CN105779445A - Fructose-1,6-bisphosphate aldolase promoter and terminator and applications thereof - Google Patents

Abstract

Through amplifying lipomyces starkeyi fructose-1,6-bisphosphate aldolase genome DNA upstream and downstream sequences and carrying out biology information analysis and functional verification, a promoter and terminator that can be widely applied to gene expression, genetic engineering operation, and strain improvement of Lipomyces and Trichosporon can be obtained. The nucleotide sequence of the promoter and terminator are represented by the SEQ ID No.1 and SEQ ID No.2. The invention also relates to a DNA expression cassette or recombinant carrier comprising the elements, a method using related elements to construct gene engineering strains of Lipomyces or Trichosporon, and corresponding strains.

Description

Fructose-1,6-diphosphonic acid aldolase promoter and terminator and application thereof

Technical field

The invention belongs to gene engineering technology field, be specifically related to promoter terminator of Lipomyces starkeyi (Lipomycesstarkeyi) and application thereof, including method for transformation necessary to construction method of gene engineering strain etc..

Background technology

Microorganism is to be distributed one of species the most widely in nature, has the biosynthesis ability of brilliance, almost can synthesize all of organic chemicals on the earth.Compared with multicellular organism, although the metabolic pathway of microorganism is relatively easy, but the production of its compound is efficiently, fast, has reaction condition gentleness, controllability is strong, be prone to the features such as large-scale production, can as an excellent cell factory.

In nature, a part of microorganism can store, (as nitrogenous source lacks), the oils and fats exceeding its dry cell weight 20% under given conditions in born of the same parents, wherein based on triglyceride, the microorganism with this phenotype is called oleaginous microorganism, including antibacterial, yeast, mycete, algae etc., wherein oleaginous yeast includes Lipomyces, Trichosporon, Rhodotorula, some bacterial strain (Ratledge, C.andWynn in Candida, Cryptococcu and Yarrowia genus, J.P.AdvApplMicrobiol, 2002,51,1-51.).Microbial transformation biomass resource is utilized to produce oils and fats, the new technique of be substantially independent of ploughing, can produce continuously, reduce agricultural pollution, comprehensive utilization of resources can be developed into, be formed chemicals the new production ways of fossil resources succedaneum (Zhao Zongbao. Chinese biological engineering magazine, 2005,25,8-11.).But the metabolic pathway that these bacterial strains that place one's entire reliance upon are intrinsic, produce intensity and performance does not often reach industrial requirement.Utilize technique for gene engineering to optimize further or change their metabolism network and expression regulation network, accelerating the accumulating rate of biobased products or the kind of oriented control target product, be one of important channel building excellent industrial applications bacterial strain.Although the genetic engineering modified comparatively ripe (Alper for some conventional yeasts, H., andStephanopoulos, G.NatRevMicrobiol, 2009,7,715-723.), but the genetic manipulation for these unconventional saccharomyces oleaginosuses is still in starting state, and many yeast do not have suitable genetic manipulation platform.Developing suitable genetic manipulation method, the application value for these unconventional microorganisms is great.

Lipomyces starkeyi (Lipomycesstarkeyi) in saccharomyces oleaginosus genus (Lipomyces) is the oleaginous yeast that a strain is excellent, it can accumulate the oils and fats (Zhao exceeding dry cell weight more than 60%, X., Kong, X.L., Hua, Y.Y., etal.EurJLipidSciTech, 2008,110,405-412.).It not only have substrate utilization scope wide (Angerbauer, C., Siebenhofer, M., Mittelbach, M., etal.BioresourTechnol, 2008,99,3051-3056；Liu, J.X., Yue, Q.Y., Gao, B.Y., etal.BioresourTechnol, 2012,106,69-73.), the features such as Modulatory character is strong (Wu Shuan., Hua Yanyan., Zhong Chongbin etc. microbiology is circulated a notice of, and 2008,35,200-203.), additionally it is possible to degrade and utilize the noxious substances such as herbicide (Nishimura, K., Yamamoto, M., Nakagomi, T., etal.ApplMicrobiolBiot, 2002,58,848-852.), it is the strain bacterial strain with good prospects for commercial application.But up to now, having no the promoter sequence report being suitable for Lipomyces starkeyi, also have no the genetic operating system suitable in Lipomyces starkeyi, these all constrain the strain improvement of targeting.

Trichosporon cutaneum (Trichosporoncutaneum) in Trichosporon (Trichosporon) is typically near some industrial wastewaters, waste liquid containing aldehydes matter and oil plant to be found, there is very strong phenolic compound capacity of decomposition and heavy metal adsorption (Anderson, J.J., andDagley, S.JBacteriol, 1980,141,534-543；Yotova, L., Tzibranska, I., Tileva, F., etal.J.Ind.Microbiol.Biotechnol., 2009,36,367-372.)；Substrate utilization scope wide (Yuan Jinyun, Ai Zuozuo, Zhang Zhibin, etal. biological engineering journal, 2011,27,453-460.), the oils and fats (Hu, the C. that utilize pentose and hexose accumulation to exceed own wt more than 40% can be synchronized simultaneously, Wu, S., Wang, Q., etal.BiotechnolBiofuels, 2011,4,25.).And some industrial enzymes separated from which, such as nitric oxidereductase (Zhang, L., Takaya, N., Kitazume, T., etal.EurJBiochem, 2001,268,3198-3204.), xylanase (Liu, W., Zhu, W.M., Lu, Y.L., etal.ProcessBiochem, 1998,33,331-336.) etc. imply the commercial Application potentiality that this kind of bacterial strain is good.But up to now, having no the promoter sequence report being suitable for trichosporon cutaneum, also have no the endogenesis promoter suitable in Lipomyces starkeyi, these all constrain the strain improvement of targeting.

Although once someone separates the fructose-1 of round rhodosporidium toruloides (Rhodosporidiumtoruloides), 6-bisphosphate aldolase promoter is for genetic engineering operation (ZL2010101897232) of self, but have no this promoter for trichosporon cutaneum, and the report of the genetic engineering operation such as outer other special type such as Ascomycota Lipomyces starkeyi of Basidiomycota.But, promoter is for essential genetic operating system.Therefore, separate the ester of Harden Young aldolase promoter that can start reporter gene expression in Lipomyces starkeyi and trichosporon cutaneum and become the focus of research at present.

Summary of the invention

In view of above-mentioned prior art bottleneck, the main purpose of the present invention is to provide the promoter and terminator that can be universally used in exogenous gene expression in Lipomyces starkeyi or trichosporon cutaneum, and adopts the method that this two yeast-like fungis kind improves by suitable transformation technology.

For realizing the purpose of the present invention, the present inventor is by being analyzed the genome sequence of Lipomyces starkeyi, obtain the key enzyme fructose-1 of glycolysis metabolism approach, the DNA sequence of 6-bisphosphate aldolase, and from Lipomyces starkeyi chromosomal DNA, it has been successfully separated, by round pcr, the DNA fragmentation comprising effective promoter further, adopt the suitable method for transformation will containing fructose-1, the exogenous dna fragment of 6-bisphosphate aldolase promoter pLsFBA is directed respectively in Lipomyces starkeyi or trichosporon cutaneum, it is successfully realized the expression of exogenous gene, complete the present invention.

The present invention has been successfully separated the Lipomyces starkeyi ester of Harden Young aldolase promoter that can start reporter gene expression in Lipomyces starkeyi and trichosporon cutaneum, and constructs its expression vector.

Specifically, the present invention comprises following embodiment (A) to (H):

(A) the present invention relates to a kind of DNA fragmentation with Lipomyces starkeyi or trichosporon cutaneum transcripting promoter activity, described DNA fragmentation:

(1) there is the full sequence of DNA sequence as shown in SEQIDNO:1 or comprise this DNA sequence partial sequence within 1500bp from 3 '-end,

(2) have and can play sequence that is that the partial sequence within 1500bp is hybridized and that keep transcripting promoter activity with the whole of such as sequence shown in SEQIDNO:1 or its DNA sequence 3 '-end, or

(3) deoxynucleotide sequence shown in SEQIDNO:1 is carried out the replacement of one or more base, disappearance, insertion or what interpolation obtained, with sequence shown in SEQIDNO:1, there is more than 50% homology and there is the sequence of promoter activity.

(B) the present invention relates to a kind of DNA fragmentation from Lipomyces starkeyi, described DNA fragmentation can as terminator, and: (1) has the whole of the DNA sequence as shown in SEQIDNO:2 or comprises the partial sequence of this DNA sequence 5 '-end；Or (2) have can with such as sequence hybridization shown in (1) and keep as described in (1) sequence of sequence active.

(C) the present invention relates to a kind of target gene that completes at the initial DNA molecular with tanscription termination of Lipomyces starkeyi or trichosporon cutaneum transcription, it have described in above-mentioned (A) have Lipomyces starkeyi or trichosporon cutaneum transcripting promoter activity DNA sequence, have simultaneously described in above-mentioned (A) have Lipomyces starkeyi or trichosporon cutaneum transcripting promoter activity DNA sequence, (B) DNA fragmentation described in, and the DNA fragmentation described in (B) is positioned at the downstream of the DNA sequence described in (A), it is adjacent the DNA fragmentation of 1-10000 nucleotide.

(D) the present invention relates to the DNA expression cassette that target gene can be connected by one with any one DNA molecular described in (A)-(C), in order to the recombinant DNA that described target gene can be expressed in Lipomyces starkeyi or trichosporon cutaneum.Described target gene is protein-encoding nucleotide or antisensenucleic acids code nucleic acid.Preferably, the cDNA sequence of described genes of interest has the nucleotide sequence (Ls ester of Harden Young aldolase cDNA) as shown in SEQIDNO:4.

(E) the present invention relates to one carry described in (A)-(D) DNA molecular in the recombinant vector of any one.Described carrier can be episomal vector or integrating vector, described episomal vector such as, but not limited to, pMD18-T, pUC18, pYES2c/t or pYX212 etc., described integrating vector is agriculture bacillus mediated binary expression vector, for instance, but it is not limited to, PZPK or pZP2000 etc..

(F) the present invention relates to the method for transformation proceeding to saccharomyces oleaginosus genus or Trichosporon bacterial strain by the DNA molecular as described in (D) or the carrier as described in (E).

(G) the present invention relates to the engineering strain of saccharomyces oleaginosus genus or the Trichosporon having proceeded to the DNA expression cassette as described in (D) or the recombinant vector as described in (E).

null(H) fructose-1 involved in the present invention，6-bisphosphate aldolase (pLs fructose-1，6-bisphosphate aldolase) promoter，It is characterized in that: its source is Lipomyces starkeyi，Genes of interest transcript and expression in saccharomyces oleaginosus genus or Trichosporon bacterial strain can be started，Described promoter: (1) has the full sequence of DNA sequence as shown in SEQIDNO:1 or comprises this DNA sequence partial sequence within 1500bp from 3 '-end，(2) have and can play what the partial sequence within 1500bp was hybridized with the whole of such as sequence shown in SEQIDNO:1 or its DNA sequence 3 '-end、And keep the sequence of transcripting promoter activity，Or the deoxynucleotide sequence shown in SEQIDNO:1 is carried out the replacement of one or more base by (3)、Disappearance、Insert or add and obtain，With sequence shown in SEQIDNO:1, there is more than 50% homology、And there is the sequence of promoter activity；

nullLs fructose-1 of the present invention，6-bisphosphate aldolase t terminator，It is characterized in that: its source is Lipomyces starkeyi，Genes of interest transcript and expression in saccharomyces oleaginosus genus or Trichosporon bacterial strain can be terminated，Described terminator: (1) has the whole of the DNA sequence as shown in SEQIDNO:2 or comprises the partial sequence of this DNA sequence 5 '-end，(2) have and can hybridize with the partial sequence of the whole of such as sequence shown in SEQIDNO:2 or its DNA sequence 5 '-end、And keep the sequence of transcription terminator activity，Or the deoxynucleotide sequence shown in SEQIDNO:2 is carried out the replacement of one or more base by (3)、Disappearance、Insert or add and obtain，With sequence shown in SEQIDNO:2, there is more than 50% homology、And there is the sequence of terminator activity.

Use the DNA molecular with promoter activity of the present invention and there is the DNA of transcription terminator activity, it may be achieved exogenous gene or endogenous gene expression in saccharomyces oleaginosus genus or Trichosporon bacterial strain.

Present invention provide for saccharomyces oleaginosus belongs to or Trichosporon bacterial strain is genetically engineered promoter, terminator and carrier.Belong to for saccharomyces oleaginosus or Trichosporon bacterial strain opens a breeding new way, and therefore the saccharomyces neoformans bacterial strain with industrial use can be provided.

In sum, the present invention provides following technical proposals:

1. ester of Harden Young aldolase promoter, its nucleotide sequence is such as shown in SEQIDNO:1.

2. the 1st described fructose-1,6-bisphosphate aldolase promoter can belong to the application of the recombinant expression carrier expressed in the yeast strain of (Lipomyces) or Trichosporon (Trichosporon) for structure at saccharomyces oleaginosus, saccharomyces oleaginosus genus or the Trichosporon yeast strain of wherein having cloned the recombinant expression carrier comprising described ester of Harden Young aldolase promoter constitute saccharomyces oleaginosus and belong to or Trichosporon genetic operating system.

3. a DNA expression cassette, it contains the nucleotide sequence of the ester of Harden Young aldolase promoter shown in SEQIDNO:1.

4. the 3rd described expression cassette, its possibly together with the nucleotide sequence shown in SEQIDNO:2 as terminator, wherein the sequence shown in SEQIDNO:1 is positioned at the upstream of the sequence shown in SEQIDNO:2, for the open reading frame of coding genes of interest between SEQIDNO:1 and SEQIDNO:2.

5. the 4th described DNA expression cassette, it is characterised in that: the cDNA sequence of the open reading frame of described coding genes of interest has the nucleotide sequence as shown in SEQIDNO:4.

6. the recombinant vector of the DNA expression cassette comprised according to any one of 3-5 item.

7. the 6th described recombinant vector, it is characterised in that: described carrier is sequestered or integrating vector.

8. the 7th described recombinant vector, wherein said integrating vector is agriculture bacillus mediated binary expression vector, such as PZPK or pZP2000, or for carrying the homologous recombination vector of target gene flank 1500-4000 base homologous recombination arm, described homologous recombination vector skeleton or described episomal vector selected from E. coli cloning vector or yeast shuttle vectors such as pMD18-T, pUC18, pYES2c/t or pYX212.

9. comprise the host cell of recombinant vector according to any one of 6-8 item.

10. the 9th described host cell, described host cell is Bacillus coli cells or yeast cells.

11. for an expression system for oleaginous yeast genetic expression, described expression system comprises:

(1) improved carrier that can belong at saccharomyces oleaginosus or express in Trichosporon bacterial strain, described improved carrier is passed through to belong at saccharomyces oleaginosus or insert the promoter sequence shown in SEQIDNO:1 and the acquisition of the terminator sequence construct shown in SEQIDNO:2 in integrant expression or the free plasmid expressed in Trichosporon, wherein the promoter sequence shown in SEQIDNO:1 is positioned at the upstream of the terminator sequence shown in SEQIDNO:2, sequence shown in SEQIDNO:1 and be multiple clone site between the sequence shown in SEQIDNO:2, and described carrier also comprises selected marker；

(2) genes of interest open reading frame sequence, it can be inserted in the improved carrier described in (1) operably, and make described genes of interest be connected with meeting reading frame with the promoter in the improved carrier described in (1) and terminator, and

(3) saccharomyces oleaginosus belongs to or Trichosporon bacterial strain.

12. the expression system for oleaginous yeast genetic expression of the 11st, wherein the improved carrier described in (1) is obtained by the promoter sequence shown in insertion SEQIDNO:1 and the terminator sequence construct shown in SEQIDNO:2 in the plasmid can expressed in saccharomyces oleaginosus genus or Trichosporon.

13. the expression system for oleaginous yeast genetic expression of the 12nd, wherein said plasmid is sequestered or integrative plasmid, and, wherein said integrative plasmid is agriculture bacillus mediated double base expression plasmid, such as PZPK or pZP2000, further, described episomal plasmids is selected from pMD18-T, pUC18, pYES2c/t or pYX212.

null14. the expression system for oleaginous yeast genetic expression of the 11st，Wherein the saccharomyces oleaginosus described in (3) belongs to bacterial strain selected from oil-producing saccharomyces oleaginosus (Lipomyceslipofer)、Lipomyces starkeyi (Lipomycesstarkeyi)、Fructus Citri tangerinae woods saccharomyces oleaginosus (Lipomyceskononenkoae)，Described Trichosporon bacterial strain is selected from oil-producing trichosporon (Trichosporonoleaginosus)、Trichosporon cutaneum (Trichosporoncutaneum)、Trichosporon fermentans (Trichosporonfermentans)、Gonimoblast spore yeast (Trichosporonporosum)、Bai Shi trichosporon bacteria (Trichosporonbeigelii) or mamillary trichosporon (Trichosporoncapitatum).

15. the expression system for oleaginous yeast genetic expression of the 11st, wherein the genes of interest open reading frame sequence described in (2) has the nucleotide sequence as shown in SEQIDNO:4.

Those skilled in the art should understand that, term " expression system " refers to the composition system of recombinant vector, the coding nucleotide sequence of target protein to be expressed, applicable host cell or host strain etc., is used for expressing described target protein in described host cell or host strain.

The invention has the beneficial effects as follows:

Belong to for saccharomyces oleaginosus and the yeast of Trichosporon provides promoter, terminator genetic transforming method, the saccharomyces oleaginosus promoted effectively from now on is belonged to and the saccharomycetic strain improvement of Trichosporon and metabolic engineering research.

Accompanying drawing explanation

Fig. 1 represents the result of the agarose gel electrophoresis of LsFBA degenerate pcr product (swimming lane 1), and swimming lane M is molecular weight standard.

Fig. 2 represents the result of the agarose gel electrophoresis of pLsFBA promoter dna fragment (swimming lane 1), and swimming lane M is molecular weight standard.

Fig. 3 represents the result of the agarose gel electrophoresis of LsFBAt terminator DNA fragmentation (swimming lane 1), and swimming lane M is molecular weight standard.

Fig. 4 represents the structural representation of plasmid FBAHYG, LB, T-DNA left margin；RB, T-DNA right margin.

Fig. 5 represent use HYG gene transformation oil-producing saccharomyces oleaginosus (Lipomyceslipofer) CBS944 after PCR qualification result, swimming lane M is molecular weight standard, and swimming lane 1-6 represents different Hyg resistant transformants respectively, and WT represents wild type, + for positive control ,-represent negative control.

Fig. 6 represents that the detection of expression Westernblot of HYG gene analyzes, and swimming lane 1-3 is agrobacterium mediation converted oil-producing saccharomyces oleaginosus CBS944 hygromycin transformant 1-3 total protein；Swimming lane 4 is the starting strain oil-producing saccharomyces oleaginosus CBS944 total protein sample as negative control.

Fig. 7 represents the structural representation of plasmid URA3-FBABLE.

Fig. 8 represents the conversion flat board using BLE selection markers to knock out Lipomyces starkeyi (Lipomycesstarkeyi) NRRLY-11557URA3 gene.

Fig. 9 represents the transcriptional level expression analysis RT-PCR result of BLE resistance Ura3 auxotrophy Lipomyces starkeyi recombinant bacterial strain, swimming lane 1-2 is BLE resistance Ura3 auxotrophy Lipomyces starkeyi NRRLY-11557 recombinant bacterial strain 1-2, and swimming lane 3 is control strain Lipomyces starkeyi NRRLY-11557.

Figure 10 represents the structural representation of FBAKAN-CpFAH.

Figure 11 represents that restructuring saccharomyces oleaginosus belongs to oleate hydroxylase Westernblot in CBS7729 and analyzes, and swimming lane 1-3 belongs to CBS7729 bacterial strain 1-3 total protein for restructuring saccharomyces oleaginosus；Swimming lane 4 is that the starting strain saccharomyces oleaginosus as negative control belongs to CBS7729 total protein sample.

Figure 12 represents that use BLE selection markers converts PCR qualification result after oil-producing trichosporon (Trichosporonoleaginosus) ATCC20509, swimming lane M is molecular weight standard, swimming lane 1-6 represents different Hyg resistant transformants respectively, and WT represents wild type ,+for positive control.

Figure 13 shows the genomic dna sequence (base number 1456) of ester of Harden Young aldolase and the encoding amino acid sequence of corresponding exon.

Sequence table explanation

SEQIDNO:1LsFBA promoter, derives from Lipomyces starkeyi (Lipomycesstarkeyi)

SEQIDNO:2LsFBA terminator, derives from Lipomyces starkeyi

SEQIDNO:3LsFBA reading frame

SEQIDNO:4LsFBAcDNA

SEQIDNO:5LsFBA aminoacid sequence

SEQIDNO:6HYG

SEQIDNO:7pLsFBA-HYG-LsFBAt

SEQIDNO:8pURA3-URA3-URA3t

SEQIDNO:9BLE

SEQIDNO:10pURA3-FBABLE-URA3t

SEQIDNO:11Kanmx

SEQIDNO:12CpFAH

SEQIDNO:13FBAKAN-CpFAH

SEQIDNO:14LB sequence

SEQIDNO:15RB sequence

SEQIDNO:16pLsFBA-orf-LsFBAt

Detailed description of the invention

In this article, " promoter " refers to by RNA polymerase identification, combination can the DNA sequence transcribed of promotor gene.Term " promoter " may also be understood to be: includes 5 ' noncoding regions, cis acting element (such as enhancer) and other nucleotide sequence being combined with transcription factor.

Existence or the intensity of promoter represent typically by promoter activity, its assay method: the downstream of promoter as described in reporter gene (such as resistant gene) is connected to, and this DNA construct is converted corresponding host cell, whether examining report gene expresses.If it is observed that be connected to the expression of described promoter downstream reporter gene, it is possible to think that described promoter has activity in the host cell that it converts.

In this article, " terminator " refers to the section of DNA sequence providing termination signal to make RNA polymerase separate on chromosome and to make tanscription termination with DNA profiling.Can build body by " promoter-reporter gene-terminator " makes reporter gene effective expression determine the activity of terminator.

" Lipomyces starkeyi " in the present invention, including any diploid and monoploid, wild-type strain and the auxotrophic strain that belong to these " species ".null" saccharomyces oleaginosus belongs to or Trichosporon " in the present invention，It is not specifically limited，The example includes the fungus belonging to this genus，Except Lipomyces starkeyi or trichosporon cutaneum，Also just like oil-producing saccharomyces oleaginosus (Lipomyceslipofer)，Fructus Citri tangerinae woods saccharomyces oleaginosus (Lipomyceskononenkoae)，Saccharomyces oleaginosus belongs to (Lipomycessp.) other species，Or Trichosporon fermentans (Trichosporonfermentans)，Gonimoblast spore yeast (Trichosporonporosum)，Oil-producing trichosporon (Trichosporonoleaginosus)，Bai Shi trichosporon bacteria (Trichosporonbeigelii)，Mamillary trichosporon (Trichosporoncapitatum).

" genes of interest " of the present invention, including albumen coded sequence, antisense RNA coding sequences and the nuclease coded sequence that can belong at saccharomyces oleaginosus or express in Trichosporon bacterial strain.Can include coming from the albumen in this two classes Pseudomonas or nucleotide sequence at the example of the albumen coded sequence that saccharomyces oleaginosus belongs to or expresses in Trichosporon bacterial strain, and be not limited thereto, also include deriving from other microorganism, the albumen of plant and animal or nucleotide sequence.Art technology arbitrarily should be appreciated that, when use derive from other microorganism, plant and animal albumen coded sequence as genes of interest (namely, external source genes of interest) time, for optimizing the expression in saccharomyces oleaginosus genus or Trichosporon bacterial strain, it usually needs belong to for saccharomyces oleaginosus or described genes of interest is carried out codon optimized by the codon preference of Trichosporon bacterial strain.And codon optimized belong to ordinary skill in the art means.

Promoter in the present invention: (1) has the full sequence of DNA sequence as shown in SEQIDNO:1 or comprises this DNA sequence partial sequence within 1500bp from 3 '-end, (2) have and can play what the partial sequence within 1500bp was hybridized with the whole of such as sequence shown in SEQIDNO:1 or its DNA sequence 3 '-end, and keep the sequence of transcripting promoter activity, or the deoxynucleotide sequence shown in SEQIDNO:1 is carried out the replacement of one or more base by (3), disappearance, insert or add and obtain, with sequence shown in SEQIDNO:1, there is more than 50% homology, and there is the sequence of promoter activity.

Terminator in the present invention: (1) has the whole of the DNA sequence as shown in SEQIDNO:2 or comprises the partial sequence of this DNA sequence 5 '-end, (2) have and can hybridize with the partial sequence of the whole of such as sequence shown in SEQIDNO:2 or its DNA sequence 5 '-end, and keep the sequence of transcription terminator activity, or the deoxynucleotide sequence shown in SEQIDNO:2 is carried out the replacement of one or more base by (3), disappearance, insert or add and obtain, with sequence shown in SEQIDNO:2, there is more than 50% homology, and there is the sequence of terminator activity.

The structure body building body or promoter-genes of interest-terminator building body, genes of interest-terminator of the promoter-genes of interest in the present invention, can directly or through carrier mediated conversion fat Saccharomyces or Trichosporon bacterial strain, so that destination gene expression, it may be preferred to plasmid vector is as mediation carrier.

The promoter of the present invention can separate from Lipomyces starkeyi according to following aspect.

Below in conjunction with drawings and Examples, the invention will be further described, it will help those of ordinary skill in the art understands the present invention, but does not limit the present invention in any form.In following embodiment, the synthesis of all primers and examining order, then complete by Dalian TakaRa company if no special instructions.

Embodiment 1: the extraction of Lipomyces starkeyi (Lipomycesstarkeyi) NRRLY-11557 total serum IgE

nullBy Lipomyces starkeyi (L.starkeyi) NRRLY-11557 (purchased from American agricultural research DSMZ (NRRL)，BacterialFoodbornePathogens&MycologyResearch，1815N.UniversityStreetIL61604.Peoria，Illinois) by inclined plane inoculating to 50mlYEPD fluid medium (glucose 20.0g/l，Yeast extract 10.0g/l，Peptone 20.0g/l，PH6.0) in，24h is cultivated in 30 DEG C of shaking tables，With the volume ratio of 1: 50, bacterium solution is transferred in 100mlYEPD fluid medium respectively again，Cultivate 12h in 30 DEG C of shaking tables and reach exponential phase.At 4 DEG C, 5000rpm is centrifuged 4min, collects thalline, with liquid nitrogen quick freeze thalline, grinds breaking cellular wall.Use TakaRa company RNAiso test kit, and extract total serum IgE according to its standard step.

RNA carries out 1.5% agarose gel electrophoresis, uses fluorescence-uv analyzer to observe and identifies, it is seen that two band clearly.With ultraviolet/visible light spectrometer analysis total serum IgE sample, record OD₂₆₀/OD₂₈₀=2.01, it was shown that total serum IgE quality is fine.Total serum IgE sample is frozen in-80 DEG C, standby.

Embodiment 2: the synthesis of Lipomyces starkeyi NRRLY-11557cDNA the first chain and FBA degenerate pcr

With Lipomyces starkeyi NRRLY-11557 total serum IgE for template, reverse transcription synthesis cDNA the first chain.First, by 1.0 μ l total serum IgE (about 2 μ g), 1.0 μ l primer SMARTIV:5 '-AAGCAGTGGTATCAACGCAGAGTGGCCATTACGGCCGGG-3 ' and 1.0 μ loligodT-adapter-primer CDSIII/3 ': 5 '-ATTCTAGAGGCCGAGGCGGCCGACATG-d (T)_30N-1N-3 ', 2.0 μ lDEPC process water, and (pyrocarbonic acid diethyl ester processes water, purchased from Dalian TakaRa company), join in PCR pipe and mix, be incubated 2min in 72 DEG C, it is immediately placed on cooled on ice 2min, by 2.0 μ l5 × the first chain buffer (Clontech company), 1.0 μ lDTT (20mM), 1.0 μ ldNTP (10mM), 1.0 μ lpowerscript reverse transcription (Clontech company) join in system, mixing.In 42 DEG C of extension 60min, last 4 DEG C are terminated reaction, are stored in-20 DEG C, standby.

null(in bracket, base occurs at random design two degenerate primer FBA-sense:5 '-ATGCCC (AGCT) CC (AGCT) (CT) CA (AGCT) TGA (CT) GT (ACT) CTCTC-3 ' of synthesis in this position，For degeneracy base) and FBA-anti:5 '-TTA (AGCT) AC (AG) (AGCT) A (AG) CCAGCAGCC-3 ' (in bracket, base occurs at random in this position，For degeneracy base)，With cDNA first chain of reverse transcription synthesis for template，Carry out the degenerate pcr amplification of FBA gene，10 × PCR buffer 5.0 μ l，dNTPs(10mM)1.0μl，Forward primer (50mmol/l) 1.0 μ l，Downstream primer (50mnol/l) 1.0ul，RTaq enzyme (Dalian TakaRa) 0.5 μ l，CDNA the first chain template 1.0 μ l of synthesis，ddH₂O40.5 μ l, is incubated 3min in 94 DEG C, and then in 94 DEG C of 30s, 57 DEG C of 45s, 72 DEG C of 1min, 35 circulations, 72 DEG C of 10min, 4 DEG C are terminated reaction.Amplified production carries out 1% (mass/volume concentration) agarose gel electrophoresis, it was observed that the band (Fig. 1) of about 1.2kb, utilizes DNA to reclaim test kit (purchased from the green skies), according to supplier's proposed steps purified pcr product.PCR primer is cloned into pMD18-T carrier (purchased from Dalian TakaRa) with reference to the method that Dalian TakaRa company provides, it is transformed into E.coliDH5 α competent cell, wherein competent cell presses Calcium Chloride Method (the Molecular Cloning: A Laboratory guide third edition, Pehanorm Brooker work, Huang Peitang etc. translate, and Science Press publishes) prepare.Select Amp resistant transformants and carry out Zengjing Granule, plasmid extraction.The order-checking of Dalian TakaRa company delivered to by recombiant plasmid sample, and the aminoacid sequence that sequence results deduces is analyzed through Blastp, it was demonstrated that for ester of Harden Young aldolase sequence (LsFBA aminoacid sequence), as shown in SEQIDNO:5.Ester of Harden Young aldolase cDNA sequence (LsFBAcDNA) is as shown in SEQIDNO:4 sequence.

Embodiment 3: the amplification of Lipomyces starkeyi NRRLY-11557 genomic DNA

The extracting genome DNA of Lipomyces starkeyi NRRLY-11557 adopts bead breaking cellular wall method (the fine works molecular biology experiment guide third edition the 13rd chapter, Ao Sibai etc. shows, and face grain husk etc. is translated, and Science Press publishes).The genomic DNA prepared, utilizes Nanodrop1000 to measure, records OD₂₆₀/OD₂₈₀=1.85, it was shown that genomic DNA quality is fine.Concentration is 120ng/ μ l, totally 500 μ l, and genome DNA sample is frozen in-20 DEG C, standby.

According to the fructose-1 obtained in embodiment 2,6-bisphosphate aldolase cDNA sequence, design 1 is to gene-specific primer, FBA-p1:5 '-ATGCCCTCCGTCACTGACGTTCTCTC-3 ' and FBA-p2:5 '-TTAGACAGAGCCAGCAGCCTGGAAATC-3 ', with the genomic DNA of Lipomyces starkeyi NRRLY-11557 for template, conventionally carry out pcr amplification, obtain the PCR primer (not shown) of about 1.6kb.Pcr amplification product reclaims according to the operating procedure of embodiment 2, is cloned into pMD18-T carrier, and checks order, and obtains the DNA sequence (LsFBA reading frame) as shown in sequence table SEQ IDNO:3.Warp and the ester of Harden Young aldolase cDNA sequence comparison of acquisition in embodiment 2, it was demonstrated that this genetic fragment is its ester of Harden Young aldolase gene group DNA sequence (gDNA), wherein contains 6 introns and 7 exons.

Embodiment 4: chromosome walking obtains LsFBA gene 5 ' flank sequence (promoter)

The present embodiment utilizes GenomeWalkingKit (purchased from Dalian TakaRa) to complete.

According to the FBADNA sequence obtained in embodiment 3, design 3 SpecificPrimer (gene-specific primer) respectively FBA-SP1:5 '-GCGAAAAAGCGGCCGAGCAAGAG-3 ', FBA-SP2:5 '-GCCGCTTGCGGTGCAGAAAAAAGCCC-3 ' and FBA-SP3:5 '-ATCGCCGACGATGACACCGGATTTG-3 ', as downstream primer, carry out following operation according to test kit description.

1.1^stPCR reacts

Genomic DNA refining in embodiment 3, for template, carries out first round amplification.Reaction system 50 μ l:10 × LAPCRbufferII (Mg²⁺Plus, Dalian TakaRa) 5.0 μ l, dNTPs (2.5mmol/l) 8.0 μ l, LATaqDNA polymerase (5U/ μ l, Dalian TakaRa) 1.0 μ l, AP1Primer (100 μm of ol/l, Dalian TakaRa) 1.0 μ l, FBA-SP1 (10 μm of ol/l) 1.0 μ l, Lipomyces starkeyi NRRLY-11557 genomic DNA template (120ng/ μ l) 1.0 μ l, ddH₂O adds to 50 μ l.Reaction condition: first carry out the high specific reaction of 5 high temperature anneal temperature, then carry out the low specific reaction of 1 extremely low annealing temperature；Then hot asymmetric PCR is carried out: the high specific reaction of 2 high annealing temperatures (65 DEG C) and the low specific reaction alternate cycles of 1 low temperature thermal oxidation (44 DEG C), totally 15 times.Design parameter is as follows: 94 DEG C of 1min, 98 DEG C of 1min；94 DEG C of 30s, 65 DEG C of 1min, 72 DEG C of 2min, totally 5 circulations；94 DEG C of 30s, 25 DEG C of 3min, 72 DEG C of 2min；94 DEG C of 30s, 65 DEG C of 1min, 72 DEG C of 2min, 94 DEG C of 30s, 65 DEG C of 1min, 72 DEG C of 2min, 94 DEG C of 30s, 44 DEG C of 1min, 72 DEG C of 2min, totally 15 circulations；72 DEG C of 10min, terminate reaction.

2.2^ndNest-type PRC reacts

Reaction system 50 μ l:10 × LAPCRbufferII (Mg²⁺Plus, Dalian TakaRa) 5.0 μ l, dNTPs (2.5mmol/l) 8.0 μ l, LATaqDNA polymerase (5U/ μ l, Dalian TakaRa) 1.0 μ l, AP1Primer (100 μm of ol/l, Dalian TakaRa) 1.0 μ l, l^stPCR product 1.0 μ l, FBA-SP2 (10 μm of ol/l) 1.0 μ l, ddH₂O adds to 50 μ l.Reaction condition: 94 DEG C of 30s, 65 DEG C of 1min, 72 DEG C of 2min, 94 DEG C of 30s, 65 DEG C of 1min, 72 DEG C of 2min, 94 DEG C of 30s, 44 DEG C of 1min, 72 DEG C of 2min, totally 15 circulations；72 DEG C of 10min, terminate reaction.

3.3^rdNest-type PRC reacts

Reaction system 50 μ l:10 × LAPCRbufferII (Mg²⁺Plus, Dalian TakaRa) 5.0 μ l, dNTPs (2.5mmol/l) 8.0 μ l, LATaqDNA polymerase (5U/ μ l, Dalian TakaRa) 1.0 μ l, AP1Primer (100 μm of ol/l, Dalian TakaRa) 1.0 μ l, 2^ndNest-type PRC product 1.0 μ l, FBA-SP3 (10 μm of ol/l) 1.0 μ l, ddH₂O adds to 50 μ l.Reaction condition: 94 DEG C of 30s, 65 DEG C of 1min, 72 DEG C of 2min, 94 DEG C of 30s, 65 DEG C of 1min, 72 DEG C of 2min, 94 DEG C of 30s, 44 DEG C of 1min, 72 DEG C of 2min, totally 15 circulations；72 DEG C of 10min, terminate reaction.

3^rdNest-type PRC product cuts purpose band (as shown in Figure 2) after 1% (mass/volume concentration) agarose gel electrophoresis, utilizes DNA fragmentation gel purification kit (purchased from the green skies) to be purified.DNA fragmentation after purification inserts pMD18-T carrier (purchased from Dalian TakaRa company) through TA clone, converts DH5 α competent cell；Wherein competent cell is prepared by Calcium Chloride Method (yellow training hall etc. is translated, and Science Press publishes for the Molecular Cloning: A Laboratory guide third edition, Pehanorm Brooker work).Select Amp resistant transformants and carry out Zengjing Granule, plasmid extraction.The order-checking of Dalian TakaRa company delivered to by recombiant plasmid sample, obtains the DNA sequence as shown in SEQIDNO:1, it was demonstrated that for intended pLsFBA gene order.

Embodiment 5: chromosome walking obtains LsFBA gene 3 ' flank sequence (terminator)

The present embodiment completes also with GenomeWalkingKit (purchased from Dalian TakaRa).

nullAccording to the FBADNA sequence obtained in embodiment 3，Design 3 SpecificPrimer (gene-specific primer) respectively FBA-SP11:5 '-GCATACGATCTCTTCTAATAATTGCC-3 '，FBA-SP22:5 '-CGATCCCCGTGTCTGGGTTCGCGAG-3 ' and FBA-SP33:5 '-CTATGTCGGAGCGTGTCAAGGTTGCC-3 '，As forward primer，3 ' flank chromosome walking operations are carried out according to test kit description，Except SpecificPrimer respectively by FBA-SP1，FBA-SP2，FBA-SP3 is replaced by FBA-SP11 successively，FBA-SP22，Outside FBA-SP33，The other the same as in Example 4.

3^rdNest-type PRC product (as shown in Figure 3) utilizes DNA fragmentation gel purification kit (purchased from the green skies) to be purified, insert pMD18-T carrier (purchased from Dalian TakaRa company) through TA clone, convert DH5 α competent cell；Wherein competent cell is prepared by Calcium Chloride Method (yellow training hall etc. is translated, and Science Press publishes for the Molecular Cloning: A Laboratory guide third edition, Pehanorm Brooker work).Select Amp resistant transformants and carry out Zengjing Granule, plasmid extraction.The order-checking of Dalian TakaRa company delivered to by recombiant plasmid sample, obtains the DNA sequence as shown in SEQIDNO:2, it was demonstrated that for intended ester of Harden Young aldolase terminator (LsFBAt) gene order.

Embodiment 6:LsFBA promoter-open reading frame-terminator full-length gene obtains

According to the promoter obtained in embodiment 4 and embodiment 5 and terminator sequence, redesign pair of primers and carry out the amplification of LsFBA " promoter-open reading frame-terminator " full-length gene.PFBA-p2:5 '-TTTCTTGAAGGAGACGACTGGCAG-3 ', FBAt-p2:5 '-GTATACATGCATGGATTTTGACCG-3 '.In embodiment 3, the L.starkeyiNRRLY-11557 genomic DNA of preparation carries out pcr amplification for template.PCR system (50 μ l): 10 × Speedbuffer (Dalian TakaRa) 5.0 μ l, dNTPs (10mmol/l) 1.0 μ l, forward primer (10 μm of ol/l) 2.0 μ l, downstream primer (10 μm of ol/l) 2.0 μ l, SpeedSTAR^TMHSDNA polymerase (amplification rate is fast, and 1kb/10s, purchased from Dalian TakaRa company) 0.5 μ l, genomic DNA template (120ng/ μ l) 2 μ l, ddH₂O adds to 50 μ l.Reaction condition: 98 DEG C of 1min, 98 DEG C of 10s, 65 DEG C of 1.0min, 35 circulations, 72 DEG C of 10min, 4 DEG C are terminated reaction.PCR primer utilizes PCR fragment purification kit (purchased from the green skies) to be purified after 1% (mass/volume concentration) agarose gel electrophoresis analysis.Fragment inserts pMD18-T carrier (purchased from Dalian TakaRa company) through TA clone, converts DH5 α competent cell；Wherein competent cell is prepared by Calcium Chloride Method (yellow training hall etc. is translated, and Science Press publishes for the Molecular Cloning: A Laboratory guide third edition, Pehanorm Brooker work).Select Amp resistant transformants and carry out Zengjing Granule, plasmid extraction.The order-checking of Dalian TakaRa company delivered to by recombiant plasmid sample, it was demonstrated that for intended pLsFBAt (ester of Harden Young aldolase) full length gene sequence, this recombinant vector called after T-FBA.

Embodiment 7:RF cloning builds hygromycin protein expression box FBAHYG

HYG protein sequence according to NCBI report entrusts Shanghai Sheng Gong company full genome synthesis HYG gene (as shown in SEQIDNO:6).With the gene of synthesis for template, reference literature method (vandenEnt, F., andLowe, J.JBiochemBiophysMethods, 2006,67,67-74.), design RF cloning primer: HYG-RF-p1:5 '-ATCGTCATATTCGTGGTCTCTGACAATGCCGGAGCTCACGGCGACGTCGG-3 ' and HYG-RF-p2:5 '-TTAGAATCCCAACATTAACGGGAGCTATTCTTTCGCCCGCGGGCGCGT-3 ' is primer, carries out pcr amplification.Carry out RF first round amplification.System (50 μ l): 5 × Primebuffer (Dalian TakaRa) 10.0 μ l, dNTPs (2.5mmol/l) 4.0 μ l, forward primer (10 μm of ol/l) 2.0 μ l, downstream primer (10 μm of ol/l) 2.0 μ l, PrimeSTAR^TMHSDNA polymerase (Dalian TakaRa) 1.0 μ l, T-GFPuv plasmid (100ng/ μ l) 1 μ l, ddH₂O adds to 50 μ l.Reaction condition: 95 DEG C of 3min, 98 DEG C of 8s, 49 DEG C of 15s, 72 DEG C of 1min, 35 circulations, 72 DEG C of 10min, 4 DEG C are terminated reaction.RFI product utilizes DNA fragmentation glue to reclaim Purification Kit, and-20 DEG C save backup.

RFII reacts: 5 × Primebuffer (Dalian TakaRa) 10.0 μ l, dNTPs (2.5mmol/l) 4.0 μ l, T-FBA plasmid (100ng/ μ l) the 1.0 μ l built in embodiment 5, RFI product (200ng/ μ l) 5.0 μ l, PrimeSTAR in the present embodiment abovementioned steps^TMHSDNA polymerase (Dalian TakaRa) 1.0 μ l, ddH₂O adds to 50 μ l.Reaction condition: 95 DEG C of 3min, 68 DEG C of 12min, afterwards 95 DEG C of 30s, 65 DEG C of 45s (-1 DEG C/cyc), 68 DEG C of 12min, 15 circulations, next carry out again taking turns: 95 DEG C of 30s, 55 DEG C of 45s, 68 DEG C of 12min, 20 circulations, 72 DEG C of 10min, 4 DEG C are terminated reaction.

DpnI digestion is with electroporated: takes 8 μ lRFII product and adds 1 μ lDpnI (purchased from NewEnglandBiolabs) and 1 μ lDpnIbuffer, after acting on the 120min former T-FBA plasmid of removal at 37 DEG C after mixing, take the 2 electroporated DH5 α competent cells of μ l, competent cell prepares (the Molecular Cloning: A Laboratory guide third edition by standard method, Pehanorm Brooker work, Huang Peitang etc. translate, Science Press publishes), electroporated parameter: 2200-2500V, 400 Ω, 25 μ F, 0 DEG C, 4-8ms.Select Amp resistant transformants and carry out Zengjing Granule, plasmid extraction, and utilize RFI reaction the primer HYG-RF-p1 and HYG-RF-p2 to carry out bacterium colony PCR qualification, identify that positive recombinant vector send Dalian TakaRa to check order, obtain 5 ' ends and 3 ' and hold the FBAHYG expression cassette of respectively FBA promoter and FBA terminator, meanwhile, this recombinant vector called after T-FBAHYG.Complete FBAHYG expression cassette is such as (pLsFBA-HYG-LsFBAt) shown in SEQIDNO:7.

Embodiment 8: utilize FBAHYG expression cassette to carry out the conversion of oil-producing saccharomyces oleaginosus (Lipomyceslipofer) CBS944 yeast

Agrobacterium tumefaciems (Agrobacteriumtumefaciens) is a kind of gram negative bacteria, scab can be passed through under field conditions (factors) or wound enters host tissue, the section of DNA that it is internal is proceeded in Plant Genome, final stimulation host development is abnormal, form crown gall nodule infecting position, cause root knot.This characteristic of Agrobacterium is applied to the transformation of Plant Genome the earliest, is called ATMT technology.ATMT technology is widely used in multiple fungus and Yeast Genetics transformation subsequently.

ATMT conversion process substantially can be divided into vector construction, Agrobacterium activation, host material to prepare, cotransformation and these five steps of transformant screening.First in the selected marker that the interregional insertion of the T-DNA of binary vector is suitable, and Agrobacterium is proceeded to；With acetosyringone (AS) induction after Agrobacterium tumefaciens attachment activation containing binary vector；Host strain is diluted to certain concentration after overactivation；Activation the Agrobacterium after inducing are mixed with host material, coat be covered with mounting medium co-culture on flat board, at suitable temperature, carry out cotransformation；The mixed bacterium co-cultured is transferred on screening flat board, be placed at the optimum temperature of Host Strains and cultivate, occur to transformant.

1. contain the structure of the binary vector PZPK-FBAHYG of FBAHYG expression cassette

PZPK is that laboratory conventionally molecular cloning method builds voluntarily.Construction method is as follows:

With PZPK-RF-P1

null5 '-GTGGAACGAAAACTCACGTTAAGGGATTTTGGTCATGAGCCATATTCAACGGGA-3 ' and PZPK-RF-P2:5 '-GATTGTAACGATGACAGAGCGTTGCTGCCTGTGATTAGAAAAACTCATCGAGCA-3 ' for primer from pET24b (+) (purchased from Novegen company) amplification obtain kanamycin (KAN) resistance gene fragment，Then utilize RF cloning process (as shown in Example 3) that streptomycin/spectinomycin (aadA) resistant gene on pPZP200 carrier (purchased from American standard biological product collecting center (ATCC)) is replaced with KAN，The carrier called after PZPK obtained.

The structure of PZPK-FBAHYG carrier then adopts FBAHYG-RF-P1:5 '-GAATTGAATTCGAGCTCGCTCGGTACCCGGTTGCGATAATAGCACACCATGC-3 ' and FBAHYG-RF-P2:5 '-GCTTGCATGCTGCAGGTCGACTCTAGATCTGCGCAGGTTGAATGGTAGCGG-3 ' to be primer, obtaining FBAHYG fragment with the T-FBAHYG that embodiment 7 builds for template amplification, PCR glue adopts RF cloning process (as shown in Example 7) FBAHYG fragment to be inserted between LB and RB of PZPK binary vector after reclaiming.The carrier called after PZPK-FBAHYG obtained, structure is as shown in Figure 4.

2. contain the structure of the Agrobacterium tumefaciens attachment of PZPK-FBAHYG plasmid

The PZPK-FBAHYG binary vector obtained adopts electroporated method to convert to Agrobacterium tumefaciems (Agrobacteriumtumefaciems) AGL1 (purchased from American standard biological product collecting center (ATCC)), picking transformant on the LB flat board containing 50ng/ μ l kanamycin.Agrobacterium-mediated Transformation is verified initially with the method for bacterium colony PCR.Verify correct transformant, extract plasmid therein, convert to escherichia coli.Binary vector send sequence verification after being enriched with in a large number by escherichia coli.Agrobacterium strains containing order-checking correct plasmid is engineered strain,

The expression in oil-producing saccharomyces oleaginosus CBS944 yeast of the 3.FBAHYG gene

Oil-producing saccharomyces oleaginosus CBS944 is purchased from barms preservation center (CBS, Centraalbureau Voor preservation center).Take the oil-producing saccharomyces oleaginosus CBS944 yeast after a ring activation, be connected in 5mlYEPD (glucose 20.0g/l, yeast extract 10.0g/l, peptone 20.0g/l, pH6.0) culture fluid, 30 DEG C, 200r/min incubated overnight.After washing one time with sterilized water, regulate to OD₆₀₀=0.1-0.8, standby.After Agrobacterium activation containing PZPK-FBAHYG plasmid, it is connected in the 5ml LB liquid containing kanamycin (50ng/ μ l) and rifampicin (50ng/ μ l), 30 DEG C, 200r/min overnight incubation.Wash one time with sterilized water, regulate to OD₆₀₀=0.1-1.6, standby.

nullTake above-mentioned yeast and each 400 μ l of Agrobacterium diluent，Mixing，Directly drip in induction flat board (5mmol/l glucose，0.5% glycerol，1.45g/l potassium dihydrogen phosphate，2.05g/l dipotassium hydrogen phosphate，0.15g/l sodium chloride，0.5g/l Magnesium sulfate heptahydrate，66mg/l calcium chloride dihydrate，2.48g/l green-vitriol，0.5g/l ammonium sulfate，40mmol/lMES (2-(N-morpholine) ethyl sulfonic acid)，2% agar powder，200 μm of ol/L acetosyringones) upper (Bundock，P.，denDulk-Ras，A.，Beijersbergen，A.，etal.EMBOJ.，1995，14，3206-3214.)，24-25℃，Cultivate 4 days.With the sterilized water of about 10ml, mixing lawn is washed down, 3000r/min is centrifuged 5min, discard upper strata and mainly contain the liquid of Agrobacterium, remaining cell is resuspended with 800 μ l sterilized water, take 50-200 μ l and coat in screening flat board (YEPD containing 50ng/ μ l hygromycin and 300 μ g/mL cephalosporins), cultivate in 30 DEG C, until transformant occurs.

4. the PCR of oil-producing saccharomyces oleaginosus CBS944 hygromycin transformant identifies

6 hygromycin resistance oil-producing saccharomyces oleaginosus transformants of random picking, access in YEPD (glucose 20.0g/l, yeast extract 10.0g/l, peptone 20.0g/l, the pH6.0) liquid containing 50ng/ μ L hygromycin, cultivate 24h in 30 DEG C of shaking tables.Bead breaking cellular wall method described in reference example 3 extracts oil-producing saccharomyces oleaginosus CBS944 genomic DNA, and adopting HYG-RF-p1 and HYG-RF-p2 is primer, carries out PCR qualification.PCR system (50 μ l): 5 × Primebuffer (Dalian TakaRa) 10.0 μ l, dNTPs (2.5mmol/l) 4.0 μ l, forward primer (10 μm of ol/l) 2.0 μ l, downstream primer (10 μm of ol/l) 2.0 μ l, PrimeSTAR^TMHSDNA polymerase (Dalian TakaRa) 1.0 μ l, genomic DNA (20ng/ μ l) 1 μ l, ddH₂O adds to 50 μ l.Reaction condition: 95 DEG C of 3min, 98 DEG C of 8s, 49 DEG C of 15s, 72 DEG C of 1min, 35 circulations, 72 DEG C of 10min, 4 DEG C are terminated reaction.PCR primer is through 1% (mass/volume concentration) agarose gel electrophoresis analysis.Result is as shown in Figure 5.Visible, external source HYG fragment is successfully integrated in oil-producing saccharomyces oleaginosus CBS944 genome.

5. the Westernblot of oil-producing saccharomyces oleaginosus CBS944 hygromycin transformant analyzes

Except directly utilizing hygromycin resistance phenotype to determine that Lipomyces starkeyi FBA promoter can start hygromycin gene except the expression of oil-producing saccharomyces oleaginosus, owing to the C-end of hygromycin gene expression product carries 6 × HisTag, it is also with anti-HisTag antibody and is analyzed the expression determining gene by Westernblot.Above-mentioned PCR identifies 6 correct transformants, 3 transformants of random picking, accesses in the 10ml YEPD liquid containing 50ng/ μ L hygromycin, cultivates the centrifugal 10min of 48h, 4000r/min in 30 DEG C of shaking tables and collects bacterial strain.After the thalline obtained washs one time with sterilized water, add the broken bacterium buffer (20mmol/lTris-HCl of bead of 400ul, 10mmol/l magnesium chloride, 1mmol/lEDTA, 5% glycerol, 1mmol/lDTT, 0.3mmol/l ammonium sulfate, 1mmol/lPMSF) resuspended, add the pickling glass pearl of equal volume.Bead breaking cellular wall method smudge cells is adopted to extract total protein of cell (face grain husk etc. is translated, and Science Press publishes for the fine works molecular biology experiment guide third edition the 13rd chapter, the work such as Ao Sibai).After total protein of cell is easily separated on 12%SDS-PAGE glue, transfer to (Solarbio on nitrocellulose filter, Beijing, China), little mouse-anti His-tag antibody (purchased from the green skies, Shanghai Bioisystech Co., Ltd) and horseradish peroxidase-labeled goat anti-mouse IgG (purchased from the green skies Bioisystech Co., Ltd in Shanghai) is adopted to resist as primary antibodie and two, DAB horseradish peroxidase colour reagent box (purchased from the green skies Bioisystech Co., Ltd in Shanghai) develops the color, and the expression of hygromycin gene (Fig. 6) all be can be observed.

Embodiment 9: utilize the URA3 gene knockout that FBABLE expression cassette carries out Lipomyces starkeyi NRRLY-11557 to hold concurrently BLE protein expression

Utilize Lipomyces starkeyi URA3 gene as integration site at this, by RF cloning process, 5 ' and the 3 ' ends making FBABLE carry the Lipomyces starkeyi URA3 homologous recombination arm of about 1500bp, utilize BLE resistance screening labelling to carry out the screening of transformant.

1. the acquisition of Lipomyces starkeyi URA3 gene

According to Lipomyces starkeyi NRRLY-11557 gene order-checking result, search out URA3 (orotidine-5 '-phosphatedecarboxylase) gene, design special primer: URA3-P1:5 '-TGGCTCCAATGAGTCGTTGCTTCCAGCGC-3 ' and URA3-P2:5 '-CAAGGAGAGAGGCGTTAAGCCTAAAG-3 ', with Lipomyces starkeyi NRRLY-11557 genome for template, amplification obtains the full-length gene group sequence containing URA3 promoter, reading frame and terminator.After utilizing DNA to reclaim kits PCR primer, it is cloned into pMD18-T carrier, is transformed into escherichia coli (E.coli) DH5 α competent cell.Select Amp resistant transformants and carry out Zengjing Granule, plasmid extraction.Recombiant plasmid sample delivers to the order-checking of Dalian TakaRa company, sequence results and gene order-checking result comparison, it was demonstrated that comprise the DNA sequence (as shown in SEQIDNO:8, pURA3-URA3-URA3t) of URA3 promoter, terminator and reading frame.This plasmid called after T-URA3.

2.RF cloning process builds FBABLE expression cassette

With pPICZ α A (purchased from Invitrogen) for template, utilize pair of primers BLE-RF-p1:5 '-GGTTTTCGTCGTCTCACTACATTGATCATGGCCAAGTTGACCAGTGCCG-3 ' and BLE-RF-p2:5 '-GTTCCCACGATTTTAGATGGATTCCATCAGTCCTGCTCCTCGGCCACG-3 ', carry out pcr amplification.According to the RF cloning process described in embodiment 3, with T-FBA for skeleton, BLE (SEQIDNO:9) is inserted between pLsFBA and LsFBAt, the plasmid called after T-FBABLE being built into.

3.URA3-FBABLE knocks out the structure of box

Adopting primers F BABLE-RF-P1:5 '-CTTGTCTTCTACAGTATATCCCTAAATTCAACCGGTTGCGATAATAGCACACCATG C-3 ' and FBABLE-RF-P2:5 '-CTGCCCTTCACTCATCAATTACCAATCTGCGCAGGTTGAATGGTAGCGG-3 ' is primer, carries out pcr amplification.According to the RF cloning process described in embodiment 3, with T-FBABLE for skeleton, FBABLE is inserted in LsURA3, the sequence of gained through Takara check order after as shown in SEQIDNO:10 (pURA3-FBABLE-URA3t), the plasmid called after T-URA3-FBABLE being built into, structure is as shown in Figure 7.Recombiant plasmid sample delivers to the order-checking of Dalian TakaRa company, sequence results and gene order-checking result comparison, it was demonstrated that this genetic fragment is that two sections of FBABLE with 1500bpURA3 restructuring arm knock out box.

4.URA3-FBABLE knocks out the preparation of box

With T-URA3-FBABLE plasmid for template, with URA3-P1 and URA3-P2 for primer, carry out URA3-FBABLE and knock out a large amount of preparations of box.PCR system (500 μ l): 10 × Speedbuffer (Dalian TakaRa) 50.0 μ l, dNTPs (10mmol/l) 10.0 μ l, forward primer (10 μm of ol/l) 20.0 μ l, downstream primer (10 μm of ol/l) 20.0 μ l, SpeedSTAR^TMHSDNA polymerase (amplification rate is fast, and 1kb/10s, purchased from Dalian TakaRa company) 5.0 μ l, genomic DNA template (120ng/ μ l) 15.0 μ l, ddH₂O adds to 500 μ l, subpackage after mixing.Reaction condition: 98 DEG C of 1min, 98 DEG C of 10s, 65 DEG C of 60s, 35 circulations, 72 DEG C of 10min, 4 DEG C are terminated reaction.

PCR primer utilizes PCR fragment purification kit (purchased from the green skies) to be purified after 1% (mass/volume concentration) agarose gel electrophoresis analysis.DNA fragmentation concentration after purification is 300ng/ μ l, totally 50 μ l, and-20 DEG C save backup.

5. prepared by Lipomyces starkeyi NRRLY-11557 competent cell

The preparation of Lipomyces starkeyi NRRLY-11557 competent cell: (bacterial strain chooses colony inoculation 10mlYEPD culture medium (glucose 20.0g/l to Lipomyces starkeyi NRRLY-11557, yeast extract 10.0g/l, peptone 20.0g/l, pH6.0), 30 DEG C, 200rpm, cultivates 20h；Culture 1: the 50 ratio fresh YEPD culture medium of switching, 100ml (500ml conical flask, liquid amount 100ml), 30 DEG C, 200rpm, cultivates 6-9h, OD value and reaches 0.6-1.2；Culture ice bath 10-30min, 4 DEG C, 4000r/min is centrifuged 5min, abandons supernatant；0 DEG C of aseptic Milli-Q washes 1 time；0 DEG C of 1mol/l sorbitol washes 2 times；Ice bath, standby.Take 100 μ l Lipomyces starkeyi NRRLY-11557 competent cells, add URA3-FBABLE expression cassette 10 μ l (altogether 3 μ g), move in the electric shock cup being cooled to 0 DEG C in advance after mixing, parameter: voltage 0.8-2.0 kilovolt, resistance 200 Ω, electric capacity 25 μ F, time 4-10ms；1 μ lYEPD is added immediately, 30 DEG C of incubation 1-2h after electric shock；Coating YEPD flat board (containing bleomycin 50ng/ μ l), cultivates more than 5 days for 30 DEG C.Result is as shown in Figure 8.

6. the bacterium colony PCR of transformant identifies

Blasticidin resistance transformant inoculation 10mlYEPD fluid medium (containing bleomycin 50ng/ μ l).Extract genomic DNA with reference to bead breaking cellular wall method in embodiment 3, adopt BLE-RF-p1 and BLE-RF-p2 to carry out PCR qualification.PCR system (25 μ l): 10 × Speedbuffer (Dalian TakaRa) 2.5 μ l, dNTPs (10mmol/l) 0.5 μ l, forward primer (10 μm of ol/l) 1.0 μ l, downstream primer (10 μm of ol/l) 1.0 μ l, SpeedSTAR^TMHSDNA polymerase (amplification rate is fast, and 1kb/10s, purchased from Dalian TakaRa company) 0.25 μ l, genomic DNA template (100ng/ μ l) 1.0 μ l, ddH₂O adds to 25 μ l.Reaction condition: 98 DEG C of 1min, 98 DEG C of 10s, 65 DEG C of 60s, 35 circulations, 72 DEG C of 10min, 4 DEG C are terminated reaction.Result shows, all Lipomyces starkeyi NRRLY-11557 recombinant bacterial strains all amplifiable go out external source BLE genetic fragment, control strain Lipomyces starkeyi NRRLY-11557 is then without corresponding PCR primer.

Further the transformant that above-mentioned qualification is correct is carried out phenotype checking.Result shows: all recons on YEPD fluid medium, bacterial strain normal growth.By same transformant colony inoculation in the SD culture medium without uracil, it does not have bacterium colony is formed.Visible conversion obtains new phenotype, it may be assumed that uracil auxotrophy.5 '-FOA resistant phenotypes are analyzed result and are shown, this uracil auxotrophy Lipomyces starkeyi engineered strain is at culture medium (the 0.1%5 '-FOA, glucose 70g/L, (NH containing 5 '-FOA₄)₂SO₄0.1g/L, yeast powder 0.75g/L, KH₂PO₄0.4g/L, MgSO₄·7H₂O1.5g/L, pH6.0) upper cultivation, it is possible to normal growth, the L.starkeyiNRRLY-11557 of wild type then cannot grow in the culture medium containing 5 '-FOA.

Therefore, from genotype to phenotype, all verify the disappearance of Lipomyces starkeyi NRRLY-11557 recombinant bacterial strain URA3 gene.

The expression analysis (transcriptional level expression analysis, RT-PCR) of 7.Ble gene

Except directly utilizing bleomycin resistance phenotype to determine that Lipomyces starkeyi FBA promoter can start bleomycin resistance gene except the expression expression of Lay mycin resistant gene (the bleomycin resistance phenotype be decided by) of Lipomyces starkeyi, RT-PCR method is also utilized to have detected the expression of transcriptional level of bleomycin resistance gene ble.

Blasticidin resistance transformant inoculation 10mlYEPD fluid medium (containing bleomycin 50ng/ μ l) that random picking 2 strain bacterium colony PCR identifies and phenotype analytical is all correct.Cell total rna is extracted with reference to embodiment 1 method, reverse transcription (RT) is carried out with reference to embodiment 2 method, with synthesized cDNA the first chain for template, BLE-p1:ATGGCCAAGTTGACCAGTGCCG and BLE-p2:TCAGTCCTGCTCCTCGGCCACG is utilized to carry out pcr amplification for primer.PCR system (25 μ l): 10 × ExTaqbuffer (Dalian TakaRa) 2.5 μ l, dNTPs (10mmol/l) 0.5 μ l, forward primer BLE-p1 (10 μm of ol/l) 1.0 μ l, downstream primer BLE-p2 (10 μm of ol/l) 1.0 μ l, ExTaqDNA polymerase 0.25 μ l, cDNA the first chain template 1.0 μ l, ddH₂O adds to 25 μ l.Reaction condition: 98 DEG C of 1min, 98 DEG C of 10s, 65 DEG C of 60s, 35 circulations, 72 DEG C of 10min, 4 DEG C are terminated reaction.Result shows, all Lipomyces starkeyi NRRLY-11557 recombinant bacterial strains all amplifiable go out 0.3kbBLE genetic fragment, control strain Lipomyces starkeyi NRRLY-11557 is then without corresponding PCR primer (Fig. 9).

Embodiment 10: fatty acid hydroxylase and geneticin resistant albumen belong to the expression in (Lipomycessp.) CBS7729 at saccharomyces oleaginosus

Castor oil acid (12-hydroxy-octadeca-cis-9-enoicacid:C18:1-OH) is the very valuable essential industry raw material of a class.Existing source is mainly plant and squeezes, but resource is restricted.Derive from pathogenic epiphyte Clavicipitaceae (Clavicepspurpurea) the oleate hydroxylase gene (CpFAH, Genbank registration number: EU661785) expression in microorganism and can provide a new approach for the supply of castor oil acid.Utilize at this genetic resistance genes for selection markers, start the expression of oleate hydroxylase gene C pFAH with FBA promoter, to realize the purpose of synthetic castor oil acid in Lipomyces starkeyi.

1.FBAKAN knocks out the structure of box

Adopting primer KAN-RF-P1:5 '-GTTTTCGTCGTCTCACTACATTGATCATGGGTAAGGAAAAGACTCACG-3 ' and KAN-RF-p2:5 '-GCGGTTCCCACGATTTTAGATGGATTCCATTAGAAAAACTCATCGAGCATC-3 ' is primer, with pFA6-kanmx4 (purchased from EUROSCARF) for skeleton, carry out pcr amplification, amplified production send Takara to check order, and result is such as (Kanmx) shown in SEQIDNO:11.According to the RF cloning process described in embodiment 3, with T-FBA for template, FBAKAN is inserted in FBA, the plasmid called after T-FBAKAN being built into.

The structure of 2.FBACpFAH expression cassette

Entrusting the raw work full genome in Shanghai to synthesize this gene according to CpFAH (EU661785) gene of report on NCBI, sequence is such as (CpFAH) shown in SEQIDNO:12.Primer CpFAH-RF-p1:5 '-GTTTTCGTCGTCTCACTACATTGATCATGGCTTCCGCTACTCCTGCAATG-3 ' and CpFAH-RF-p2:5 '-GGTTCCCACGATTTTAGATGGATTCCACTACTGAGTCTTCATTGAAATGGG-3 ' is primer, carries out pcr amplification.According to the RF cloning process described in embodiment 3, with T-FBA for skeleton, oleate hydroxylase gene C pFAH is inserted between promoter pLsFBA and terminator LsFBAt, the plasmid called after T-FBACpFAH being built into.

The structure of 3.FBAKAN-CpFAH carrier

With FBAKAN-KpnI:5 '-ATCGggtaccCGGTTGCGATAATAGCACACCATG-3 ' and FBAKAN-PstI:5 '-ACTGctgcagTCTGCGCAGGTTGAATGGTAG-3 ' for primer, T-FBAKAN is template, amplification obtains the FBAKAN sequence with KpnI and PstI restriction enzyme site, utilizes PCR fragment purification kit (purchased from the green skies) to be purified.DNA fragmentation concentration after purification is 200ng/ μ l, totally 50 μ l, and-20 DEG C save backup.

With FBACpFAH-PstI:5 '-ATCGctgcagCGGTTGCGATAATAGCACACCATGC-3 ' and FBACpFAH-XbaI:5 '-ACTGtctagaTCTGCGCAGGTTGAATGGTAGCG-3 ' for primer, T-FBACpFAH is template, amplification obtains the FBACpFAH sequence with PstI and XbaI enzyme cutting site, utilizes PCR fragment purification kit (purchased from the green skies) to be purified.DNA fragmentation concentration after purification is 220ng/ μ l, totally 50 μ l, and-20 DEG C save backup.

Above-mentioned two fragment is mixed with the ratio of mol ratio 1: 1: 1 with the PZPK carrier after KpnI and XbaI enzyme cutting, the DNA adding equal volume connects reagent SolutionI (DNA ligation kit, purchased from Takara company, article No. 6022), react cumulative volume 10 μ l.After connecting 2h in 16 DEG C, converting to DH5 α competent cell through thermal shock, competent cell prepares (yellow training hall etc. is translated, and Science Press publishes for the Molecular Cloning: A Laboratory guide third edition, Pehanorm Brooker work) by standard method.Select Kan resistant transformants and carry out Zengjing Granule, plasmid extraction.Recombiant plasmid sample (plasmid construct is as shown in Figure 10) delivers to the order-checking of Dalian TakaRa company, sequence results and gene order-checking result comparison, and sequence is such as (FBAKAN-CpFAH) shown in SEQIDNO:13.Confirm to comprise FBAKAN and FBACpFAH fragment.

4. contain the structure of the Agrobacterium tumefaciens attachment of FBAKAN-CpFAH carrier

Constructed FBAKAN-CpFAH carrier adopts electroporated method to convert to Agrobacterium AGL1, picking transformant on the LB flat board containing 50ng/ μ l kanamycin.Kalamycin resistance Agrobacterium-mediated Transformation is verified initially with the method for bacterium colony PCR.Verify correct transformant, after Zengjing Granule, extract plasmid therein, convert to escherichia coli.Binary vector send sequence verification after being enriched with in a large number by escherichia coli.Agrobacterium strains containing order-checking correct plasmid is then for restructuring agrobacterium strains.

5.FBAKAN-CpFAH expression cassette belongs to the expression in CBS7729 yeast at saccharomyces oleaginosus

Saccharomyces oleaginosus belongs to CBS7729 purchased from barms preservation center (CBS, Centraalbureau Voor preservation center).Take the L.starkeyiCICC1715 yeast after a ring activation, be connected in 5mlYEPD (glucose 20.0g/l, yeast extract 10.0g/l, peptone 20.0g/l, pH6.0), 25 DEG C, 200r/min incubated overnight.After washing one time with sterilized water, regulate to OD₆₀₀=1-2, standby.After Agrobacterium activation, it is connected in the 5ml LB liquid containing kanamycin (100ng/ μ l) and rifampicin (80ng/ μ l), 250 DEG C, 200r/min overnight incubation.Wash one time with sterilized water, regulate to OD₆₀₀=1-3, standby.

Take above-mentioned yeast and each 200 μ l of Agrobacterium diluent, mixing, directly drip in induction flat board ((5mmol/l glucose, 0.5% glycerol, 1.45g/l potassium dihydrogen phosphate, 2.05g/l dipotassium hydrogen phosphate, 0.15g/l sodium chloride, 0.5g/l Magnesium sulfate heptahydrate, 66mg/l calcium chloride dihydrate, 2.48g/l green-vitriol, 0.5g/l ammonium sulfate, 40mmol/lMES (2-(N-morpholine) ethyl sulfonic acid), 2% agar powder, 200 μm of ol/L acetosyringones)) on, 28 DEG C, cultivate 2 days.With the sterilized water of about 10ml, mixing lawn is washed down, 3000r/min is centrifuged 10min, discard upper strata and mainly contain the liquid of Agrobacterium, remaining cell 1ml sterilized water is resuspended, take and coat in screening flat board (YEPD containing 50ng/ μ l Geneticin and 300 μ g/ml cephalosporins) in right amount, cultivate in 25 DEG C, until transformant occurs.

6. saccharomyces oleaginosus belongs to the bacterium colony PCR qualification of CBS7729 transformant

6 geneticin resistant saccharomyces oleaginosus CBS7729 transformants of random picking access in the 50ml YEPD liquid containing 50ng/ μ l Geneticin and cultivate, bead breaking cellular wall method described in reference example 3 extracts genomic DNA, adopt FBAKAN-RF-P1 and FBAKAN-RF-P2, CpFAH-RF-p1 and CpFAH-RF-p2 is primer, carries out PCR qualification.Result shows, exogenous gene KAN and CpFAH is all successfully integrated in saccharomyces oleaginosus CBS7729 genome.

7. restructuring saccharomyces oleaginosus belongs to the fermenting experiment of CBS7729 production castor oil acid

After 3 bacterium colony PCR of picking identify that correct transformants activate 2-3 days on flat board, the basically identical single bacterium colony of picking size is connected in the 5ml YEPD culture medium containing 50ng/ μ l Geneticin.Cultivate 24h, with the inoculum concentration of 1: 50 be connected to 50ml contain 50ng/ μ L Geneticin YEPD culture medium in, as secondary seed.After secondary seed cultivates 24h, take in the 5mL YEPD fermentation medium adding 45ml.In sweat, every 12h regulates a pH.Terminate after cultivating 120h.Taking 40ml zymocyte liquid and be placed in 50ml round bottom centrifuge tube, the centrifugal 5min of 8000r/min room temperature collects thalline, and with deionized water wash 2 times, 105 DEG C are dried 24h to constant weight.Cool down in exsiccator after taking-up, then record is weighed, add the ratio of 6ml4mol/l hydrochloric acid in 1g dry mycelium after weighing, often pipe adds 4ml4mol/l hydrochloric acid, 78 DEG C of water-bath digestion 1h, adds the chloroform/methanol (1: 1 of 2 times of volumes after cooling, v/v), fully vibrate mixing, centrifugal after extracting 1h, take chloroform layer and put in a new centrifuge tube.Aqueous phase extracts once again with equal-volume chloroform, fully centrifugal after vibration, takes chloroform layer and puts into merging in above-mentioned new centrifuge tube, and adds equal-volume 0.1% sodium chloride solution, centrifugal after vibration mixing.With syringe lower floor's organic facies carefully extracted and inject in preprepared glass funnel that (degreasing cotton filled in advance by funnel, and add appropriate anhydrous sodium sulfate), treat that in funnel, organic solution flows in the glass oil bottle of lower section substantially, add appropriate chloroform and rinse funnel 4 times, flow in the oil bottle of lower section in the lump, extract and have the chloroform of oils and fats to adopt Rotary Evaporators to carry out Grease Collection, the oil bottle that have collected oils and fats is put into oven for drying 24h.

Bacterium oil is carried out esterification: weigh the oils and fats to be measured of 70.0mg, add the KOH/CH of 5%₃OH solution 0.5ml, is heated to reflux 50min, is subsequently adding BF₃Methanol solution (V_{BF3 diethyl ether solution}∶V_CH3OH=4: 10) 0.7ml, continues backflow 10min.Adding 1ml deionized water and 0.7ml normal hexane after cooling, sucking-off organic facies after mixing, for gas chromatographic analysis after deionized water wash twice.

8. restructuring saccharomyces oleaginosus CBS7729 produces the detection of castor oil acid

Transesterification for step 7 sample obtained is dissolved in normal hexane, adopt document (Meesapyodsuk, D., andQiu, X.PlantPhysiol., 2008,147,1325-1333.) in method detect, standard substance are methyl ricinolcic acid (CAS:141-24-2), and negative control is the transesterification product of oils and fats of wild type saccharomyces oleaginosus CBS7729.Result shows, proceeds in the saccharomyces oleaginosus CBS7729 of CpFAH gene and truly has castor oil acid to produce, and content is 155 μ g/ml, and total amount accounts for more than the 52% of overall free fatty acid content.

9, the expression analysis Westernblot of oleate hydroxylase in restructuring saccharomyces oleaginosus CBS7729

Except determining Lipomyces starkeyi FBA promoter either directly through castor oil acid production phenotype and can starting the expression in saccharomyces oleaginosus belongs to of the oleate hydroxylase gene, owing to the C-end of oleate hydroxylase gene expression product carries 6 × HisTag, it is also with the expression by immunoblotting assay oleate hydroxylase gene of the anti-HisTag antibody.In above-mentioned steps 6, PCR identifies 6 correct transformants, random picking 3, accesses in the 10ml YEPD liquid containing 50ng/ μ L Geneticin, cultivates the centrifugal 10min of 48h, 4000r/min in 30 DEG C of shaking tables and collects bacterial strain.After the thalline obtained washs one time with sterilized water, add the broken bacterium buffer (20mmol/lTris-HCl of bead of 400ul, 10mmol/l magnesium chloride, 1mmol/lEDTA, 5% glycerol, 1mmol/lDTT, 0.3mmol/l ammonium sulfate, 1mmol/lPMSF) resuspended, add the pickling glass pearl of equal volume.Bead breaking cellular wall method smudge cells is adopted to extract total protein of cell (face grain husk etc. is translated, and Science Press publishes for the fine works molecular biology experiment guide third edition the 13rd chapter, the work such as Ao Sibai).After total protein of cell is easily separated on 12%SDS-PAGE glue, transfer on nitrocellulose filter (purchased from Shanghai bio-engineering corporation), little mouse-anti His-tag antibody (purchased from the green skies, Shanghai Bioisystech Co., Ltd) and horseradish peroxidase-labeled goat anti-mouse IgG (purchased from the green skies Bioisystech Co., Ltd in Shanghai) is adopted to resist as primary antibodie and two, DAB horseradish peroxidase colour reagent box (purchased from the green skies Bioisystech Co., Ltd in Shanghai) develops the color, and the expression of oleate hydroxylase gene (Figure 11) all be can be observed.

Embodiment 11: utilize FBAHYG expression cassette to carry out the conversion of Fructus Citri tangerinae woods saccharomyces oleaginosus (Lipomyceskononenkoae) ATCC44833

Fructus Citri tangerinae woods saccharomyces oleaginosus ATCC44833 (purchased from American standard biological product collecting center (ATCC)) is by inclined plane inoculating to 50mlYEPD fluid medium, 24h is cultivated in 30 DEG C of shaking tables, with the volume ratio of 1: 50, bacterium solution is transferred in 100mlYEPD fluid medium respectively again, cultivates 12h in 30 DEG C of shaking tables and reach exponential phase.The centrifugal 5min of 3000g collects thalline, and re-suspended cell is in the sterilized water of 25mL.20 DEG C, the centrifugal 5min of 3000g collects cell.Again wash one time with sterilized water, centrifugal collecting cell.With the sterilized water re-suspended cell of 1mL.Cell is transferred in 1.5mL centrifuge tube, the quick centrifugal collecting cell of 13000g30s, abandon supernatant.With the resuspended above-mentioned cell of 1mL sterilized water, take 250 μ L cell (> 10⁸Individual cell) add in 1.5mL centrifuge tube.Being sequentially added into 50% (w/v) PEG3350,36 μ L1mol/LLiAc in this clean 1.5mL centrifuge tube in advance, the 50 μ L2g/L salmon sperm dnas boiled, 1 μ gFBAHYG knocks out box, mixing.By cell in centrifuge tube biased sample mixing, be placed in 42 DEG C of thermal shock 40min.Quick centrifugal collecting cell, all coats screening flat board.Cultivate 3-4 days for 30 DEG C.

Positive recombinant connects section's 10mlYEPD fluid medium (containing hygromycin 250ng/ μ l).After embodiment 3 extracts genomic DNA, HYG-RF-p1 and HYG-RF-p2 is adopted to carry out PCR qualification.PCR system (25 μ l): 10 × Speedbuffer (Dalian TakaRa) 2.5 μ l, dNTPs (10mmol/l) 0.5 μ l, forward primer (10 μm of ol/l) 1.0 μ l, downstream primer (10 μm of ol/l) 1.0 μ l, SpeedSTAR^TMHSDNA polymerase (amplification rate is fast, and 1kb/10s, purchased from Dalian TakaRa company) 0.25 μ l, genomic DNA template (100ng/ μ l) 1.0 μ l, ddH₂O adds to 25 μ l.Reaction condition: 98 DEG C of 1min, 98 DEG C of 10s, 65 DEG C of 60s, 35 circulations, 72 DEG C of 10min, 4 DEG C are terminated reaction.PCR primer agarose gel analysis result shows, all recons all contain external source HYG gene (result does not show).

Except directly utilizing hygromycin resistance phenotype to except determining Lipomyces starkeyi FBA promoter and can starting hygromycin gene expression in Fructus Citri tangerinae woods saccharomyces oleaginosus ATCC44833, owing to the C-end of hygromycin gene expression product carries 6 × HisTag, it is also with anti-HisTag antibody and is analyzed the expression determining gene by Westernblot.Westernblot operates reference example 10.The expression of hygromycin gene (result do not show) all be can be observed.

Embodiment 12: utilize FBAHYG expression cassette to carry out the conversion of mamillary trichosporon (Trichosporoncapitatum) ATCC36553 yeast

1.FBAHYG knocks out the preparation of box

Mamillary trichosporon TCC36553 (purchased from American standard biological product collecting center (ATCC)).Utilizing pFBA-p1 and FBAt-p2 for primer, with T-FBAHYG for template, amplification obtains FBAHYG and knocks out box.After utilizing DNA to reclaim kits PCR primer, the DNA fragmentation concentration after test purification is 500ng/ μ l, totally 50 μ l, and-20 DEG C save backup.

2. prepared by mamillary trichosporon ATCC36553 competent cell

The preparation of mamillary trichosporon ATCC36553 competent cell: (bacterial strain chooses colony inoculation 10mlYEPD culture medium (glucose 20.0g/l to mamillary trichosporon ATCC36553, yeast extract 10.0g/l, peptone 20.0g/l, pH6.0), 30 DEG C, 200rpm, cultivates 20h；Culture 1: the 50 ratio fresh YEPD culture medium of switching, 100ml (500ml conical flask, liquid amount 100ml), 30 DEG C, 200rpm, cultivates 6-9h, OD value and reaches 0.6-1.2；Culture ice bath 10-30min, 4 DEG C, 4000rpm is centrifuged 5min, abandons supernatant；0 DEG C of aseptic Milli-Q washes 1 time；0 DEG C of 1mol/l sorbitol washes 2 times；Ice bath, standby.Take 50 μ l mamillary trichosporon ATCC36553 competent cells, add FBAHYG expression cassette 10 μ l (altogether 5 μ g), move in the electric shock cup being cooled to 0 DEG C in advance after mixing, parameter: voltage 0.8-2.5 kilovolt, resistance 200 Ω, electric capacity 25 μ F, time 4-10ms；1mlYEPD is added immediately, 30 DEG C of incubation 1-2h after electric shock；Coating YEPD flat board (containing hygromycin 250ng/ μ l), cultivates more than 5 days for 30 DEG C.

3. the qualification of mamillary trichosporon transformant

Positive recombinant inoculation 10mlYEPD fluid medium (containing hygromycin 250ng/ μ l).After embodiment 3 extracts genomic DNA, HYG-RF-p1 and HYG-RF-p2 is adopted to carry out PCR qualification.PCR system (25 μ l): 10 × Speedbuffer (Dalian TakaRa) 2.5 μ l, dNTPs (10mmol/l) 0.5 μ l, forward primer (10 μm of ol/l) 1.0 μ l, downstream primer (10 μm of ol/l) 1.0 μ l, SpeedSTAR^TMHSDNA polymerase (amplification rate is fast, and 1kb/10s, purchased from Dalian TakaRa company) 0.25 μ l, genomic DNA template (100ng/ μ l) 1.0 μ l, ddH₂O adds to 50 μ l.Reaction condition: 98 DEG C of 1min, 98 DEG C of 10s, 65 DEG C of 60s, 35 circulations, 72 DEG C of 10min, 4 DEG C are terminated reaction.Result shows, all recons all contain external source HYG gene (result does not show).

4. the expression analysis Westernblot of hygromycin gene in mamillary trichosporon transformant

Except directly utilizing hygromycin resistance phenotype to except determining Lipomyces starkeyi FBA promoter and can starting hygromycin gene expression in mamillary trichosporon ATCC36553, owing to the C-end of hygromycin gene expression product carries 6 × HisTag, it is also with anti-HisTag antibody and is analyzed the expression determining gene by Westernblot.Westernblot operates reference example 10.The expression of hygromycin gene (result do not show) all be can be observed.

Embodiment 13: utilize FBABLE expression cassette to carry out the conversion of oil-producing trichosporon (Trichosporonoleaginosus) ATCC20509 yeast

1.FBABLE knocks out the preparation of box

Oil-producing trichosporon ATCC20509 (purchased from American standard biological product collecting center (ATCC)).Utilizing pFBA-p1 and FBAt-p2 for primer, with T-FBABLE for template, amplification obtains FBABLE and knocks out box.After utilizing DNA to reclaim kits PCR primer, the DNA fragmentation concentration after test purification is 500ng/ μ l, totally 50 μ l, and-20 DEG C save backup.

2. prepared by oil-producing trichosporon ATCC20509 competent cell

The preparation of oil-producing trichosporon ATCC20509 competent cell: oil-producing trichosporon ATCC20509 bacterial strain chooses colony inoculation 10mlYEPD culture medium (glucose 20.0g/l, yeast extract 10.0g/l, peptone 20.0g/l, pH6.0), 30 DEG C, 200rpm, cultivates 20h；Culture 1: the 50 ratio fresh YEPD culture medium of switching, 100ml (500ml conical flask, liquid amount 100ml), 30 DEG C, 200rpm, cultivates 6-9h, OD value and reaches 0.6-1.2；Culture ice bath 10-30min, 4 DEG C, 4000rpm is centrifuged 5min, abandons supernatant；0 DEG C of aseptic Milli-Q washes 1 time；0 DEG C of 1mol/l sorbitol washes 2 times；Ice bath, standby.Take 50 μ l oil-producing trichosporon ATCC20509 competent cells, add FBABLE expression cassette 10 μ l (altogether 5 μ g), move in the electric shock cup being cooled to 0 DEG C in advance after mixing, parameter: voltage 0.8-2.5 kilovolt, resistance 200 Ω, electric capacity 25 μ F, time 4-10ms；1mlYEPD is added immediately, 30 DEG C of incubation 1-2h after electric shock；Coating YEPD flat board (containing bleomycin 200ng/ μ l), cultivates more than 5 days for 30 DEG C.

3. the qualification of transformant

Positive recombinant inoculation 10mlYEPD fluid medium (containing bleomycin 900ng/ μ l).After embodiment 3 extracts genomic DNA, BLE-RF-p1 and BLE-RF-p2 is adopted to carry out PCR qualification.PCR system (25 μ l): 10 × Speedbuffer (Dalian TakaRa) 2.5 μ l, dNTPs (10mmol/l) 0.5 μ l, forward primer (10 μm of ol/l) 1.0 μ l, downstream primer (10 μm of ol/l) 1.0 μ l, SpeedSTAR^TMHSDNA polymerase (amplification rate is fast, and 1kb/10s, purchased from Dalian TakaRa company) 0.25 μ l, genomic DNA template (100ng/ μ l) 1.0 μ l, ddH₂O adds to 25 μ l.Reaction condition: 98 DEG C of 1min, 98 DEG C of 10s, 65 DEG C of 60s, 35 circulations, 72 DEG C of 10min, 4 DEG C are terminated reaction.Result shows, all recons all contain external source BLE gene.Result is as shown in Figure 9.

Embodiment 14: fatty acid hydroxylase and the expression in trichosporon cutaneum (Trichosporoncutaneum) CGMCC2.571 of the geneticin resistant albumen

Castor oil acid (12-hydroxy-octadeca-cis-9-enoicacid:C18:1-OH) is the very valuable essential industry raw material of a class.Derive from Clavicipitaceae (Clavicepspurpurea) the oleate hydroxylase gene (Genbank:EU661785) expression in microorganism and can provide a new approach for the supply of castor oil acid.Utilize at this Geneticin for selection markers, start the expression of CpFAH gene with FBA promoter, to realize the purpose of synthetic castor oil acid in trichosporon cutaneum.

1. the agrobacterium strains containing FBAKAN-CpFAH carrier converts trichosporon cutaneum CGMCC2.571

Take the trichosporon cutaneum CGMCC2.571 yeast (purchased from China General Microbiological culture presevation administrative center CGMCC) after a ring activation, be connected in 5mlYEPD, 25 DEG C, 200r/min incubated overnight.After washing one time with sterilized water, regulate to OD₆₀₀=1-2, standby.After the activation of the Agrobacterium containing FBAKAN-CpFAH carrier described in embodiment 9, it is connected in the 5ml LB liquid containing kanamycin (100ng/ μ l) and rifampicin (80ng/ μ l), 250 DEG C, 200r/min overnight incubation.Wash one time with sterilized water, regulate to OD₆₀₀=1-3, standby.

nullTake above-mentioned yeast and each 600 μ l of agrobacterium strains diluent，Mixing，Directly drip in induction flat board (5mmol/l glucose，0.5% glycerol，1.45g/l potassium dihydrogen phosphate，2.05g/l dipotassium hydrogen phosphate，0.15g/l sodium chloride，0.5g/l Magnesium sulfate heptahydrate，66mg/l calcium chloride dihydrate，2.48g/l green-vitriol，0.5g/l ammonium sulfate，40mmol/lMES (2-(N-morpholine) ethyl sulfonic acid)，2% agar powder，200 μm of ol/L acetosyringones) upper (Bundock，P.，denDulk-Ras，A.，Beijersbergen，A.，etal.EMBOJ.，1995，14，3206-3214.)，24-25℃，Cultivate 4 days.With the sterilized water of about 10ml, mixing lawn is washed down, 3000r/min is centrifuged 5min, discard upper strata and mainly contain the liquid of Agrobacterium, remaining cell is resuspended with 800 μ l sterilized water, take 50-200 μ l and coat in screening flat board (YEPD containing 50ng/ μ L Geneticin G418 and 300 μ g/mL cephalosporins), cultivate in 25 DEG C, until transformant occurs.

2. the PCR of trichosporon cutaneum CGMCC2.571 transformant identifies

6 trichosporon cutaneum CGMCC2.571 transformants of random picking access in the YEPD liquid containing 50ng/ μ L Geneticin cultivates, method described in reference example 8 extracts genomic DNA, adopt FBAKAN-RF-P1 and FBAKAN-RF-P2, CpFAH-RF-p1 and CpFAH-RF-p2 is primer, carries out PCR qualification.Result shows, external source KAN and CpFAH fragment are all successfully integrated in trichosporon cutaneum genome (result does not show).

3. trichosporon cutaneum CGMCC2.571 transformant produces the fermenting experiment of castor oil acid

Taking after correct transformant activates 2-3 days on flat board, the basically identical single bacterium colony of picking size is connected in 5mLYEPD.After cultivating 24h, it is connected in the YEPD culture medium of 50mL with the inoculum concentration of 1: 50, as secondary seed.After secondary seed cultivates 24h, take in the 5mL YEPD fermentation medium adding 45mL.In sweat, every 12h regulates a pH.Terminate after cultivating 120h.Taking 40mL zymocyte liquid and be placed in 50mL round bottom centrifuge tube, the centrifugal 5min of 8000rpm room temperature collects thalline, and with deionized water wash 2 times, 105 DEG C are dried 24h to constant weight.Cool down in exsiccator after taking-up, then record is weighed, add the ratio of 6mL4mol/L hydrochloric acid in 1g dry mycelium after weighing, often pipe adds 4mL4mol/L hydrochloric acid, 78 DEG C of water-bath digestion 1h, adds the chloroform/methanol (1: 1 of 2 times of volumes after cooling, v/v), fully vibrate mixing, centrifugal after extracting 1h, take chloroform layer and put in a new centrifuge tube.Aqueous phase extracts once again with equal-volume chloroform, fully centrifugal after vibration, takes chloroform layer and puts into merging in above-mentioned new centrifuge tube, and adds equal-volume 0.1% sodium chloride solution, centrifugal after vibration mixing.With syringe lower floor's organic facies carefully extracted and inject in preprepared glass funnel that (degreasing cotton filled in advance by funnel, and add appropriate anhydrous sodium sulfate), treat that in funnel, organic solution flows in the glass oil bottle of lower section substantially, add appropriate chloroform and rinse funnel 4 times, flow in the oil bottle of lower section in the lump, extract and have the chloroform of oils and fats to adopt Rotary Evaporators to carry out Grease Collection, the oil bottle that have collected oils and fats is put into oven for drying 24h.

Carry out Grease Collection, the oil bottle that have collected oils and fats is put into oven for drying 12h.

Bacterium oil is carried out esterification: weigh the oils and fats to be measured of 70.0mg, add the KOH/CH of 5%₃OH solution 0.5mL, is heated to reflux 50min, is subsequently adding BF₃Methanol solution (V_{BF3 diethyl ether solution}∶V_CH3OH=4: 10) 0.7mL, continues backflow 10min.Adding 1mL deionized water and 0.7mL normal hexane after cooling, sucking-off organic facies after mixing, for gas chromatographic analysis after deionized water wash twice.

4. trichosporon cutaneum CGMCC2.571 transformant produces the measurement of castor oil acid

Transesterification sample is dissolved in normal hexane, adopt document (Meesapyodsuk, D., andQiu, X.PlantPhysiol., 2008,147,1325-1333.) in method detect, standard substance are methyl ricinolcic acid (CAS:141-24-2), and negative control is the transesterification product of oils and fats of wild type trichosporon cutaneum.Result shows, proceeds in the trichosporon cutaneum CGMCC2.571 of CpFAH gene and truly has castor oil acid to produce, and content is 190 μ g/ml, and total amount accounts for more than the 60% of overall free fatty acid content.

5. the expression analysis Westernblot of oleate hydroxylase gene in trichosporon cutaneum CGMCC2.571 transformant

Except determining Lipomyces starkeyi FBA promoter either directly through castor oil acid production phenotype and can starting the expression in trichosporon cutaneum CGMCC2.571 of the oleate hydroxylase gene, owing to the C-end of oleate hydroxylase gene expression product carries 6 × HisTag, it is also with the expression by immunoblotting assay oleate hydroxylase gene of the anti-HisTag antibody.Westernblot operates reference example 10.The expression of oleate hydroxylase gene (result do not show) all be can be observed.

Embodiment 15: utilize FBABLE expression cassette to carry out the conversion of Trichosporon fermentans (Trichosporonfermentans) ATCC10675 yeast

The expression in Trichosporon fermentans ATCC10675 yeast of the 1.FBABLE gene

Trichosporon fermentans ATCC10675 purchased from American standard biological product collecting center (ATCC).Take the Trichosporon fermentans ATCC10675 yeast after a ring activation, be connected in 5mlYEPD, 30 DEG C, 200r/min incubated overnight.After washing one time with sterilized water, regulate to OD₆₀₀=0.1-1.9, standby.After Agrobacterium activation, it is connected in the 5ml LB liquid containing kanamycin (50ng/ μ l) and rifampicin (50ng/ μ l), 30 DEG C, 200r/min overnight incubation.Wash one time with sterilized water, regulate to OD₆₀₀=0.1-1.9, standby.

nullTake above-mentioned yeast and each 600 μ l of Agrobacterium diluent，Mixing，Directly drip in induction flat board (5mmol/l glucose，0.5% glycerol，1.45g/l potassium dihydrogen phosphate，2.05g/l dipotassium hydrogen phosphate，0.15g/l sodium chloride，0.5g/l Magnesium sulfate heptahydrate，66mg/l calcium chloride dihydrate，2.48g/l green-vitriol，0.5g/l ammonium sulfate，40mmol/lMES (2-(N-morpholine) ethyl sulfonic acid)，2% agar powder，200 μm of ol/L acetosyringones) upper (Bundock，P.，denDulk-Ras，A.，Beijersbergen，A.，etal.EMBOJ.，1995，14，3206-3214.)，24-25℃，Cultivate 4 days.With the sterilized water of about 10ml, mixing lawn is washed down, 3000r/min is centrifuged 5min, discard upper strata and mainly contain the liquid of Agrobacterium, remaining cell is resuspended with 800 μ l sterilized water, take 50-200 μ l and coat in screening flat board (YEPD containing 50ng/ μ L bleomycin and 300 μ g/mL cephalosporins), cultivate in 30 DEG C, until transformant occurs.

2. the PCR of Trichosporon fermentans ATCC10675 bleomycin transformant identifies

6 Trichosporon fermentans ATCC10675 bleomycin transformants of random picking access in the YEPD liquid containing 50ng/ μ L bleomycin cultivates, method described in reference example 3 extracts Trichosporon fermentans ATCC10675 genomic DNA, adopting BLE-RF-p1 and BLE-RF-p2 is primer, carries out PCR qualification.PCR system (50 μ l): 5 × Primebuffer (Dalian TakaRa) 10.0 μ l, dNTPs (2.5mmol/l) 4.0 μ l, forward primer (10 μm of ol/l) 2.0 μ l, downstream primer (10 μm of ol/l) 2.0 μ l, PrimeSTAR^TMHSDNA polymerase (Dalian TakaRa) 1.0 μ l, genomic DNA (20ng/ μ l) 1 μ l, ddH₂O adds to 50 μ l.Reaction condition: 95 DEG C of 3min, 98 DEG C of 8s, 49 DEG C of 15s, 72 DEG C of 1min, 35 circulations, 72 DEG C of 10min, 4 DEG C are terminated reaction.PCR primer is through 1% (mass/volume concentration) agarose gel electrophoresis analysis.Result shows visible, and external source BLE fragment is successfully integrated in Trichosporon fermentans ATCC10675 genome (result does not show).

3. the expression analysis Westernblot of bleomycin resistance gene in Trichosporon fermentans ATCC10675 bleomycin resistance transformant

Except directly utilizing bleomycin resistance phenotype to except determining Lipomyces starkeyi FBA promoter and can starting the expression in Trichosporon fermentans ATCC10675 of the bleomycin resistance gene, owing to the C-end of bleomycin resistance gene expression product carries 6 × HisTag, it is also with anti-HisTag antibody and is analyzed the expression determining gene by Westernblot.Westernblot operates reference example 10.The expression of hygromycin gene (result do not show) all be can be observed.

Embodiment 16: utilize FBAHYG expression cassette to carry out the conversion of gonimoblast spore yeast (Trichosporonporosum) ATCC90770 yeast

The expression in gonimoblast spore yeast ATCC90770 yeast of the 1.FBAHYG gene

Gonimoblast spore yeast ATCC90770 purchased from American standard biological product collecting center (ATCC).Take the gonimoblast spore yeast ATCC90770 yeast after a ring activation, be connected in 5mlYEPD, 30 DEG C, 200r/min incubated overnight.After washing one time with sterilized water, regulate to OD₆₀₀=0.1-0.8, standby.After Agrobacterium activation, it is connected in the 5ml LB liquid containing kanamycin (50ng/ μ l) and rifampicin (50ng/ μ l), 30 DEG C, 200r/min overnight incubation.Wash one time with sterilized water, regulate to OD₆₀₀=0.1-1.6, standby.

nullTake above-mentioned yeast and each 400 μ l of Agrobacterium diluent，Mixing，Directly drip in induction flat board (5mmol/l glucose，0.5% glycerol，1.45g/l potassium dihydrogen phosphate，2.05g/l dipotassium hydrogen phosphate，0.15g/l sodium chloride，0.5g/l Magnesium sulfate heptahydrate，66mg/l calcium chloride dihydrate，2.48g/l green-vitriol，0.5g/l ammonium sulfate，40mmol/lMES (2-(N-morpholine) ethyl sulfonic acid)，2% agar powder，200 μm of ol/L acetosyringones) upper (Bundock，P.，denDulk-Ras，A.，Beijersbergen，A.，etal.EMBOJ.，1995，14，3206-3214.)，24-25℃，Cultivate 4 days.With the sterilized water of about 10ml, mixing lawn is washed down, 3000r/min is centrifuged 5min, discard upper strata and mainly contain the liquid of Agrobacterium, remaining cell is resuspended with 800 μ l sterilized water, take 50-200 μ l and coat that screening flat board (YEPD containing 50ng/ μ L hygromycin and 300 μ g/mL cephalosporins) is upper cultivates in 30 DEG C, until transformant appearance.

2. the PCR of the hygromycin resistant transformed son of gonimoblast spore yeast ATCC90770 identifies

6 gonimoblast spore yeast ATCC90770 hygromycin transformants of random picking access in the YEPD liquid containing 50ng/ μ L hygromycin cultivates, method described in reference example 3 extracts gonimoblast spore yeast ATCC90770 genomic DNA, adopting HYG-RF-p and HYG-RF-p2 is primer, carries out PCR qualification.PCR system (50 μ l): 5 × Primebuffer (Dalian TakaRa) 10.0 μ l, dNTPs (2.5mmol/l) 4.0 μ l, forward primer (10 μm of ol/l) 2.0 μ l, downstream primer (10 μm of ol/l) 2.0 μ l, PrimeSTAR^TMHSDNA polymerase (Dalian TakaRa) 1.0 μ l, genomic DNA (20ng/ μ l) 1 μ l, ddH₂O adds to 50 μ l.Reaction condition: 95 DEG C of 3min, 98 DEG C of 8s, 49 DEG C of 15s, 72 DEG C of 1min, 35 circulations, 72 DEG C of 10min, 4 DEG C are terminated reaction.PCR primer is through 1% (mass/volume concentration) agarose gel electrophoresis analysis.Result shows visible, and external source HYG fragment is successfully integrated in gonimoblast spore yeast ATCC90770 genome.

3. the expression analysis Westernblot of hygromycin in the hygromycin resistant transformed son of gonimoblast spore yeast ATCC90770

Except directly utilizing hygromycin resistance phenotype to except determining Lipomyces starkeyi FBA promoter and can starting hygromycin gene expression in mamillary trichosporon ATCC36553, owing to the C-end of hygromycin gene expression product carries 6 × HisTag, it is also with anti-HisTag antibody and is analyzed the expression determining gene by Westernblot.Westernblot operates reference example 10.The expression of hygromycin gene (result do not show) all be can be observed.

Embodiment 17: utilize FBAHYG expression cassette to carry out the conversion of Bai Shi trichosporon bacteria (Trichosporonbeigelii) ATCCMYA-911

Bai Shi trichosporon bacteria ATCCMYA-911 (purchased from American standard biological product collecting center (ATCC)) is by inclined plane inoculating to 50mlYEPD fluid medium, 24h is cultivated in 30 DEG C of shaking tables, with the volume ratio of 1: 50, bacterium solution is transferred in 100mlYEPD fluid medium respectively again, cultivates 12h in 30 DEG C of shaking tables and reach exponential phase.The centrifugal 5min of 3000g collects thalline, and re-suspended cell is in the sterilized water of 25mL.20 DEG C, the centrifugal 5min of 3000g collects cell.Again wash one time with sterilized water, centrifugal collecting cell.With the sterilized water re-suspended cell of 1mL.Cell is transferred in 1.5mL centrifuge tube, the quick centrifugal collecting cell of 13000g30s, abandon supernatant.With the resuspended above-mentioned cell of 1mL sterilized water, take 250 μ L cell (> 10⁸Individual cell) add in 1.5mL centrifuge tube.Being sequentially added into 50% (w/v) PEG3350,36 μ L1mol/LLiAc in this clean 1.5mL centrifuge tube in advance, the 50 μ L2g/L salmon sperm dnas boiled, 1 μ gFBAHYG knocks out box, mixing.By cell in centrifuge tube biased sample mixing, be placed in 42 DEG C of thermal shock 40min.Quick centrifugal collecting cell, all coats screening flat board.Cultivate 3-4 days for 30 DEG C.

Positive recombinant inoculation 10mlYEPD fluid medium (containing hygromycin 250ng/ μ l).After embodiment 3 extracts genomic DNA, HYG-RF-p1 and HYG-RF-p2 is adopted to carry out PCR qualification.PCR system (25 μ l): 10 × Speedbuffer (Dalian TakaRa) 2.5 μ l, dNTPs (10mmol/l) 0.5 μ l, forward primer (10 μm of ol/l) 1.0 μ l, downstream primer (10 μm of ol/l) 1.0 μ l, SpeedSTAR^TMHSDNA polymerase (amplification rate is fast, and 1kb/10s, purchased from Dalian TakaRa company) 0.25 μ l, genomic DNA template (100ng/ μ l) 1.0 μ l, ddH₂O adds to 50 μ l.Reaction condition: 98 DEG C of 1min, 98 DEG C of 10s, 65 DEG C of 60s, 35 circulations, 72 DEG C of 10min, 4 DEG C are terminated reaction.Result shows, all recons all contain external source HYG gene.

Except directly utilizing hygromycin resistance phenotype to except determining Lipomyces starkeyi FBA promoter and can starting hygromycin gene expression in Bai Shi trichosporon bacteria ATCCMYA-911, owing to the C-end of hygromycin gene expression product carries 6 × HisTag, it is also with anti-HisTag antibody and is analyzed the expression determining gene by Westernblot.Westernblot operates reference example 10.The expression of hygromycin gene (result do not show) all be can be observed.

Claims (10)

1. fructose-6-bisphosphate aldolase promoter, its nucleotide sequence is such as shown in SEQIDNO:1.

2. a DNA expression cassette, it contains the nucleotide sequence of the ester of Harden Young aldolase promoter shown in SEQIDNO:1.

3. the expression cassette described in claim 2, its possibly together with the nucleotide sequence shown in SEQIDNO:2 as terminator, wherein the sequence shown in SEQIDNO:1 is positioned at the upstream of the sequence shown in SEQIDNO:2, for the open reading frame of coding genes of interest between SEQIDNO:1 and SEQIDNO:2.

4. the DNA expression cassette described in claim 3, it is characterised in that: the cDNA sequence of the open reading frame of described coding genes of interest has the nucleotide sequence as shown in SEQIDNO:4.

5. the recombinant vector of the DNA expression cassette that a kind comprises according to any one of claim 2-4.

6. the recombinant vector described in claim 5, it is characterised in that: described carrier is sequestered or integrating vector.

7. the recombinant vector described in claim 6, wherein said integrating vector is agriculture bacillus mediated binary expression vector, such as PZPK or pZP2000, or for carrying the homologous recombination vector of target gene flank 1500-4000 base homologous recombination arm, described homologous recombination vector skeleton or described episomal vector selected from E. coli cloning vector or yeast shuttle vectors such as pMD18-T, pUC18, pYES2c/t or pYX212.

8. comprise the host cell of recombinant vector according to any one of claim 5-7.

9. the host cell described in claim 8, described host cell is Bacillus coli cells or yeast cells.

10., for an expression system for oleaginous yeast genetic expression, described expression system comprises:

(1) improved carrier expressed in (Lipomyces) or Trichosporon (Trichosporon) bacterial strain can be belonged at saccharomyces oleaginosus, described improved carrier is passed through to belong at saccharomyces oleaginosus or insert the promoter sequence shown in SEQIDNO:1 and the acquisition of the terminator sequence construct shown in SEQIDNO:2 in integrant expression or the free plasmid expressed in Trichosporon, wherein the promoter sequence shown in SEQIDNO:1 is positioned at the upstream of the terminator sequence shown in SEQIDNO:2, sequence shown in SEQIDNO:1 and be multiple clone site between the sequence shown in SEQIDNO:2, and described carrier also comprises selected marker；

(2) genes of interest open reading frame sequence, it can be inserted in the improved carrier described in (1) operably, and make described genes of interest be connected with meeting reading frame with the promoter in the improved carrier described in (1) and terminator, and

(3) saccharomyces oleaginosus belongs to or Trichosporon bacterial strain.