects thalline, Cell is resuspended in the sterile water of 25mL.20 DEG C, 3000g centrifuges 5min and collects cell.Again with sterile water washing one time, from The heart collects cell.Cell is resuspended with the sterile water of 1mL.Cell is transferred in 1.5mL centrifuge tubes, 13000g 30s rapid centrifugations Cell is collected, supernatant is abandoned.Above-mentioned cell is resuspended with 1mL sterile waters, takes 250 μ L cells (＞ 10⁸A cell) 1.5mL centrifugations are added Guan Zhong.50% (w/v) PEG3350 is sequentially added in this clean 1.5mL centrifuge tube in advance, 36 μ L 1mol/L LiAc boil The 50 μ L 2g/L salmon sperm dnas crossed, 1 μ g FBAHYG knock out box, mixing.Mixing sample of the cell in centrifuge tube is mixed It is even, it is placed in 42 DEG C of thermal shock 40min.Rapid centrifugation collects cell, is all coated on screening flat board.30 DEG C are cultivated 3-4 days.

Positive recombinant is inoculated with 10ml YEPD fluid nutrient mediums (μ l of 250ng/ containing hygromycin).With reference to being extracted in embodiment 3 After genomic DNA, PCR identifications are carried out using HYG-RF-p1 and HYG-RF-p2.PCR system (25 μ l)：10×Speed Buffer (Dalian TakaRa) 2.5 μ l, dNTPs (10mmol/l) 0.5 μ l, sense primer (10 μm of ol/l) 1.0 μ l, downstream is drawn Object (10 μm of ol/l) 1.0 μ l, SpeedSTAR^TM(amplification rate is fast, 1kb/10s, public purchased from Dalian TakaRa for HS archaeal dna polymerases Department) 0.25 μ l, genomic DNA template (100ng/ μ l) 1.0 μ l, ddH₂O adds to 25 μ l.Reaction condition：98 DEG C of 1min, 98 DEG C 10s, 65 DEG C of 60s, 35 cycles, 72 DEG C of 10min, 4 DEG C reaction was completed.PCR product agarose gel analysis is the results show that all Recon contains external source HYG genes (result is not shown).

In addition to directly determining that Lipomyces starkeyi FBA promoters can start hygromycin using hygromycin resistance phenotype Resistant gene is outside the expression in tangerine woods saccharomyces oleaginosus ATCC 44833, since the ends C- of hygromycin gene expression product are taken Band 6 × His Tag also determine the expression of gene using anti-His Tag antibody by Western blot analyses.Western Blot operates reference implementation example 10.The expression of hygromycin gene can be observed (result is not shown).

Embodiment 12：Mamillary trichosporon cutaneum (Trichosporon capitatum) is carried out using FBAHYG expression cassettes The conversion of 36553 yeast of ATCC

1.FBAHYG knocks out the preparation of box

Mamillary trichosporon cutaneum TCC 36553 (is purchased from Unite States Standard biology product collecting center (ATCC)).Utilize pFBA-p1 It is primer with FBAt-p2, using T-FBAHYG as template, amplification obtains FBAHYG and knocks out box.It is purified using DNA QIAquick Gel Extraction Kits After PCR product, a concentration of 500ng/ μ l of DNA fragmentation after purification are tested, totally 50 μ l, -20 DEG C save backup.

2. prepared by 36553 competent cells of mamillary trichosporon cutaneum ATCC

The preparation of 36553 competent cells of mamillary trichosporon cutaneum ATCC：36553 (bacterium of mamillary trichosporon cutaneum ATCC Colony inoculation 10ml YEPD culture mediums (glucose 20.0g/l, 10.0 g/l of yeast extract, peptone 20.0g/l, pH are chosen in strain 6.0), 30 DEG C, 200rpm, 20h is cultivated；The fresh YEPD culture mediums of 1: 50 ratio of culture switching, 100ml (500ml conical flasks, Liquid amount 100ml), 30 DEG C, 200rpm, 6-9h is cultivated, OD values reach 0.6-1.2；Culture ice bath 10-30min, 4 DEG C, 4000rpm centrifuges 5min, abandons supernatant；0 DEG C of sterile Milli-Q is washed 1 time；0 DEG C of 1mol/l sorbitol washes 2 times；Ice bath, it is standby With.50 μ l mamillary trichosporon cutaneums ATCC, 36553 competent cells are taken, 10 μ l (5 μ g in total) of FBAHYG expression cassettes are added, mix It moves into after even and is cooled in 0 DEG C of electric shock cup in advance, parameter：0.8-2.5 kilovolts of voltage, 200 Ω of resistance, capacitance 25 μ F, time 4- 10ms；1ml YEPD, 30 DEG C of incubation 1-2h is added after electric shock immediately；Coating YEPD tablets (μ l of 250ng/ containing hygromycin), 30 DEG C Cultivate 5 days or more.

3. the identification of mamillary trichosporon cutaneum transformant

Positive recombinant is inoculated with 10ml YEPD fluid nutrient mediums (μ l of 250ng/ containing hygromycin).With reference to being extracted in embodiment 3 After genomic DNA, PCR identifications are carried out using HYG-RF-pl and HYG-RF-p2.PCR system (25 μ l)：10×Speed Buffer (Dalian TakaRa) 2.5 μ l, dNTPs (10mmol/l) 0.5 μ l, sense primer (10 μm of ol/l) 1.0 μ l, downstream is drawn Object (10 μm of ol/l) 1.0 μ l, SpeedSTAR^TM(amplification rate is fast, 1kb/10s, public purchased from Dalian TakaRa for HS archaeal dna polymerases Department) 0.25 μ l, genomic DNA template (100ng/ μ l) 1.0 μ l, ddH₂O adds to 50 μ l.Reaction condition：98 DEG C of 1min, 98 DEG C 10s, 65 DEG C of 60s, 35 cycles, 72 DEG C of 10min, 4 DEG C reaction was completed.The results show that all recons contain external source HYG bases Because of (result is not shown).

4. the expression analysis of hygromycin gene --- Western blot in mamillary trichosporon cutaneum transformant

In addition to directly determining that Lipomyces starkeyi FBA promoters can start hygromycin using hygromycin resistance phenotype Resistant gene is outside the expression in mamillary trichosporon cutaneum ATCC 36553, due to the ends C- of hygromycin gene expression product 6 × His Tag are carried, also determine the expression of gene by Western blot analyses using anti-His Tag antibody. Western blot operation reference implementations example 10.The expression of hygromycin gene can be observed (result is not shown).

Embodiment 13：Oil-producing trichosporon cutaneum (Trichosporon oleaginosus) is carried out using FBABLE expression cassettes The conversion of 20509 yeast of ATCC

1.FBABLE knocks out the preparation of box

Oil-producing trichosporon cutaneum ATCC 20509 (is purchased from Unite States Standard biology product collecting center (ATCC)).Utilize pFBA-p1 It is primer with FBAt-p2, using T-FBABLE as template, amplification obtains FBABLE and knocks out box.It is purified using DNA QIAquick Gel Extraction Kits After PCR product, a concentration of 500ng/ μ l of DNA fragmentation after purification are tested, totally 50 μ l, -20 DEG C save backup.

2. prepared by 20509 competent cells of oil-producing trichosporon cutaneum ATCC

The preparation of 20509 competent cells of oil-producing trichosporon cutaneum ATCC：20509 bacterial strains of oil-producing trichosporon cutaneum ATCC are chosen Colony inoculation 10ml YEPD culture mediums (glucose 20.0g/l, yeast extract 10.0g/l, peptone 20.0g/l, pH 6.0), 30 DEG C, 200rpm, 20h is cultivated；The fresh YEPD culture mediums of 1: 50 ratio of culture switching, 100ml (500ml conical flasks, Liquid amount 100ml), 30 DEG C, 200rpm, 6-9h is cultivated, OD values reach 0.6-1.2；Culture ice bath 10-30min, 4 DEG C, 4000rpm centrifuges 5 min, abandons supernatant；0 DEG C of sterile Milli-Q is washed 1 time；0 DEG C of 1mol/l sorbitol washes 2 times；Ice bath, it is standby With.50 μ l oil-producing trichosporon cutaneums ATCC, 20509 competent cells are taken, 10 μ l (5 μ g in total) of FBABLE expression cassettes, mixing is added It moves into and is cooled in 0 DEG C of electric shock cup in advance afterwards, parameter：0.8-2.5 kilovolts of voltage, 200 Ω of resistance, capacitance 25 μ F, time 4- 10ms；1ml YEPD, 30 DEG C of incubation 1-2h is added after electric shock immediately；Coating YEPD tablets (μ l of 200ng/ containing bleomycin), 30 DEG C culture 5 days or more.

3. the identification of transformant

Positive recombinant is inoculated with 10ml YEPD fluid nutrient mediums (μ l of 900ng/ containing bleomycin).With reference to being carried in embodiment 3 After taking genomic DNA, PCR identifications are carried out using BLE-RF-p1 and BLE-RF-p2.PCR system (25 μ l)：10×Speed 2.5 0.5 μ l of μ l, dNTPs (10 mmol/l) of buffer (Dalian TakaRa), sense primer (10 μm of ol/l) 1.0 μ l, downstream is drawn Object (10 μm of ol/l) 1.0 μ l, SpeedSTAR^TM(amplification rate is fast, 1kb/10s, public purchased from Dalian TakaRa for HS archaeal dna polymerases Department) 0.25 μ l, genomic DNA template (100ng/ μ l) 1.0 μ l, ddH₂O adds to 25 μ l.Reaction condition：98 DEG C of 1min, 98 DEG C 10s, 65 DEG C of 60s, 35 cycles, 72 DEG C of 10min, 4 DEG C reaction was completed.The results show that all recons contain external source BLE bases Cause.The results are shown in Figure 9.

Embodiment 14：Fatty acid hydroxylase and geneticin resistant albumen are in trichosporon cutaneum (Trichosporon Cutaneum) the expression in CGMCC 2.571

Ricinoleic acid (12-hydroxy-octadeca-cis-9-enoic acid：C18：It is 1-OH) a kind of very valuable The essential industry raw material of value.From ergot (Claviceps purpurea) oleate hydroxylase gene (Genbank： EU661785) expression in microorganism can provide a new approach for the supply of ricinoleic acid.Geneticin is utilized herein For selection markers, start the expression of CpFAH genes with FBA promoters, to realize the synthetic castor oil acid in trichosporon cutaneum Purpose.

1. the agrobacterium strains conversion trichosporon cutaneum CGMCC 2.571 containing FBAKAN-CpFAH carriers

2.571 yeast of trichosporon cutaneum CGMCC after taking a ring to activate (is purchased from China General Microbiological culture presevation Administrative center CGMCC), it is connected in 5ml YEPD, 25 DEG C, 200r/min is incubated overnight.After sterile water washing one time, it is adjusted to OD₆₀₀=1-2, it is spare.After the Agrobacterium activation containing FBAKAN-CpFAH carriers described in embodiment 9, it is connected to 5ml and contains card In the LB liquid of that mycin (100ng/ μ l) and rifampin (80ng/ μ l), 250 DEG C, 200r/min overnight incubations.Use sterile water Washing one time, is adjusted to OD₆₀₀=1-3, it is spare.

Above-mentioned yeast and each 600 μ l of agrobacterium strains dilution are taken, mixing, directly drop are in induction tablet (5 Portugals mmol/l Grape sugar, 0.5% glycerine, 1.45g/l potassium dihydrogen phosphates, 2.05g/l dipotassium hydrogen phosphates, 0.15g/l sodium chloride, seven water of 0.5g/l Magnesium sulfate, 66mg/l calcium chloride dihydrates, 2.48g/l green-vitriols, 0.5g/l ammonium sulfate, 40mmol/l MES (2- (N- Coffee quinoline) ethanesulfonic acid), 2% agar powder, 200 μm of ol/L acetosyringones) on (Bundock, P., den Dulk-Ras, A., Beijersbergen, A., et al.EMBO J., 1995,14,3206-3214.), 24-25 DEG C, cultivate 4 days.With the left sides 10ml Right sterile water is washed down lawn is mixed, and 3000 r/min centrifuge 5min, discard the liquid that upper layer mainly contains Agrobacterium, remaining Cell be resuspended with 800 μ l sterile waters, take 50-200 μ l to be coated on screening flat board (μ containing 50ng/ L Geneticins G418 and 300 μ The YEPD of g/mL cephalosporins) on, it is cultivated in 25 DEG C, until transformant occurs.

2. the PCR of 2.571 transformants of trichosporon cutaneum CGMCC is identified

Random 6 2.571 transformants of trichosporon cutaneum CGMCC of picking access the YEPD containing 50ng/ μ L Geneticins It is cultivated in liquid, method described in reference implementation example 8 extracts genomic DNA, using FBAKAN-RF-P1 and FBAKAN-RF- P2, CpFAH-RF-p1 and CpFAH-RF-p2 are primer, carry out PCR identifications.The results show that external source KAN and CpFAH segment at Work(is integrated into trichosporon cutaneum genome (result is not shown).

3. 2.571 transformants of trichosporon cutaneum CGMCC produce the fermenting experiment of ricinoleic acid

Take correct transformant after being activated 2-3 days on tablet, the almost the same single bacterium colony of picking size is connected to 5 mL In YEPD.After culture for 24 hours, it is connected in the YEPD culture mediums of 50mL with 1: 50 inoculum concentration, as secondary seed.Secondary seed is trained After supporting for 24 hours, 5mL is taken to be added in the YEPD fermentation mediums of 45mL.A pH is adjusted in fermentation process per 12h.After cultivating 120h Terminate.40mL zymocyte liquids are taken to be placed in 50mL round bottom centrifuge tubes, 8000rpm room temperatures centrifuge 5min and collect thalline, use deionized water Washing 2 times, 105 DEG C are dried for 24 hours to constant weight.It is cooling in drier after taking-up, record is then weighed, is added by 1g dry myceliums after weighing Enter the ratio of 6mL 4mol/L hydrochloric acid, often 4mL 4mol/L hydrochloric acid is added in pipe, and 78 DEG C of water-baths digest 1h, 2 times of bodies are added after cooling Long-pending chloroform/methanol (1: 1, v/v) fully vibrates mixing, is centrifuged after extracting 1h, chloroform layer is taken to be put into a new centrifuge tube In.Water phase is extracted once again with isometric chloroform, is fully centrifuged after oscillation, is taken chloroform layer to be put into above-mentioned new centrifuge tube and close And and be added isometric 0.1% sodium chloride solution, centrifuged after vibrating mixing.Lower layer's organic phase is carefully extracted simultaneously with syringe It injects in preprepared glass funnel (funnel fills in degreasing cotton in advance, and appropriate anhydrous sodium sulfate is added), waits for funnel Middle organic solution is flowed into substantially in the glass oil bottle of lower section, and suitable chloroform is added and rinses funnel 4 times, flows into lower section oil bottle together In, extraction has the chloroform of grease to carry out Grease Collection using Rotary Evaporators, and the oil bottle for having collected grease is put into baking oven drying 24h。

Grease Collection is carried out, the oil bottle for having collected grease, which is put into baking oven, dries 12h.

Esterification is carried out to bacterium oil：The grease to be measured for weighing 70.0mg, is added 5% KOH/CH₃OH solution 0.5mL, add Heat reflux 50min, is then added BF₃Methanol solution (V_{BF3 diethyl ether solutions}∶V_CH3OH=4: 10) 0.7mL, continue the 10min that flows back.It is cold But 1mL deionized waters and 0.7mL n-hexanes are added afterwards, organic phase is sucked out after mixing, gas is used for after deionized water is washed twice Analysis of hplc.

4. 2.571 transformants of trichosporon cutaneum CGMCC produce the measurement of ricinoleic acid

Transesterification sample is dissolved in n-hexane, using document (Meesapyodsuk, D., and Qiu, X. Plant Physiol., 2008,147,1325-1333.) method in is detected, and standard items are methyl ricinolcic acid (CAS： 141-24-2), negative control is the transesterification product of grease of wild type trichosporon cutaneum.The results show that being transferred to CpFAH genes Ricinoleic acid is truly had to generate in trichosporon cutaneum CGMCC 2.571, content is 190 μ g/ml, and total amount accounts for overall free fatty 60% or more of content.

5. expression analysis --- the Western of oleate hydroxylase gene in 2.571 transformants of trichosporon cutaneum CGMCC blot

Determine that Lipomyces starkeyi FBA promoters can start oleic acid in addition to directly producing phenotype by ricinoleic acid '-hydroxylase gene is outside the expression in trichosporon cutaneum CGMCC 2.571, due to the C- of oleate hydroxylase gene expression product End carries 6 × His Tag, the expression for also passing through immunoblotting assay oleate hydroxylase gene using anti-His Tag antibody. Western blot operation reference implementations example 10.The expression of oleate hydroxylase gene can be observed (result is not shown).

Embodiment 15：Trichosporon fermentans (Trichosporon fermentans) are carried out using FBABLE expression cassettes The conversion of 10675 yeast of ATCC

Expression of the 1.FBABLE genes in 10675 yeast of Trichosporon fermentans ATCC

Trichosporon fermentans ATCC 10675 is purchased from Unite States Standard biology product collecting center (ATCC).After taking a ring to activate 10675 yeast of Trichosporon fermentans ATCC, be connected in 5ml YEPD, 30 DEG C, 200r/min is incubated overnight.Use sterile water After washing one time, it is adjusted to OD₆₀₀=0.1-1.9, it is spare.After Agrobacterium activation, it is connected to 5ml and contains kanamycins (50ng/ μ l) In the LB liquid of rifampin (50ng/ μ l), 30 DEG C, 200r/min overnight incubations.With sterile water washing one time, it is adjusted to OD₆₀₀=0.1-1.9, it is spare.

Take above-mentioned yeast and each 600 μ l of Agrobacterium dilution, mixing, directly drop in induction tablet (5mmol/l glucose, 0.5% glycerine, 1.45g/l potassium dihydrogen phosphates, 2.05g/l dipotassium hydrogen phosphates, 0.15g/l sodium chloride, seven water sulfuric acid of 0.5g/l Magnesium, 66mg/l calcium chloride dihydrates, 2.48g/l green-vitriols, 0.5g/l ammonium sulfate, 40mmol/l MES (2- (N- morpholines) Ethanesulfonic acid), 2% agar powder, 200 μm of ol/L acetosyringones) on (Bundock, P., den Dulk-Ras, A., Beijersbergen, A., et al.EMBO J., 1995,14,3206-3214.), 24-25 DEG C, cultivate 4 days.With the left sides 10ml Right sterile water is washed down lawn is mixed, and 3000 r/min centrifuge 5min, discard the liquid that upper layer mainly contains Agrobacterium, remaining Cell be resuspended with 800 μ l sterile waters, take 50-200 μ l to be coated on screening flat board (the L bleomycin of μ containing 50ng/ and 300 μ g/mL The YEPD of cephalosporin) on, it is cultivated in 30 DEG C, until transformant occurs.

2. the PCR of 10675 bleomycin transformants of Trichosporon fermentans ATCC is identified

6 Trichosporon fermentans ATCC of random picking, 10675 bleomycin transformant accesses are rich next containing 50 ng/ μ L It is cultivated in the YEPD liquid of mycin, method described in reference implementation example 3 extracts 10675 genomes of Trichosporon fermentans ATCC DNA uses BLE-RF-p1 and BLE-RF-p2 for primer, carries out PCR identifications.PCR system (50 μ l)：5×Prime buffer (Dalian TakaRa) 10.0 μ l, dNTPs (2.5mmol/l) 4.0 μ l, sense primer (10 μm of ol/l) 2.0 μ l, downstream primer (10 μm ol/l) 2.0 μ l, PrimeSTAR^TM1.0 μ l of HS archaeal dna polymerases (Dalian TakaRa), 1 μ l of genomic DNA (20ng/ μ l), ddH₂O adds to 50 μ l.Reaction condition：95 DEG C of 3min, 98 DEG C of 8s, 49 DEG C of 15s, 72 DEG C of 1min, 35 cycles, 72 DEG C of 10min, 4 DEG C reaction was completed.PCR product is analyzed through 1% (mass/volume concentration) agarose gel electrophoresis.As a result display is as it can be seen that external source BLE Segment is successfully integrated into 10675 genomes of Trichosporon fermentans ATCC (result is not shown).

3. the expression of bleomycin resistance gene in 10675 bleomycin resistance transformants of Trichosporon fermentans ATCC Analysis --- Western blot

In addition to directly determining that Lipomyces starkeyi FBA promoters can start rich Lay using bleomycin resistance phenotype Mycin resistant gene is outside the expression in Trichosporon fermentans ATCC 10675, due to bleomycin resistance gene expression product The ends C- carry 6 × His Tag, also pass through the table that Western blot analysis determines gene using anti-His Tag antibody It reaches.Western blot operation reference implementations example 10.The expression of hygromycin gene can be observed (result is not shown).

Embodiment 16：Gonimoblast spore yeast (Trichosporon porosum) ATCC is carried out using FBAHYG expression cassettes The conversion of 90770 yeast

Expression of the 1.FBAHYG genes in 90770 yeast of gonimoblast spore yeast ATCC

Gonimoblast spore yeast ATCC 90770 is purchased from Unite States Standard biology product collecting center (ATCC).After taking a ring to activate 90770 yeast of gonimoblast spore yeast ATCC, is connected in 5ml YEPD, 30 DEG C, 200r/min is incubated overnight.With sterile water washing After one time, it is adjusted to OD₆₀₀=0.1-0.8, it is spare.After Agrobacterium activation, it is connected to 5ml and contains kanamycins (50ng/ μ l) and profit Good fortune is put down in the LB liquid of (50ng/ μ l), 30 DEG C, 200r/min overnight incubations.With sterile water washing one time, it is adjusted to OD₆₀₀= 0.1-1.6, it is spare.

Take above-mentioned yeast and each 400 μ l of Agrobacterium dilution, mixing, directly drop in induction tablet (5mmol/l glucose, 0.5% glycerine, 1.45g/l potassium dihydrogen phosphates, 2.05g/l dipotassium hydrogen phosphates, 0.15g/l sodium chloride, seven water sulfuric acid of 0.5g/l Magnesium, 66mg/l calcium chloride dihydrates, 2.48g/l green-vitriols, 0.5g/l ammonium sulfate, 40mmol/lMES (2- (N- morpholines) Ethanesulfonic acid), 2% agar powder, 200 μm of ol/L acetosyringones) on (Bundock, P., den Dulk-Ras, A., Beijersbergen, A., et al.EMBO J., 1995,14,3206-3214.), 24-25 DEG C, cultivate 4 days.With 10ml or so Sterile water by mix lawn wash down, 3000 r/min centrifuge 5min, discard the liquid that upper layer mainly contains Agrobacterium, it is remaining Cell is resuspended with 800 μ l sterile waters, and 50-200 μ l is taken to be coated on screening flat board (the L hygromycin of μ containing 50ng/ and 300 μ g/mL cephalos The YEPD of rhzomorph) on cultivated in 30 DEG C, until transformant occur.

2. the PCR of 90770 hygromycin resistant transformed sons of gonimoblast spore yeast ATCC is identified

6 90770 hygromycin transformants of the gonimoblast spore yeast ATCC accesses of random picking contain 50ng/ μ L hygromycin It is cultivated in YEPD liquid, method described in reference implementation example 3 extracts 90770 genomic DNAs of gonimoblast spore yeast ATCC, uses HYG-RF-p and HYG-RF-p2 is primer, carries out PCR identifications.PCR system (50 μ l)：(the Dalian 5 × Prime buffer TakaRa) 10.0 μ l, dNTPs (2.5mmol/l) 4.0 μ l, sense primer (10 μm of ol/l) 2.0 μ l, downstream primer (10 μm of ol/ L) 2.0 μ l, PrimeSTAR^TM1.0 μ l of HS archaeal dna polymerases (Dalian TakaRa), genomic DNA (20ng/ μ l) 1 μ l, ddH₂O Add to 50 μ l.Reaction condition：95 DEG C of 3min, 98 DEG C of 8s, 49 DEG C of 15s, 72 DEG C of 1min, 35 cycles, 72 DEG C of 10min, 4 DEG C of knots Shu Fanying.PCR product is analyzed through 1% (mass/volume concentration) agarose gel electrophoresis.As a result display is as it can be seen that external source HYG pieces Duan Chenggong is integrated into 90770 genomes of gonimoblast spore yeast ATCC.

3. the expression analysis of hygromycin in 90770 hygromycin resistant transformed sons of gonimoblast spore yeast ATCC --- Western blot

In addition to directly determining that Lipomyces starkeyi FBA promoters can start hygromycin using hygromycin resistance phenotype Resistant gene is outside the expression in mamillary trichosporon cutaneum ATCC 36553, due to the ends C- of hygromycin gene expression product 6 × His Tag are carried, also determine the expression of gene by Western blot analyses using anti-His Tag antibody. Western blot operation reference implementations example 10.The expression of hygromycin gene can be observed (result is not shown).

Embodiment 17：Bai Shi trichosporon bacterias (Trichosporon beigelii) ATCC is carried out using FBAHYG expression cassettes The conversion of MYA-911

Bai Shi trichosporon bacteria ATCC MYA-911 (being purchased from Unite States Standard biology product collecting center (ATCC)) are by inclined plane inoculating Into 50ml YEPD fluid nutrient mediums, for 24 hours, then with 1: 50 volume ratio bacterium solution is transferred to respectively in 30 DEG C of shaking table cultures In 100ml YEPD fluid nutrient mediums, exponential phase is reached in 30 DEG C of shaking table culture 12h.3000g centrifuges 5min and collects thalline, weight Outstanding cell is in the sterile water of 25mL.20 DEG C, 3000g centrifuges 5min and collects cell.Again with sterile water washing one time, centrifugation is received Collect cell.Cell is resuspended with the sterile water of 1mL.Cell is transferred in 1.5mL centrifuge tubes, 13000g30s rapid centrifugations are collected Cell abandons supernatant.Above-mentioned cell is resuspended with 1mL sterile waters, takes 250 μ L cells (＞ 10⁸A cell) 1.5mL centrifuge tubes are added In.50% (w/v) PEG3350 is sequentially added in this clean 1.5mL centrifuge tube in advance, 36 μ L1mol/L LiAc boiled 50 μ L2g/L salmon sperm dnas, 1 μ g FBAHYG knock out box, mixing.By mixing sample blending of the cell in centrifuge tube, set In 42 DEG C of thermal shock 40min.Rapid centrifugation collects cell, is all coated on screening flat board.30 DEG C are cultivated 3-4 days.

Positive recombinant is inoculated with 10ml YEPD fluid nutrient mediums (μ l of 250ng/ containing hygromycin).With reference to being extracted in embodiment 3 After genomic DNA, PCR identifications are carried out using HYG-RF-p1 and HYG-RF-p2.PCR system (25 μ l)：10×Speed Buffer (Dalian TakaRa) 2.5 μ l, dNTPs (10mmol/l) 0.5 μ l, sense primer (10 μm of ol/l) 1.0 μ l, downstream is drawn Object (10 μm of ol/l) 1.0 μ l, SpeedSTAR^TM(amplification rate is fast, 1kb/10s, public purchased from Dalian TakaRa for HS archaeal dna polymerases Department) 0.25 μ l, genomic DNA template (100ng/ μ l) 1.0 μ l, ddH₂O adds to 50 μ l.Reaction condition：98 DEG C of 1min, 98 DEG C 10s, 65 DEG C of 60s, 35 cycles, 72 DEG C of 10min, 4 DEG C reaction was completed.The results show that all recons contain external source HYG bases Cause.

In addition to directly determining that Lipomyces starkeyi FBA promoters can start hygromycin using hygromycin resistance phenotype Resistant gene is outside the expression in Bai Shi trichosporon bacteria ATCC MYA-911, due to the ends C- of hygromycin gene expression product 6 × His Tag are carried, also determine the expression of gene by Western blot analyses using anti-His Tag antibody. Western blot operation reference implementations example 10.The expression of hygromycin gene can be observed (result is not shown).

Claims (15)

1. ester of Harden Young aldolase promoter, nucleotide sequence such as SEQ ID NO：Shown in 1.

2. a kind of DNA expression cassettes contain SEQ ID NO：The nucleosides of ester of Harden Young aldolase promoter shown in 1 Acid sequence.

3. the expression cassette described in claim 2 also contains SEQ ID NO：Nucleotide sequence shown in 2 as terminator, Middle SEQ ID NO：Sequence shown in 1 is located at SEQ ID NO：The upstream of sequence shown in 2, SEQ ID NO：1 and SEQ ID NO：It is the open reading frame of coding target gene between 2.

4. the DNA expression cassettes described in claim 3, it is characterised in that：The open reading frame of the coding target gene CDNA sequence such as SEQ ID NO：Shown in 4.

5. a kind of recombinant vector including the DNA expression cassettes described in any one of claim 2-4.

6. the recombinant vector described in claim 5, it is characterised in that：The carrier is sequestered or integrating vector.

7. the recombinant vector described in claim 6, wherein the episomal vector is selected from E. coli cloning vector or yeast is worn Shuttle carrier.

8. the recombinant vector described in claim 7, wherein the episomal vector be selected from pMD18-T, pUC18, pYES2c/t or pYX212。

9. the recombinant vector described in claim 6, wherein the integrating vector is agriculture bacillus mediated binary expression vector, or Person is the homologous recombination vector for carrying target gene flank 1500-4000 base homologous recombination arms.

10. the recombinant vector described in claim 9, wherein the agriculture bacillus mediated binary expression vector be selected from pZPK or PPZP200, wherein the pZPK by with kalamycin resistance gene segment replace pPZP200 carriers on streptomysin/it is grand Mycin resistant gene segment is built-up.

11. the recombinant vector described in claim 9, wherein the skeleton of the homologous recombination vector is selected from E. coli cloning vector Or yeast shuttle vector.

12. the recombinant vector described in claim 11, wherein the skeleton of the homologous recombination vector be selected from pMD18-T, pUC18, PYES2c/t or pYX212.

13. including the host cell of the recombinant vector described in any one of claim 5-12.

14. the host cell described in claim 13, the host cell is Bacillus coli cells or yeast cells.

15. a kind of expression system for oleaginous yeast genetic expression, the expression system include：

(1) what can be expressed in saccharomyces oleaginosus category (Lipomyces) or Trichosporon (Trichosporon) bacterial strain changes Good carrier, the improved carrier is by being capable of integrant expression or free expression in saccharomyces oleaginosus category or Trichosporon SEQ ID NO are inserted into plasmid：Promoter sequence shown in 1 and SEQ ID NO：Terminator sequence structure shown in 2 obtains, Middle SEQ ID NO：Promoter sequence shown in 1 is located at SEQ ID NO：The upstream of terminator sequence shown in 2, SEQ ID NO： Sequence shown in 1 and SEQ ID NO：It is multiple cloning sites between sequence shown in 2, and the carrier also includes selectivity mark Remember gene；

(2) target gene open reading frame sequence can operably be inserted into the improved carrier described in (1), and make The target gene in the improved carrier described in (1) promoter and terminator connect with meeting reading frame, and

(3) saccharomyces oleaginosus category or Trichosporon bacterial strain.