CN106318943B - Galactokinase enzyme promoters and terminator and its application - Google Patents

Abstract

The present invention passes through the red winter spore ferment galactokinase gene group DNA upstream and downstream sequence of amplification circle, carry out biological information analysis and functional verification, acquisition can be widely used for Rhodosporidium in rhodotorula (Rhodosoporidium), lock throws saccharomyces (Sporidiobolus), gene expression in Sporobolomyces (Sporobolomyces) and Rhodotorula (Rhodotorula), genetic engineering procedure and strain improvement promoter and terminator, nucleotide sequence is respectively SEQ ID NO:1 and SEQ ID NO:2.The invention further relates to DNA expression cassettes or recombinant vector containing these elements, and construct Rhodosporidium using related elements, lock the method for throwing saccharomyces and Rhodotorula engineering strain and corresponding bacterial strain.

Description

Galactokinase enzyme promoters and terminator and its application

Technical field

The invention belongs to gene engineering technology fields, and in particular to circle rhodosporidium toruloides (Rhodosporidium Toruloides promoter terminator) and application thereof, including method for transformation necessary to construction method of gene engineering strain etc..

Background technique

Microorganism is that one of widest species are distributed in nature, has brilliant biosynthesis ability, can almost close At organic chemicals all on the earth.Compared with multicellular organism, the metabolic pathway of microorganism is although relatively easy, but it is changed The production for closing object efficiently, fast, has the characteristics that reaction condition is mild, controllability is strong, is easy to be mass produced, can be used as one Excellent cell factory.

A part of microorganism can be more than under given conditions (such as nitrogen source shortage) that its cell is dry in storage intracellular in nature 20% grease is weighed, wherein based on triglycerides, the microorganism with this phenotype is known as oleaginous microorganism, including bacterium, Yeast, mould, algae etc. (Ratledge, C.and Wynn, J.P.Adv Appl Microbiol, 2002,51,1-51.).Benefit With microorganism conversion biomass resource produce grease, can develop into do not depend on substantially arable land, can continuous production, reduce agricultural dirt Dye, the new technology of comprehensive utilization of resources are the new production ways of fossil resources substitute (the Zhao Zongbao China to form chemicals Bioengineering magazine, 2005,25,8-11.).As the natural production bacterial strain or environmental improvement application bacterial strain of a certain chemicals, Specific production performance is often and non-optimized.How to optimize or change the metabolism network and expression regulation network of industrial strain, It is that current field of biotechnology genetic engineering changes to improve the accumulating rate of biobased products or the quality of oriented control target product The hot and difficult issue made.Although for some conventional yeasts genetic engineering transformation have been relatively mature (Alper H, Stephanopoulos G.Nat Rev Microbiol, 2009,7,715-723.), but for these unconventional oil-producing ferment Still in its infancy, many unconventional oleaginous yeasts do not have suitable genetic manipulation platform to female genetic manipulation.Exploitation is suitable Genetic manipulation method, it is great for the application value of these unconventional microorganisms.

Circle rhodosporidium toruloides belong to Basidiomycota heterothallism type fungi, are a kind of particularly important micro- lifes in fermentation industry Object is that raw material produces important biobased products: microbial oil, grease intracellular using the hexose and pentose that are derived from biomass Up to 60% or more (Ratledge C, Wynn J P.Adv.Appl.Microbiol.2002,51:1-51 of dry cell weight；Li Y,Zhao Z,Bai F.Enzyme Microb.Technol.2007,41(3):312-317)；Industrial enzymes or pharmaceutical synthesis are used Enzyme such as phosphodiesterase, phenylalanine lyase (Hodgins D S.J Biol.Chem.1971,246 (9): 2977-2985； Gilbert H J, Clarke I N, Gibson R K, et al.J Bacteriol.1985,161 (1): 314-320), D ammonia Base acid oxidase (Gadda G, Negri A, Pilone M S.J Biol.Chem.1994,269 (27): 17809-17814； Liao G J, Lee Y J, Lee Y H, et al.Biotechnol.Appl.Biochem.1998,27 (Pt 1): 55-61) etc. And beta carotene and exocellular polysaccharide；And there is wide application in sewage treatment and bio-pharmaceuticals.The experimental results showed that The bacterium can be simultaneously substrate using pentose and hexose, and good stress resistance can be directly using corn stover acid hydrolysis liquid as carbon source product , it can be achieved that biomass is to the Efficient Conversions of biobased products, (Li Yonghong, Liu Bo, Sun Yan wait Chinese biological engineering miscellaneous to tired grease Will, 2005,25 (12): 39-44).The research of R.toruloides functional gene mainly passes through gene cloning, heterogenous expression at present (Gilbert H J, Clarke I N, Gibson R K, et al.J is carried out with saccharomyces cerevisiae function reasonableness Bacteriol.1985,161(1):314-320；Liao G J,Lee Y J,Lee Y H,et al.Biotechnol.Appl.Biochem.1998,27(Pt 1):55-61).But it to be carried out from molecular level R.toruloides oil and fat accumulation mechanism, genetic development, growth metabolism and the research of bacterial strain genetic modification, it is necessary to have corresponding something lost Pass operating system.However for R.toruloides good for widely distributed, prospects for commercial application, due to its special sort The shortage of status and biochemical characteristic and genetic operating system, so that its genetic improvement and Advances in research on molecular mechanism are slow, mesh Preceding effective genetic operating system is based on its own glycerol 3-phosphate kinase promoter pPGK and glyceraldehyde-3-phosphate dehydrogenation Agrobacterium mediation converted system (Lin XP, Wang YN, Zhang SF, the et al.Fems Yeast of enzyme GPD promoter Res.2014,14:547–555).But the constitutive promoter used can not a certain genetic transcription of selective regulation, be not suitable for thin The overexpression of cytotoxic genes；Meanwhile metabolic engineering is also required to more promoters and termination subcomponent is available, to realize The accuracy controlling of a certain each gene expression dose of metabolic pathway.

Inducible promoter is specifically physically or chemically under the stimulation of signal, the starting of regulation downstream gene transcription and pass It closes, it is particularly important to the genetic manipulation of some cytotoxic genes.Galactokinase Gal1, stringent suppression of the transcription by glucose The induced activation of system and galactolipin, raffinose etc..It is highly suitable for the accurate expression regulation of target gene.Although once there is numerous grind The person of studying carefully separate saccharomyces cerevisiae (Saccharomyces cerevisiae) or other ascus yeast galactokinase enzyme promoters or Other galactolipin evoked promoters for itself genetic engineering operation (Liu Weifeng, Gao Dong, Wang Zunong's fungus system, 1998, 17(3),256-261.；CN201410143885.0；CN201180008591.1；Schultz LD,Hofmann KJ,Mylin LM,et al.Gene.1987,61(2):123-133.；Choi ES1,Sohn JH,Rhee SK.Appl Microbiol Biotechnol.1994,42(4):587-594.；Li J,Wang S,VanDusen WJ,et al.Biotechnol Bioeng.2000,70 (2): 187-196.), but have no such promoter for Rhodosporidium (Rhodosoporidium), lock throws saccharomyces (Sporidiobolus), Sporobolomyces (Sporobolomyces) and red ferment Mother belongs to the report of the genetic engineering operation of gene expression, genetic engineering procedure and strain improvement in (Rhodotorula).Meanwhile It is known to the skilled person in the art that " different microorganisms exists big in terms of genetic background, gene expression pattern, physiological and biochemical property Difference, even if being all yeast, there is also very big differences between different kinds, for example, belong to the saccharomyces cerevisiae of Ascomycota, Pichia pastoris, Ye Shi solve rouge yeast, it is necessary to construct its genetic system respectively, select autogenous promoter ".However, promoter It is essential for genetic operating system.Therefore, separation can start the half of reporter gene expression in these rhodotorulas Galactokinase promoter becomes the focus studied at present.

Terminator sequence is to give the DNA sequence dna of RNA polymerase transcription stop signals, while also determining the stabilization of mRNA The release of property, transcriptional efficiency and mRNA from transcription complex.It is commercialized the synthetic biology document of Yeast expression carrier and report In, the terminator of more options cance high-expression gene is as transcription terminator element.

Summary of the invention

In view of above-mentioned prior art bottleneck, the main object of the present invention, which is to provide, can be universally used in Rhodosporidium (Rhodosoporidium), lock throws saccharomyces (Sporidiobolus), Sporobolomyces (Sporobolomyces) and red ferment Mother belong to (Rhodotorula) in gene expression, genetic engineering procedure and strain improvement middle exogenous gene expression promoter and Terminator, and the method that these rhodotorula bacterial strains are improved using suitable transformation technology.

To achieve the purpose of the present invention, the present invention is analyzed by the genome sequence to circle rhodosporidium toruloides, is obtained Galactokinase enzyme promoters (GAL1p) sequence of galactolipin induction is responded, and further passes through round pcr from circle rhodosporidium toruloides It has been successfully separated the DNA fragmentation comprising effective promoter in chromosomal DNA, the red winter spore of circle will be contained using suitable method for transformation The exogenous dna fragment of yeast galactokinase enzyme promoters (GAL1p) is directed respectively into Rhodosporidium, lock throws saccharomyces, throws spore In saccharomyces and Rhodotorula, it is successfully realized the expression of foreign gene, completes the present invention.

The present invention, which has been successfully separated, to throw saccharomyces, Sporobolomyces and Rhodotorula ferment in Rhodosporidium, lock Start circle rhodosporidium toruloides galactokinase enzyme promoters (GAL1p) promoter of reporter gene expression in mother, and constructs its table Up to carrier.

Specifically, the present invention includes that following technical proposals (A) arrives (H):

(A) the present invention relates to one kind, and there is Rhodosporidium, lock to throw saccharomyces, Sporobolomyces and Rhodotorula transcription The DNA fragmentation of promoter activity, the DNA fragmentation:

(1) there is the full sequence of the DNA sequence dna as shown in SEQ ID NO:1 or comprising the DNA sequence dna from 3 '-ends Partial sequence within 500bp,

(2) having can rise within 500bp with the whole of the sequence as shown in SEQ ID NO:1 or its DNA sequence dna 3 '-end Partial sequence the hybridizes and holding active sequence of transcripting promoter, or

(3) to deoxynucleotide sequence shown in SEQ ID NO:1 carry out one or or 50 bases within substitution, lack It loses, be inserted into or add obtained, with 70% or more homology and have promoter living with sequence shown in SEQ ID NO:1 The sequence of property.

(B) a kind of DNA fragmentation from circle rhodosporidium toruloides, the DNA fragmentation can be used as terminator, and: (1) have The whole of the DNA sequence dna as shown in SEQ ID NO:2 or partial sequence comprising the DNA sequence dna 5 '-end；Or (2) have can Sequence that is hybridizing with the sequence as shown in (1) and keeping such as (1) described sequence active.

(C) a kind of achievable target gene throws saccharomyces, Sporobolomyces and Rhodotorula yeast in Rhodosporidium, lock The DNA molecular of middle transcription initiation and tanscription termination, it with described in above-mentioned (A) have Rhodosporidium, lock throw saccharomyces, The DNA sequence dna of Sporobolomyces and Rhodotorula yeast transcriptional promoter activity, or have described in above-mentioned (A) simultaneously with red Winter spore saccharomyces, lock throw the DNA sequence dna of saccharomyces, Sporobolomyces and Rhodotorula yeast transcriptional promoter activity, and (B) institute The DNA fragmentation stated, and DNA fragmentation described in (B) is located at the downstream of DNA sequence dna described in (A), 1-10000 core adjacent thereto The DNA fragmentation of thuja acid.

(D) the DNA expression cassette that target gene can be connect by one kind with (A)-(C) any described DNA molecular, in order to institute The recombination expressed in saccharomyces, Sporobolomyces and Rhodotorula yeast can be thrown in Rhodosporidium, lock by stating target gene DNA.The target gene is protein-encoding nucleotide or antisense nucleic acid code nucleic acid.Preferably, the cDNA sequence of the target gene With the nucleotide sequence (galactokinase cDNA) as shown in SEQ ID NO:4.

(E) a kind of recombinant vector of any one carried in DNA molecular described in (A)-(D).The carrier can be with Episomal vector or integrating vector, the episomal vector such as, but not limited to, pMD18-T, pUC18, pYES2c/t or PYX212 etc., the integrating vector are the binary expression vector of mediated by agriculture bacillus, such as, but not limited to, PZPK or pZP2000 Deng.

(F) a kind of DNA molecular by as described in (D) or the carrier as described in (E) be transferred to Rhodosporidium, lock throws ferment The method for transformation of mother's category, Sporobolomyces and Rhodotorula bacterial strain.

(G) one kind be transferred to the DNA expression cassette as described in (D) or the recombinant vector as described in (E) Rhodosporidium, Lock throws the engineering strain of saccharomyces, Sporobolomyces and Rhodotorula.

(H) galactokinase (Gal1) promoter, it is characterised in that: its source is circle rhodosporidium toruloides, can start purpose Gene throws the transcript and expression in saccharomyces, Sporobolomyces and Rhodotorula yeast, the starting in Rhodosporidium, lock Son: (1) with the DNA sequence dna as shown in SEQ ID NO:1 full sequence or comprising the DNA sequence dna from 3 '-ends 500bp with Interior partial sequence, (2) have and can play 500bp with the whole of the sequence as shown in SEQ ID NO:1 or its DNA sequence dna 3 '-end Within partial sequence hybridization and keep the active sequence of transcripting promoter, or (3) to deoxidation shown in SEQ ID NO:1 Substitution, missing, insertion or addition within nucleotide sequence progress one or 50 bases is obtained, with SEQ ID NO:1 Shown sequence is with 70% or more homology and with the sequence of promoter activity；

Galactokinase terminator of the present invention, it is characterised in that: its source is circle rhodosporidium toruloides, can terminate mesh Gene throw transcript and expression in saccharomyces, Sporobolomyces and Rhodotorula yeast, the end in Rhodosporidium, lock It is only sub: (1) whole with such as SEQ ID NO:2 shown in DNA sequence dna or partial sequence comprising the DNA sequence dna 5 '-end, (2) have can hybridizing with the partial sequence of the whole of the sequence as shown in SEQ ID NO:2 or its DNA sequence dna 5 '-end and protect The active sequence of transcription terminator is held, or (3) carry out one or 50 alkali to deoxynucleotide sequence shown in SEQ ID NO:2 Substitution, missing, insertion within base or addition are obtained, with sequence shown in SEQ ID NO:2 have 70% or more homology, And the sequence with terminator activity.

Using the DNA molecular with promoter activity of the invention and there is the active DNA of transcription terminator, it can be achieved that outer Source gene or endogenous gene throw the expression in saccharomyces, Sporobolomyces and Rhodotorula yeast in Rhodosporidium, lock.

The present invention provides throw saccharomyces, Sporobolomyces and Rhodotorula yeast strain for Rhodosporidium, lock Genetically engineered promoter, terminator and carrier.Saccharomyces, Sporobolomyces and red ferment are thrown for Rhodosporidium, lock Mother belongs to yeast strain and opens a breeding new way, and therefore can provide the saccharomyces neoformans bacterial strain with industrial use.

In conclusion the present invention provides following technical proposals:

1. galactokinase enzyme promoters, nucleotide sequence is as shown in SEQ ID NO:1.

2. galactokinase (Gal1) promoter described in the 1st for construct can c (Rhodosoporidium), Lock throws saccharomyces (Sporidiobolus), Sporobolomyces (Sporobolomyces) and Rhodotorula (Rhodotorula) The application for the recombinant expression carrier expressed in yeast strain, wherein having cloned comprising the galactokinase (Gal1) promoter Rhodosporidium, the lock of recombinant expression carrier throw saccharomyces and Rhodotorula yeast strain constitutes Rhodosporidium, lock is thrown Saccharomyces, Sporobolomyces and Rhodotorula genetic operating system.

3. a kind of DNA expression cassette, the nucleotide sequence containing galactokinase enzyme promoters shown in SEQ ID NO:1.

4. expression cassette described in the 3rd, also contain nucleotide sequence shown in SEQ ID NO:2 as terminator, Sequence shown in middle SEQ ID NO:1 is located at the upstream of sequence shown in SEQ ID NO:2, SEQ ID NO:1 and SEQ ID It is the open reading frame of coding target gene between NO:2.

5. DNA expression cassette described in the 4th, it is characterised in that: the open reading frame of the coding target gene CDNA sequence has the nucleotide sequence as shown in SEQ ID NO:4.

6. a kind of recombinant vector comprising DNA expression cassette described in any one of 3-5.

7. recombinant vector described in the 6th, it is characterised in that: the carrier is sequestered or integrating vector.

8. recombinant vector described in the 7th, wherein the integrating vector is the binary expression vector of mediated by agriculture bacillus, example Such as PZPK or pZP2000, also, the episomal vector is selected from pMD18-T, pUC18, pYES2c/t or pYX212.

9. the host cell comprising recombinant vector described in any one of 6-8.

10. host cell described in the 9th, the host cell is Bacillus coli cells or yeast cells.

11. a kind of expression system for oleaginous yeast genetic expression, the expression system includes:

(1) changing of expressing in saccharomyces, Sporobolomyces and Rhodotorula category bacterial strain can be thrown in Rhodosporidium, lock Good carrier, the improved carrier in Rhodosporidium, lock by that can throw in saccharomyces, Sporobolomyces and Rhodotorula It is inserted into shown in promoter sequence shown in SEQ ID NO:1 and SEQ ID NO:2 in integrant expression or the plasmid of free expression Terminator sequence building obtains, and wherein promoter sequence shown in SEQ ID NO:1 is located at terminator shown in SEQ ID NO:2 The upstream of sequence is multiple cloning sites between sequence shown in sequence and SEQ ID NO:2 shown in SEQ ID NO:1, and The carrier also includes selected marker；

(2) target gene open reading frame sequence can be operably inserted into improved carrier described in (1), And make the target gene in improved carrier described in (1) promoter and terminator connect with meeting reading frame, and

(3) Rhodosporidium, lock throw saccharomyces, Sporobolomyces and Rhodotorula bacterial strain.

12. the 11st expression system for oleaginous yeast genetic expression, wherein improved carrier described in (1) by It can be thrown in Rhodosporidium, lock and be inserted into SEQ ID in the plasmid expressed in saccharomyces, Sporobolomyces and Rhodotorula The building of terminator sequence shown in promoter sequence shown in NO:1 and SEQ ID NO:2 obtains.

13. the 12nd expression system for oleaginous yeast genetic expression, wherein the plasmid is sequestered or whole Mould assembly plasmid, also, wherein the integrative plasmid is the double base expression plasmid of mediated by agriculture bacillus, such as PZPK or pZP2000, Also, the episomal plasmids are selected from pMD18-T, pUC18, pYES2c/t or pYX212.

14. the 11st expression system for oleaginous yeast genetic expression, wherein Rhodosporidium toruloides described in (3) It selects good strains in the field for seed from circle rhodosporidium toruloides (Rhodosporidium toruloides), Bei Jiwei rhodosporidium toruloides (Rhodosporidium Babjevae), the lock, which is thrown saccharomyces (Sporidiobolus) bacterial strain and is selected from, intends pink lock shadow yeast (Sporidiobolus Pararoseus), Sporobolomyces (Sporobolomyces) bacterial strain is selected from pink shadow yeast (Sporobolomyces Roseus), Rhodotorula (Rhodotorula) bacterial strain is selected from rhodothece rubra (Rhodotorula rubra), rhodotorula mucilaginosa (Rhodotorula mucilaqinosa), Rhodotorula marina (Rhodotorula marina), grass rhodotorula (Rhodotorula graminis) and rhodotorula glutinis (Rhodotorula glutinis).

15. the 11st expression system for oleaginous yeast genetic expression, wherein the opening of target gene described in (2) is read Frame sequence has the nucleotide sequence as shown in SEQ ID NO:4.

It should be appreciated by those skilled in the art that term " expression system " refers to including recombinant vector, target egg to be expressed The composition system of white coding nucleotide sequence, suitable host cell or host strain etc. is used in the host cell Or the target protein is expressed in host strain.

The beneficial effects of the present invention are:

Saccharomyces is thrown for Rhodosporidium, lock and the saccharomycete of Rhodotorula provides promoter, terminator heredity turns The strong Rhodosporidium promoted from now on, lock are thrown the bacterium of saccharomyces, Sporobolomyces and Rhodotorula saccharomycete by change method Strain improvement and metabolic engineering research.

Detailed description of the invention

The agarose gel electrophoresis results of Fig. 1, GAL1 degenerate pcr product (swimming lane 1), swimming lane M are molecular weight standard.

The structural schematic diagram of Fig. 2, PZPK-GAL1p-hyg-GAL1t carrier, LB, T-DNA left margin；On the right of RB, T-DNA Boundary.

Fig. 3, the PCR qualification result that recon is obtained using HYG genetic transformation R.babjevae NCYC 2630, swimming lane M For molecular weight standard, swimming lane 1-6 respectively indicates different Hyg resistant transformants, and 7 be wild type control.

Fig. 4, the detection of expression for indicating HYG --- Western blot analyze result figure, and swimming lane 1-3 is R.babjevae 2630 hygromycin transformant 1-3 total protein of NCYC；Swimming lane 4 is the starting strain R.babjevae NCYC as negative control 2630 total protein samples.

Transcriptional level expression analysis --- the RT- of Fig. 5, BLE resistance Ura3 auxotrophy circle rhodosporidium toruloides recombinant bacterial strain PCR result figure, swimming lane 1-6 are BLE resistance Ura3 auxotrophy circle 10788 recombinant bacterial strain 1-6 of rhodosporidium toruloides ATCC, swimming lane 7 For control strain circle rhodosporidium toruloides ATCC 10788.

The structural schematic diagram of Fig. 6, PZPK-GAL1p-hyg-Thsp carrier, LB, T-DNA left margin；On the right of RB, T-DNA Boundary.

The structural schematic diagram of Fig. 7, pZPK-GAL1p-MCS-Thsp carrier, LB, T-DNA left margin；On the right of RB, T-DNA Boundary.

The structural schematic diagram of Fig. 8, PZPK-HYG-GAL1p-MCS-Thsp carrier, LB, T-DNA left margin；RB, T-DNA are right Boundary.

The structural schematic diagram of Fig. 9, pZPK-HYG-GAL1p-CpFAH-Thsp carrier, LB, T-DNA left margin；RB, T-DNA Right margin.

Figure 10, the detection of expression for indicating CpFAH --- Western blot analyze result figure, and swimming lane 1-3 is to intend pink lock 3765 hygromycin transformant 1-3 total protein of shadow yeast JCM；Swimming lane 4 intends pink lock for the starting strain as negative control 3765 total protein sample of shadow yeast JCM.

The structural schematic diagram of Figure 11, pZPK-HYG-GAL1p-ME-Thsp carrier, LB, T-DNA left margin；RB, T-DNA are right Boundary.

Figure 12, the detection of expression for indicating RtME --- Western blot analyze result figure, and swimming lane 1-3 throws spore ferment to be pink Female 8242 hygromycin transformant 1-3 total protein of S.roseus JCM；Swimming lane 4 is pink for the starting strain as negative control 8242 total protein sample of shadow yeast S.roseus JCM.

The structural schematic diagram of Figure 13, pZPK-HYG-GAL1p-GFP-Thsp carrier, LB, T-DNA left margin；RB, T-DNA Right margin.

Figure 14, the detection of expression for indicating GFP --- Western blot analyze result figure, and swimming lane 1-3 is to recombinate dark red ferment Female 2.279 hygromycin transformant 1-3 total protein of CGMCC；Swimming lane 4 is the dark red ferment of starting strain recombination as negative control Female 2.279 total protein sample of CGMCC.

Figure 15, the detection of expression for indicating GFP --- Western blot analyze result figure, and swimming lane 1-3 is the recombination red ferment of glue Female 2.22 hygromycin transformant 1-3 total protein of CGMCC；Swimming lane 4 is the starting strain recombination rhodotorula mucilaginosa as negative control 2.22 total protein sample of CGMCC.

The structural schematic diagram of Figure 16, pZPK-HYG-GAL1p-INU-Thsp carrier, LB, T-DNA left margin；RB, T-DNA Right margin.

Sequence table explanation

Specific embodiment

Herein, " promoter " is referred to by RNA polymerase identification, in conjunction with the DNA sequence that simultaneously energy promotor gene is transcribed Column.Term " promoter " it can also be understood that are as follows: including 5 ' noncoding regions, cis-acting elements (such as enhancer) and it is other can with turn Record the nucleotide sequence that the factor combines.

The presence of promoter or intensity are usually to be indicated by promoter activity, measuring method: by reporter gene (as resisted Property gene) be connected to the downstream of the promoter, and the DNA construct is converted into corresponding host cell, examining report gene is No expression.If it is observed that being connected to the expression of promoter downstream reporter gene, so that it may think the promoter It is active in the host cell that it is converted.

Herein, " terminator " refers to that termination signal is provided on chromosome makes RNA polymerase separate and make with DNA profiling The section of DNA sequence of tanscription termination.It can make the effective table of reporter gene by " promoter-reporter gene-terminator " construct Reach and determine the activity of terminator.

" circle rhodosporidium toruloides " in the present invention, any diploid and monoploid including belonging to " species ", wild type Bacterial strain and auxotrophic strain.In the present invention " Rhodosporidium, lock throw saccharomyces, Sporobolomyces and rhodotorula Belong to ", it is not specifically limited, the example includes circle rhodosporidium toruloides (Rhodosporidium toruloides), Bei Jiwei red winter Spore yeast (Rhodosporidium babjevae), pink lock shadow yeast (Sporidiobolus pararoseus) are pink Shadow yeast (Sporobolomyces roseus), rhodothece rubra (Rhodotorula rubra), rhodotorula mucilaginosa (Rhodotorula mucilaqinosa), Rhodotorula marina (Rhodotorula marina), grass rhodotorula (Rhodotorula graminis) and rhodotorula glutinis (Rhodotorula glutinis).

" target gene " of the invention, including saccharomyces, Sporobolomyces and red ferment can be thrown in Rhodosporidium, lock Mother belongs to albumen coded sequence, antisense RNA coding sequences and the nuclease coded sequence expressed in bacterial strain.It can be in red winter spore ferment Mother belongs to, lock throws the example for the albumen coded sequence expressed in saccharomyces, Sporobolomyces and Rhodotorula bacterial strain including derived from this Albumen or nucleic acid sequence in two class Pseudomonas, and be not limited thereto, it further include from other microorganisms, plant and animal Albumen or nucleic acid sequence.Art technology is any it should be understood that when using from other microorganisms, plant and animal Albumen coded sequence as a purpose gene (that is, external source target gene) when, for optimization Rhodosporidium, lock throw saccharomyces, Expression in Sporobolomyces and Rhodotorula bacterial strain, it usually needs throw saccharomyces, shadow yeast for Rhodosporidium, lock Belong to and the codon preference of Rhodotorula bacterial strain carries out codon optimization to the target gene.And codon optimization belongs to this The conventional technical means in field.

Promoter in the present invention: (1) there is the full sequence of the DNA sequence dna as shown in SEQ ID NO:1 or includes the DNA Partial sequence of the sequence from 3 '-ends within 500bp, (2) have can with the whole of the sequence as shown in SEQ ID NO:1 or its It is right that the partial sequence within 500bp hybridizes and the holding active sequence of transcripting promoter, or (3) are played in DNA sequence dna 3 '-end Deoxynucleotide sequence shown in SEQ ID NO:1 carries out substitution, missing, insertion or addition institute within one or 50 bases It obtains, with sequence shown in SEQ ID NO:1 with 70% or more homology and with the sequence of promoter activity.

Terminator in the present invention: (1) there is the whole of the DNA sequence dna as shown in SEQ ID NO:2 or includes the DNA sequence The partial sequence of column 5 '-end, (2) have can whole with the sequence as shown in SEQ ID NO:2 or its DNA sequence dna 5 '-end Partial sequence hybridization and keep the active sequence of transcription terminator, or (3) to deoxyribonucleoside shown in SEQ ID NO:2 It is obtained that acid sequence carries out substitution within one or 50 bases, missing, insertion or addition, and shown in SEQ ID NO:2 Sequence is with 70% or more homology and with the sequence of terminator activity.

Promoter-target gene construct, target gene-terminator construct or promoter-mesh in the present invention Gene-terminator construct, can throw saccharomyces directly or through carrier mediated conversion Rhodosporidium, lock, throw spore ferment Mother belongs to and Rhodotorula bacterial strain, can be using preferred plasmid carrier as mediation carrier in order to destination gene expression.

Below in conjunction with the accompanying drawings and embodiment the invention will be further described, it will help those skilled in the art Understand the present invention, but the invention is not limited in any way.All primer synthesis and examining order in following embodiments, such as without spy It does not mentionlet alone bright then by the completion of Dalian TakaRa company.Experimental method in following embodiments is unless otherwise specified conventional side Method.The experimental materials used in the following example is unless otherwise specified to be commercially available from conventional biochemical reagent company.

R.toruloides CGMCC 2.1389: China General Microbiological Culture Collection Center (CGMCC) is originated from Tokyo Microbe research institute, university (IFO 8766), the diploid made of IFO 0559 and IFO 0880 are with, is equal to CBS 6016 or NBRC 8766 or NRRL Y-6987.

R.toruloides ATCC 10788: Unite States Standard biology product collecting center (ATCC) is originated from CBS-KNAW Fungal biodiversity centre, be equal to IFO 0559 or JCM 3792 or CCRC 20306 or DBVPG 6740 or IAM 13469 or IGC 4416 or MUCL 30249 or NCYC 921 or NRRL Y-1091 or VKM Y-334 or PYCC 4416.

Rhodosporidium babjevae NCYC 2630 is purchased from United Kingdom National barms collection (National Collection of Yeast Cultures, NCYC).

Intend pink lock shadow yeast (Sporidiobolus pararoseus) JCM 3765 to be purchased from purchased from China commonly Microbiological Culture Collection administrative center (CGMCC).

Pink shadow yeast (Sporobolomyces roseus) JCM 8242 is purchased from Japanese Microbiological Culture Collection The heart (JCM).

Rhodothece rubra (Rhodotorula rubra) CGMCC 2.279 is purchased from barms collection (purchased from China General Microbiological Culture preservation administrative center (CGMCC).

Rhodotorula mucilaginosa CGMCC 2.22 (is purchased from China General Microbiological culture presevation pipe purchased from barms collection Reason center (CGMCC).

Rhodotorula marina (Rhodotorula marina) CGMCC 2.4203 (is purchased from purchased from barms collection China General Microbiological culture presevation administrative center (CGMCC).

Rhodotorula glutinis (Rhodotorula glutinis) NCYC 2666 is purchased from United Kingdom National barms collection (National Collection of Yeast Cultures, NCYC).

Embodiment 1: circle 2.1389 total serum IgE of rhodosporidium toruloides (Rhodosporidium toruloides) CGMCC mentions It takes

Circle rhodosporidium toruloides (R.toruloides) CGMCC 2.1389 (is purchased from China General Microbiological culture presevation pipe Reason center (China General Microbiological Culture Collection Center, CGMCC)) by inclined-plane It is inoculated into 10mL YEPD fluid nutrient medium (glucose 20.0g/L, yeast extract 10.0g/L, peptone 20.0g/L, pH 6.0) in, for 24 hours in 30 DEG C of shaking table cultures, then bacterium solution is transferred to 100mL YEPD Liquid Culture respectively with the volume ratio of 1:50 In base, logarithmic growth phase is reached in 30 DEG C of shaking table culture 14h.At 4 DEG C, 5000rpm is centrifuged 4min, collects thallus, fast with liquid nitrogen Quickly cooling jelly thallus, grinding broken wall (Yang F, Tan HD, Zhou YJ, et al.Mol.Biotechnol.2010,47 (2): 144–151.).Total serum IgE is extracted using TakaRa company RNAiso kit, and according to its standard step.

RNA carries out 1.5% (mass/volume concentration) agarose gel electrophoresis, uses fluorescence-uv analyzer observation mirror It is fixed, it is seen that clearly two band.With ultraviolet/visible light spectrometer analysis total serum IgE sample, OD is measured₂₆₀/OD₂₈₀=1.99, show Total serum IgE quality is fine.Total serum IgE sample freezes in -80 DEG C, spare.

Embodiment 2: the synthesis of circle 2.1389 the first chain of cDNA of rhodosporidium toruloides CGMCC and GAL1 degenerate pcr

To justify 2.1389 total serum IgE of rhodosporidium toruloides CGMCC as template, reverse transcription synthesizes the first chain of cDNA.Firstly, by 1.0 μ L total serum IgE (about 2 μ g), 1.0 μ L primer SMART IV:5 '-AAGCAGTGGTATCAACGCAGAGTGGCCATTACGGCCGGG- 3 ' and 1.0 μ L oligo dT- adapter-primer III/3':5 ' of CDS-ATTCTAGAGGCCGAGGCGGCCGACATG-d (T)_30N-1N- 3 ', 2.0 μ L DEPC handle water (pyrocarbonic acid diethyl ester handles water, is purchased from Dalian TakaRa company), are added in PCR pipe and mix, In 72 DEG C of heat preservation 2min, it is immediately placed on cooled on ice 2min, by 2.0 μ L, 5 × the first chain buffer (Clontech company), 1.0 μ L DTT (20mM), 1.0 μ L dNTP (10mM), 1.0 μ Lpowerscript reverse transcriptase (Clontech company) are added to body In system, mix.In 42 DEG C of extension 60min, last 4 DEG C reaction was completed, is stored in -20 DEG C, spare.

Two degenerate primer GAL1-sense:5 '-ATGCC (AGCT) TC (AGCT) CTCGAGAC (AGCT) of design synthesis TCGCC-3 ' (base occurs at random in this position in bracket, is degeneracy base) and GAL1-anti:5 '-TCA (AG) TCCGAGTT (CT) TGGAA (AGCT) AGCAG-3 ' (base occurs at random in this position in bracket, is degeneracy base), with reverse transcription synthesis The first chain of cDNA is template, carries out the degenerate pcr amplification of GAL1 gene, 5 × PCR buffer 10.0 μ L, dNTPs (10mM) 1.0 μ L, 1.0 μ L of upstream primer (50mmol/l), downstream primer (50mmol/l) 1.0ul, PrimeSTAR archaeal dna polymerase (Dalian TakaRa) 0.5 μ L, the first chain of cDNA template 1.0 the μ L, ddH of synthesis₂O is added to 50 μ L, in 94 DEG C of heat preservation 3min, then in 98 DEG C of 10s, 62 DEG C of 10s, 72 DEG C of 1min, 35 circulations, 72 DEG C of 10min, 4 DEG C reaction was completed.Amplified production progress 1% (quality/ Volumetric concentration) agarose gel electrophoresis, it observes the band (Fig. 1) of 1.8kb or so, (is purchased from Shanghai using DNA QIAquick Gel Extraction Kit Raw work), according to supplier's proposed steps purified pcr product.PCR product is cloned into referring to the method that Dalian TakaRa company provides PMD18-T carrier (is purchased from Dalian TakaRa), is transformed into E.coli DH5 α competent cell, and wherein competent cell presses chlorination Calcium method (the Molecular Cloning:A Laboratory guide third edition, Pehanorm Brooker write, and Huang Peitang etc. is translated, and Science Press publishes) preparation.It selects Amp resistant transformants carry out Zengjing Granule, plasmid extracts.Recombinant plasmid sample send to Dalian TakaRa company and is sequenced, sequence knot The amino acid sequence that fruit deduces is analyzed through Blastp, it was demonstrated that is galactokinase enzyme sequence (RtGAL1 amino acid sequence), such as SEQ Shown in ID NO:5.Galactokinase cDNA sequence (RtGAL1 cDNA) is as shown in SEQ ID NO:4 sequence.

Embodiment 3: the amplification of circle rhodosporidium toruloides CGMCC 2.1389RtGAL1CDS

The extracting genome DNA of circle rhodosporidium toruloides CGMCC 2.1389 uses bead broken wall method (fine works molecular biosciences The 13rd chapter of the experiment guide third edition is learned, Ao Sibai etc. writes, and face sub- grain husk etc. is translated, and Science Press publishes).The genome prepared DNA is measured using Nanodrop ND-1000, measures OD₂₆₀/OD₂₈₀=1.85, show that genomic DNA quality is fine.Concentration is 280ng/ μ L, totally 500 μ L, genome DNA sample freezes in -20 DEG C, spare.

According to galactokinase (RtGal1) cDNA sequence obtained in embodiment 2,1 pair of gene-specific primer is designed, GAL1-p1:5 '-atgccctcgctcgagacgtcgccgctc-3 ' and GAL1-p2:5 '- Tcaatccgagttctggaagaggagtgc-3 ' is pressed using the genomic DNA for justifying rhodosporidium toruloides CGMCC 2.1389 as template More solito carries out PCR amplification, obtains the PCR product (not shown) of about 2.3kb.Pcr amplification product according to embodiment 2 behaviour Make step recycling, be cloned into pMD18-T carrier, and be sequenced, obtains the DNA sequence dna as shown in sequence table SEQ ID NO:3 (code area RtGAL1).Through being compared with the galactokinase cDNA sequence obtained in embodiment 2, it was demonstrated that the genetic fragment be its half Galactokinase coding region sequence, wherein containing 6 intrones and 7 exons.

Embodiment 4: chromosome walking obtains RtGAL1 gene 5 ' flank sequence (promoter)

The present embodiment is completed using Genome Walking Kit (being purchased from Dalian TakaRa).

According to RtGAL1CDS sequence obtained in embodiment 3, designing 3 Specific Primer, (gene specific draws Object), respectively GAL1-SP1:5 '-ctcgcctgcaaagtgcaagtacaaacact-3 ', GAL1-SP2:5 '- Cgtctcgagagcaacgagggacgcaccgat-3 ' and GAL1-SP3:5 '- Cgagagtgcagcctgggtgtagacctggtc-3 ' is carried out according to kit specification following operation as downstream primer.

1.1^stPCR reaction

Using the genomic DNA refined in embodiment 3 as template, first round amplification is carried out.50 μ L:10 × LA of reaction system PCR buffer II(Mg²⁺Plus, Dalian TakaRa) 5.0 8.0 μ L, LA Taq archaeal dna polymerases of μ L, dNTPs (2.5mmol/l) 1.0 μ L, GAL1-SP1 (10 μm of ol/ of (5U/ μ L, Dalian TakaRa) 1.0 μ L, AP1Primer (100 μm of ol/l, Dalian TakaRa) L) 1.0 μ L, circle 2.1389 genomic DNA template of rhodosporidium toruloides CGMCC (120ng/ μ L) 1.0 μ L, ddH₂O adds to 50 μ L.Instead It answers condition: first carrying out the high specific reaction of 5 high temperature anneal temperatures, then carry out the low specificity of 1 extremely low annealing temperature Reaction；Then hot asymmetric PCR is carried out: the high specific reaction of 2 high annealing temperature (65 DEG C) and 1 low temperature thermal oxidation (44 DEG C) low specificity react alternate cycles, totally 15 times.Design parameter is as follows: 94 DEG C of 1min, 98 DEG C of 1min；94 DEG C of 30s, 65 DEG C 1min, 72 DEG C of 2min, totally 5 recycle；94 DEG C of 30s, 25 DEG C of 3min, 72 DEG C of 2min；94℃30s,65℃1min,72℃2min, 94 DEG C of 30s, 65 DEG C of 1min, 72 DEG C of 2min, 94 DEG C of 30s, 44 DEG C of 1min, 72 DEG C of 2min, totally 15 recycle；72 DEG C of 10min terminate Reaction.

2.2^ndNest-type PRC reaction

50 μ L:10 × LA PCR buffer II (Mg of reaction system²⁺Plus, Dalian TakaRa) 5.0 μ L, dNTPs (2.5mmol/l) 8.0 μ L, LA Taq archaeal dna polymerase (5U/ μ L, Dalian TakaRa) 1.0 μ L, AP1Primer (100 μm of ol/l, Dalian TakaRa) 1.0 μ L, 1^stPCR reaction product 1.0 μ L, GAL1-SP2 (10 μm of ol/l) 1.0 μ L, ddH₂O adds to 50 μ L.Instead Answer condition: 94 DEG C of 30s, 65 DEG C of 1min, 72 DEG C of 2min, 94 DEG C of 30s, 65 DEG C of 1min, 72 DEG C of 2min, 94 DEG C of 30s, 44 DEG C of 1min, 72 DEG C of 2min, totally 15 recycle；72 DEG C of 10min, reaction was completed.

3.3^rdNest-type PRC reaction

50 μ L:10 × LA PCR buffer II (Mg of reaction system²⁺Plus, Dalian TakaRa) 5.0 μ L, dNTPs (2.5mmol/l) 8.0 μ L, LA Taq archaeal dna polymerase (5U/ μ L, Dalian TakaRa) 1.0 μ L, AP1Primer (100 μm of ol/l, Dalian TakaRa) 1.0 μ L, 2^ndNested PCR reaction product 1.0 μ L, GAL1-SP3 (10 μm of ol/l) 1.0 μ L, ddH₂O adds to 50 μ L.Reaction condition: 94 DEG C of 30s, 65 DEG C of 1min, 72 DEG C of 2min, 94 DEG C of 30s, 65 DEG C of 1min, 72 DEG C of 2min, 94 DEG C of 30s, 44 DEG C 1min, 72 DEG C of 2min, totally 15 recycle；72 DEG C of 10min, reaction was completed.

3^rdNested PCR reaction product cuts purpose band after 1% (mass/volume concentration) agarose gel electrophoresis, benefit It is purified with DNA fragmentation gel purification kit (being purchased from the green skies).DNA fragmentation after purification clones insertion pMD18- through TA Carrier T (is purchased from Dalian TakaRa company), converts DH5 α competent cell；Wherein competent cell presses Calcium Chloride Method (molecule gram The grand experiment guide third edition, Pehanorm Brooker write, and Huang Peitang etc. is translated, and Science Press publishes) preparation.Select Amp resistant transformants Son carries out Zengjing Granule, plasmid extracts.Recombinant plasmid sample send to Dalian TakaRa company and is sequenced, and obtains such as SEQ ID NO:1 Shown in DNA sequence dna, it was demonstrated that be expected RtGAL1 promoter sequence.

Embodiment 5: chromosome walking obtains 3 ' flank sequence (terminator) of RtGAL1 gene

The present embodiment is completed also with Genome Walking Kit (being purchased from Dalian TakaRa).

According to GAL1DNA sequence obtained in embodiment 3,3 Specific Primer (gene-specific primer) are designed Respectively GAL1-SP11:5 '-gtgtcccgagttggacgagttggtctc-3 ', GAL1-SP22:5 '- Gtgcgggatggggaggcgcgaccgtct-3 ' and GAL1-SP33:5 '-tcgcgactaagccggaacacggggcactcc- 3 ', as upstream primer, it is carried out according to kit specification the operation of 3 ' flank chromosome walkings, except Specific Primer points GAL1-SP11 is not changed to successively by GAL1-SP1, GAL1-SP2, GAL1-SP3, it is other outside GAL1-SP22, GAL1-SP33 With embodiment 4.

3^rdNested PCR reaction product (not shown) is carried out pure using DNA fragmentation gel purification kit (being purchased from the green skies) Change, clones insertion pMD18-T carrier (being purchased from Dalian TakaRa company) through TA, convert DH5 α competent cell；Wherein competence Cell is by Calcium Chloride Method (the Molecular Cloning:A Laboratory guide third edition, Pehanorm Brooker write, and Huang Peitang etc. is translated, and Science Press publishes) Preparation.It selects Amp resistant transformants and carries out Zengjing Granule, plasmid extraction.Recombinant plasmid sample send to Dalian TakaRa company and surveys Sequence obtains the DNA sequence dna as shown in SEQ ID NO:2, it was demonstrated that is the terminator sequence of expected galactokinase enzyme coding gene.

Embodiment 6:RtGAL1 promoter-open reading frame-terminator full-length gene obtains

According to the promoter and terminator sequence obtained in embodiment 4 and embodiment 5, redesigns pair of primers and carry out The amplification of RtGAL " promoter-open reading frame-terminator " full-length gene.Pgal1-p1:5'- Aggcgaatggatcggaaggcatggtcg-3 ', gal1t-p2:5 '-gggcgttgcgaacgtcctccaatcaag-3 '.With 2.1389 genomic DNA of circle rhodosporidium toruloides CGMCC prepared in embodiment 3 is that template carries out PCR amplification.PCR system (50 μ L): 10 × Speed buffer (Dalian TakaRa) 5.0 μ L, dNTPs (10mmol/l) 1.0 μ L, upstream primer (10 μm of ol/l) 2.0 μ L, downstream primer (10 μm of ol/l) 2.0 μ L, SpeedSTAR^TM(amplification rate is fast, and 1kb/10s is purchased from for HS archaeal dna polymerase Dalian TakaRa company) 0.5 μ L, genomic DNA template (120ng/ μ L) 2 μ L, ddH₂O adds to 50 μ L.Reaction condition: 98 DEG C 1min, 98 DEG C of 10s, 65 DEG C of 1.0min, 35 circulations, 72 DEG C of 10min, 4 DEG C reaction was completed.PCR product is through 1% (mass/volume Concentration) it is purified using PCR fragment purification kit (purchased from the green skies) after agarose gel electrophoresis analysis.Segment is through TA grams Grand insertion pMD18-T carrier (being purchased from Dalian TakaRa company), converts DH5 α competent cell；Wherein competent cell presses chlorination Calcium method (the Molecular Cloning:A Laboratory guide third edition, Pehanorm Brooker write, and Huang Peitang etc. is translated, and Science Press publishes) preparation.It selects Amp resistant transformants carry out Zengjing Granule, plasmid extracts.Recombinant plasmid sample send to Dalian TakaRa company and is sequenced, it was demonstrated that is Expected galactokinase gene full length sequence pGAL1t, the recombinant vector are named as T-pGAL1t.

Embodiment 7:RF PCR cloning PCR constructs hygromycin protein expression box GAL1p-hyg-GAL1t

HYG gene (such as SEQ ID is synthesized according to HYG protein sequence commission Shanghai Sangon Biotech Company's full genome of NCBI report Shown in NO:6).Using the gene of synthesis as template, reference literature method (van den Ent F, Lowe J J.Biochem Biophys Methods, 2006,67,67-74.), design RF cloning primer: HYG-RF-p1:5 '-GATTCGCTTGCTGTGC GCTGTGAGACGatgccggagctcacggcgacgtcggtc-3 ' and HYG-RF-p2:5 '-CTTCTCCTCCTCGTCCTTGC TCGCCGCctattctttcgcccgcgggcgcgtcga-3 ' is primer, carries out PCR amplification.Carry out the amplification of the RF first round.System (50 μ L): 5 × Prime buffer (Dalian TakaRa) 10.0 μ L, dNTPs (2.5mmol/l) 4.0 μ L, upstream primer (10 μ Mol/l) 2.0 μ L, 1.0 μ L of downstream primer (10 μm of ol/l) 2.0 μ L, PrimeSTAR HS archaeal dna polymerase (Dalian TakaRa), T-GFPuv plasmid (100ng/ μ L) 1 μ L, ddH₂O adds to 50 μ L.Reaction condition: 95 DEG C of 3min, 98 DEG C of 8s, 49 DEG C of 15s, 72 DEG C 1min, 35 circulations, 72 DEG C of 10min, 4 DEG C reaction was completed.RF I reaction product is pure using DNA fragmentation glue recovery purifying kit Change, -20 DEG C save backup.

RF II reaction: 5 × Prime buffer (Dalian TakaRa) 10.0 μ L, dNTPs (2.5mmol/l) 4.0 μ L, it is real Apply T-pGal1t plasmid (100ng/ μ L) the 1.0 μ L constructed in example 6, RF I reaction product in the present embodiment abovementioned steps (200ng/ μ L) 5.0 μ L, PrimeSTAR HS archaeal dna polymerase (Dalian TakaRa) 1.0 μ L, ddH₂O adds to 50 μ L.React item Part: 95 DEG C of 3min, 68 DEG C of 12min, 95 DEG C of 30s later, 65 DEG C of 45s (- 1 DEG C/cyc), 68 DEG C of 12min, 15 circulations, next A wheel: 95 DEG C of 30s is carried out again, and 55 DEG C of 45s, 68 DEG C of 12min, 20 circulations, 72 DEG C of 10min, 4 DEG C reaction was completed.

DpnI digestion and electroporated: take 8 μ L RF II reaction products that 1 μ L DpnI (purchased from TaKaRa) and 1 μ L is added DpnI buffer takes the electroporated DH5 α impression of 2 μ L after mixing after 37 DEG C of effect 120min remove original T-pGal1t plasmid State cell, competent cell prepare (the Molecular Cloning:A Laboratory guide third edition, Pehanorm Brooker work, Huang Peitang etc. by standard method Translate, Science Press publishes), electroporated parameter: 2200-2500V, 400 Ω, 25 μ F, 0 DEG C, 4-8ms.Amp resistance is selected to turn Beggar carries out Zengjing Granule, plasmid extracts, and carries out bacterium colony using RF I reaction the primer HYG-RF-p1 and HYG-RF-p2 PCR identification identifies that positive recombinant vector send Dalian TakaRa to be sequenced, and obtaining 5 ' ends and 3 ' ends is respectively GAL1 promoter With " GAL1p-hyg-GAL1t " expression cassette of GAL1 terminator, meanwhile, which is named as T-GAL1p-hyg-GAL1t. Completely " GAL1p-hyg-GAL1t " expression cassette is as shown in SEQ ID NO:7.

Embodiment 8:hyg luring in Bei Jiwei rhodosporidium toruloides (Rhodosporidium babjevae) NCYC 2630 Lead expression

Agrobacterium tumefaciems (Agrobacterium tumefaciens) under field conditions (factors) can by scab or wound into Enter host tissue, its intracorporal section of DNA is transferred in Plant Genome, it is final that host is stimulated to infect position formation crown gall Tumor.This characteristic of Agrobacterium is applied to the transformation of Plant Genome, referred to as ATMT technology earliest.Subsequent ATMT technology is answered extensively For a variety of fungies and Yeast Genetics transformation and T-DNA insertion mutation library construction.

ATMT conversion process can substantially be divided into vector construction, Agrobacterium activation, host material preparation, cotransformation and conversion Son screens this five steps.First in the interregional suitable selected marker of insertion of the T-DNA of binary vector, and it is transferred to Agrobacterium； It is induced after Agrobacterium tumefaciens attachment activation containing binary vector with acetosyringone (AS)；Host strain dilutes after overactivation To certain concentration；Agrobacterium after activation and induction is mixed with host material, is coated on the co-cultivation for being covered with mounting medium On plate, cotransformation is carried out at a suitable temperature；The mixed bacterium of co-cultivation is transferred in screening flat board, it is most suitable to be placed in host strain It is cultivated at a temperature of suitable, until transformant occurs.

1. the building of binary vector PZPK-GAL1p-hyg-GAL1t

PZPK skeleton carrier from Dalian Chemiclophysics Inst., Chinese Academy of Sciences Zhao Zongbao researcher laboratory (Lin XP, Wang YN, Zhang SF, et al.Fems Yeast Res.2014,14:547-555), PZPK-GAL1p-hyg-GAL1t is carried The building of body then uses GAL1-HYG-RF-p1:5 '-CCGAATTGAATTCGAGCTCGCTCGGTACCCGGaggcgaatggat Cggaaggcatggtcg-3 ' and GAL1-HYG-RF-p2:5 '-GCTTGCATGCTGCAGGTCGACTCTAGA Gggcgttgcgaacgtcctccaatcaagt-3 ' is primer, and the T-GAL1p-hyg-GAL1t constructed using embodiment 7 is template Amplification obtains " GAL1p-hyg-GAL1t " segment, uses RF cloning process is (as shown in Example 7) will after the recycling of PCR glue " GAL1p-hyg-GAL1t " segment is inserted between the LB and RB of PZPK binary vector.Carrier obtained is named as PZPK- GAL1p-hyg-GAL1t, structure are as shown in Figure 2.

2. the building of the Agrobacterium tumefaciens attachment containing PZPK-GAL1p-hyg-GAL1t plasmid

PZPK-GAL1p-hyg-GAL1t binary vector obtained is converted using electroporated method to Agrobacterium tumefaciems In (Agrobacterium tumefaciems) AGL1 (being purchased from Unite States Standard biology product collecting center (ATCC)), Yu Hanyou Picking transformant on the LB plate of 50ng/ μ L kanamycins.The method that Agrobacterium-mediated Transformation uses bacterium colony PCR first is tested Card.Correct transformant is verified, plasmid therein is extracted, is converted into Escherichia coli.Binary vector is a large amount of by Escherichia coli Sequence verification is sent after enrichment.Agrobacterium strains containing sequencing correct plasmid are engineered strain, are saved backup.

3. inducing expression of the HYG gene in Rhodosporidium babjevae NCYC 2630

R.babjevae NCYC 2630 is purchased from United Kingdom National barms collection (National Collection Of Yeast Cultures, NCYC).R.babjevae NCYC 2630 after taking a ring to activate, is connected to 5mL YEPD (grape Sugared 20.0g/L, yeast extract 10.0g/L, peptone 20.0g/L, pH 6.0) in culture solution, 30 DEG C, 200r/min culture 12h.After sterile water washing one time, it is adjusted to OD₆₀₀=0.1-0.8, it is spare.Contain PZPK-GAL1p-hyg-GAL1t plasmid Agrobacterium activation after, be connected in the LB liquid of 5mL (50ng/ μ L) containing kanamycin and rifampin (50ng/ μ L), 30 DEG C, 200r/min cultivates 8h.With sterile water washing one time, it is adjusted to OD₆₀₀=0.1-1.6, it is spare.

Take above-mentioned yeast and each 400 μ L of Agrobacterium dilution, mix, directly drop in induce plate (5mmol/l glucose, 0.5% glycerol, 1.45g/L potassium dihydrogen phosphate, 2.05g/L dipotassium hydrogen phosphate, 0.15g/L sodium chloride, 0.5g/L epsom salt, 66mg/L calcium chloride dihydrate, 2.48g/L green-vitriol, 0.5g/L ammonium sulfate, 40mmol/l MES (2- (N- morpholine) second sulphur Acid), 2% agar powder, 200 μm of ol/L acetosyringones) on (Bundock P, den Dulk-Ras A, Beijersbergen A, et al.EMBO J, 1995,14,3206-3214.), 24-25 DEG C, cultivate 4 days.With the sterile water of 10mL or so by Mixed Microbes Tongue fur is washed down, and 3000r/min is centrifuged 5min, discards the liquid that upper layer mainly contains Agrobacterium, 800 μ L sterile waters of remaining cell It is resuspended, 50-200 μ L is taken to be coated on YPGR (galactolipin) culture medium (50ng/ μ L hygromycin, 300 μ g/mL cephalosporins, 1% ferment Female extract, 2% peptone, 1% raffinose, 2% galactolipin, agar powder 1.5g/L, PH 6.0) on, it is cultivated in 30 DEG C, Until transformant occurs.

4. the PCR of 2630 hygromycin transformant of R.babjevae NCYC is identified

6 hygromycin resistance R.babjevae transformants of random picking, access the YPGR liquid containing 50ng/ μ L hygromycin Culture medium (50ng/ μ L hygromycin, 300 μ g/mL cephalosporins, 1% yeast extract, 2% peptone, 1% raffinose, 2% half Lactose, PH 6.0) in, in 30 DEG C of shaking table culture 36h.Bead broken wall method described in reference implementation example 3 extracts recombination R.babjevae strain gene group DNA uses HYG-RF-p1 and HYG-RF-p2 for primer, carries out PCR identification.PCR system (50 μ L): 10 × PCR buffer (Dalian TakaRa) 5.0 μ L, dNTPs (2.5mmol/l) 4.0 μ L, upstream primer (10 μm of ol/l) 2.0 μ L, downstream primer (10 μm of ol/l) 2.0 μ L, rTaq archaeal dna polymerase (Dalian TakaRa) 1.0 μ L, genomic DNA (30ng/ μ L) 1 μ L, ddH₂O adds to 50 μ L.Reaction condition: 95 DEG C of 3min, 98 DEG C of 10s, 55 DEG C of 15s, 72 DEG C of 1min, 35 circulations, 72 DEG C 10min, 4 DEG C reaction was completed.PCR product is analyzed through 1% (mass/volume concentration) agarose gel electrophoresis.As a result such as Fig. 3 institute Show.As it can be seen that external source HYG segment is successfully integrated into 2630 genome of R.babjevae NCYC.

5. the Western blot of 2630 hygromycin transformant of R.babjevae NCYC is analyzed

In addition to directly determining that round rhodosporidium toruloides GAL1 promoter can star hygromycin using hygromycin resistance phenotype Resistant gene is outside the expression of R.babjevae NCYC 2630, since the end C- of hygromycin gene expression product carries 6 × His Tag also determines the expression of corresponding albumen using anti-His Tag antibody by Western blot analysis.Above-mentioned PCR Identify that correct 6 transformants, 3 transformants of random picking, access 10mL contain the YPGR Liquid Culture of 50ng/ μ L hygromycin In base, 10min collection bacterial strain is centrifuged in 30 DEG C of shaking table cultures 48h, 4000r/min.The thallus of acquisition is with sterile water washing one time Afterwards, be added 400 μ L protein extract buffer (8M urea, 65mM DTT, 0.1%Triton X-100,100mM NaCl, 50mM Tris-Cl, 1mM PMSF, 1mM EGTA, 1mM EDTA, pH 7.4) it is resuspended, add the pickling glass of equal volume Pearl.Using bead broken wall method smudge cells extract total protein of cell (the 13rd chapter of the fine works molecular biology experiment guide third edition, Ao Sibai etc. writes, and face sub- grain husk etc. is translated, and Science Press publishes).After total protein of cell is separated on 12%SDS-PAGE glue, (Solarbio, Beijing, China) is transferred on nitrocellulose filter, it is (green purchased from Shanghai using the anti-His-tag antibody of mouse Skies Bioisystech Co., Ltd) and horseradish peroxidase-labeled goat anti-mouse IgG (be purchased from the green skies biotechnology in Shanghai Co., Ltd) it is used as primary antibody and secondary antibody, DAB horseradish peroxidase colour reagent box (has purchased from the green skies biotechnology in Shanghai Limit company) it develops the color, the expression (Fig. 4) of hygromycin gene can be observed.

Embodiment 9: the URA3 gene of round rhodosporidium toruloides ATCC 10788 is carried out using GAL1p-hyg-GAL1t expression cassette Knock out the inducing expression of simultaneous BLE

Herein using circle rhodosporidium toruloides URA3 gene as integration site, by RF cloning process, so that " GAL1p- 5 ' and 3 ' ends of hyg-GAL1t " expression cassette carry the circle rhodosporidium toruloides URA3 homologous recombination arm of about 1500bp, benefit The screening of transformant is carried out with BLE resistance screening label.

1. the acquisition of circle rhodosporidium toruloides URA3 gene

According to circle rhodosporidium toruloides URA3 (orotidine-5'-phosphate decarboxylase) gene order (NCBI accession number: KB722658.1, EU693529.1) designs special primer: URA3-P1:5 '- TGGCTCCAATGAGTCGTTGCTTCCAGCGC-3 ' and URA3-P2:5 '-CAAGGAGAGAGGCGTTAAGCCTAAAG-3 ', with Circle 10788 genome of rhodosporidium toruloides ATCC is template, and amplification, which obtains, contains URA3 promoter, reading frame and terminator Full-length genome sequence.After DNA QIAquick Gel Extraction Kit purified pcr product, it is cloned into pMD18-T carrier, is transformed into large intestine bar Bacterium (E.coli) DH5 α competent cell.It selects Amp resistant transformants and carries out Zengjing Granule, plasmid extraction.Recombinant plasmid sample It send to Dalian TakaRa company and is sequenced, sequence results are compared with gene order-checking result, it was demonstrated that include URA3 promoter, terminator With the DNA sequence dna of reading frame (as shown in SEQ ID NO:8, URA3p-URA3-URA3t).The plasmid is named as T-URA3.

2. RF cloning process constructs GALp-BLE-GAL1t expression cassette

With pPICZ α A (being purchased from Invitrogen) for template, pair of primers BLE-RF-p1:5 '-GATTCGCTTGC is utilized TGTGCGCTGTGAGACGatggccaagttgaccagtgccgttccg-3 ' and BLE-RF-p2:5 '-CTTCTCCTCCTCGTC CTTGCTCGCCGCtcagtcctgctcctcggccacgaagtg-3 ' carries out PCR amplification.According to RF described in embodiment 7 BLE (SEQ ID NO:9) is inserted between pRtGAL1 and RtGAL1t by cloning process using T-GALp-hyg-GAL1t as skeleton, The plasmid being built into is named as T-GALp-BLE-GAL1t.

3. the building of URA3-BLE knockout box

Using primer URA3-GAL1-BLE-RF-P1:5 '-CTTGTCTTCTACAGTATATCCCTAAATTaggcgaatg Gatcggaaggcatggtcg-3 ' and URA3-GAL1-BLE-RF-P2:5 '-CTGCCCTTCACTCATCAATTACCAgggcgt Tgcgaacgtcctccaatcaagt-3 ' is primer, carries out PCR amplification.According to RF cloning process described in embodiment 3, with T-URA3 is skeleton, " GALp-BLE-GAL1t " expression cassette is inserted into RtURA3, resulting sequence is after Takara is sequenced As shown in SEQ ID NO:10 (pURA3-GAL1-BLE-URA3t), the plasmid being built into is named as T-URA3-GAL1-BLE, knot Structure is as shown in Figure 7.Recombinant plasmid sample send to Dalian TakaRa company and is sequenced, and sequence results are compared with gene order-checking result, Confirm that the genetic fragment is " URA3-GAL1-BLE-URA3 " knockout box that both ends recombinate arm with 1500bp URA3.

4. a large amount of preparations of URA3-GAL1-BLE-URA3 knockout box

Using T-URA3-GAL1-BLE plasmid as template, using URA3-P1 and URA3-P2 as primer, " URA3-GAL1- is carried out A large amount of preparations of BLE-URA3 " knockout box.PCR system (500 μ L): 10 × Speed buffer (Dalian TakaRa), 50.0 μ L, 10.0 μ L of dNTPs (10mmol/l), upstream primer (10 μm of ol/l) 20.0 μ L, downstream primer (10 μm of ol/l) 20.0 μ L, SpeedSTAR HS archaeal dna polymerase (amplification rate is fast, 1kb/10s, is purchased from Dalian TakaRa company) 5.0 μ L, genomic DNA Template (120ng/ μ L) 15.0 μ L, ddH₂O adds to 500 μ L, dispenses after mixing.Reaction condition: 98 DEG C of 1min, 98 DEG C of 10s, 65 DEG C 60s, 35 circulations, 72 DEG C of 10min, 4 DEG C reaction was completed.

PCR product utilizes PCR fragment purification kit after the analysis of 1% (mass/volume concentration) agarose gel electrophoresis (purchased from raw work) is purified.DNA fragmentation concentration after purification is 500ng/ μ L, totally 60 μ L, and -20 DEG C save backup.

5. circle 10788 competent cell of rhodosporidium toruloides ATCC preparation

The preparation of circle 10788 competent cell of rhodosporidium toruloides ATCC: circle rhodosporidium toruloides ATCC 10788 chooses bacterium colony and connects Kind 10mLYEPD culture medium (glucose 20.0g/L, yeast extract 10.0g/L, peptone 20.0g/L, pH 6.0), 30 DEG C, 200rpm cultivates 20h；The fresh YEPD culture medium of culture 1:50 ratio switching, 100mL (500mL conical flask, liquid amount 100mL), 30 DEG C, 200rpm, 6-9h is cultivated, OD value reaches 0.6-1.2；Culture ice bath 10-30min, 4 DEG C, 4000r/min It is centrifuged 5min, abandons supernatant；0 DEG C of sterile Milli-Q is washed 1 time；0 DEG C 1mol/l sorbitol washes 2 times；Ice bath, it is spare.Take 100 μ L justifies 10788 competent cell of rhodosporidium toruloides ATCC, and " URA3-GAL1-BLE-URA3 " is added and knocks out 10 μ L (5 μ in total of box G), pre-cooling is moved into after mixing into 0 DEG C of electric shock cup, parameter: 0.8-2.0 kilovolts of voltage, 200 Ω of resistance, 25 μ F of capacitor, the time 4-8ms；The YEPD of 1mL sorbierite containing 1M, 30 DEG C of incubation 1-2h is added after electric shock immediately；It is coated with the YPGR culture of the sorbierite containing 1M Base (50ng/ μ L bleomycin, 1% yeast extract, 2% peptone, 1% raffinose, 2% galactolipin, 1.5 agar powders, PH 6.0), 30 DEG C of cultures 5 days or more, sub- appearance to be transformed.

6. the bacterium colony PCR of transformant is identified

Blasticidin resistance transformant is inoculated with 10mL YPGR fluid nutrient medium, and (50ng/ μ L bleomycin, 1% yeast extract Object, 2% peptone, 1% raffinose, 2% galactolipin, PH 6.0).Genome is extracted referring to bead broken wall method in embodiment 3 DNA carries out PCR identification using BLE-RF-p1 and BLE-RF-p2.PCR system (25 the μ L): (Dalian 10 × PCR buffer TakaRa) 2.5 μ L, dNTPs (2.5mmol/l) 2.0 μ L, upstream primer (10 μm of ol/l) 1.0 μ L, downstream primer (10 μm of ol/l) 21.0 μ L, rTaq archaeal dna polymerase (Dalian TakaRa), 0.5 μ L, genomic DNA (20ng/ μ L) 1 μ L, ddH₂O adds to 25 μ L.Instead Condition: 95 DEG C of 3min is answered, 95 DEG C of 30s, 55 DEG C of 30s, 72 DEG C of 1min, 35 circulations, 72 DEG C of 10min, 4 DEG C reaction was completed.PCR is produced Object is analyzed through 1% (mass/volume concentration) agarose gel electrophoresis.The results show that all round rhodosporidium toruloides ATCC 10788 The amplifiable external source BLE genetic fragment out of recombinant bacterial strain, and control strain circle rhodosporidium toruloides ATCC 10788 is then without corresponding PCR Product (not shown).

Phenotype verifying further is carried out to the correct transformant of above-mentioned identification.5 '-FOA resistant phenotypes analysis the results show that This uracil auxotrophy circle rhodosporidium toruloides engineered strain is in the galactolipin SD culture medium (0.1%5 '-for containing 5 '-FOA FOA, galactolipin 20g/L, (NH₄)₂SO₄0.1g/L, yeast powder 0.75g/L, KH₂PO₄0.06g/L, MgSO₄·7H₂O 1.5g/L, PH 6.0) on can normal growth, and the R.toruloides ATCC 10788 of wild type is then in the culture medium for containing 5 '-FOA In can not grow.

Therefore, from genotype to phenotype, lacking for circle 10788 recombinant bacterial strain URA3 gene of rhodosporidium toruloides ATCC is verified It loses.

7. the expression analysis (transcriptional level expression analysis, RT-PCR) of Ble gene

It is mould in addition to directly determining that round rhodosporidium toruloides FBA promoter can star rich Lay using bleomycin resistance phenotype Plain resistant gene circle rhodosporidium toruloides expression (expression that bleomycin resistance phenotype is decided by Lay mycin resistant gene) outside, The expression of the transcriptional level of bleomycin resistance gene ble is also had detected using RT-PCR method.

The 2 plants of bacterium colony PCR identifications of random picking and the correct blasticidin resistance transformant of phenotypic analysis are inoculated with 10mL YPGR fluid nutrient medium (50ng/ μ L bleomycin, 1% yeast extract, 2% peptone, 1% raffinose, 2% galactolipin, PH 6.0), Fiber differentiation 48h.Cell total rna is extracted referring to 1 method of embodiment, carries out reverse transcription (RT) referring to 2 method of embodiment, Using synthesized the first chain of cDNA as template, BLE-p1:ATGGCCAAGTTGACCAGTGCCG and BLE-p2 are utilized: TCAGTCCTGCTCCTCGGCCACG is that primer carries out PCR amplification.PCR system (25 the μ L): (Dalian 10 × Ex Taq buffer TakaRa) 2.5 μ L, dNTPs (10mmol/l) 0.5 μ L, upstream primer BLE-p1 (10 μm of ol/l) 1.0 μ L, downstream primer BLE- 0.25 the first chain template of μ L, cDNA of p2 (10 μm of ol/l) 1.0 μ L, Ex Taq archaeal dna polymerase 1.0 μ L, ddH₂O adds to 25 μ L.Instead Condition: 98 DEG C of 1min is answered, 98 DEG C of 10s, 65 DEG C of 60s, 35 circulations, 72 DEG C of 10min, 4 DEG C reaction was completed.The results show that all The amplifiable 0.3kb BLE genetic fragment out of circle 10788 recombinant bacterial strain of rhodosporidium toruloides ATCC, and the red winter spore of control strain circle Yeast ATCC 10788 is then without corresponding PCR product (Fig. 5).

Embodiment 10: the building of double expression boxes GAL1 promoter vector

1. the building of the mono- expression cassette carrier of pZPK-GAL1p-hyg-Thsp

Using the R.toruloides CGMCC2.1389 genomic DNA prepared in embodiment 3 as template, primer is utilized HSPt-H1:CGAAAGAACACCACCATCACCATCACTAGacgattccgcccc gtctcacctcgcat and HSPt-H2: GCATGCTGCAGGTCGACTCTAGAGGATCC cgcgcacttctctgcactgcatctttg, amplification obtain Thsp terminator Sequence (SEQ ID NO:11), PCR product use RF cloning process (such as after purification through DNA plastic recovery kit (purchased from raw work) Shown in embodiment 7) by the GAL1 terminator of Thsp termination sub-piece displacement PZPK-GAL1p-hyg-GAL1t carrier, it is obtained Carrier be named as PZPK-GAL1p-hyg-Thsp, structure is as shown in Figure 6.

2. the introducing of multiple cloning sites and the building of the mono- expression cassette carrier of pZPK-GAL1p-MCS-Thsp

Select pZPK-pPGK-hyg-Tnos carrier (Lin XP, Wang YN, Zhang SF, et al.Fems Yeast Res.2014,14:547-555) and the PZPK-GAL1p-HYG-Thsp carrier of previous step building in 3 enzymes not containing Enzyme site EcoR V, Nco I, Spe I design multiple cloning sites MCS (Multiple Cloning Site).It is cloned with reference to RF former The long strand primer GAL1-HSPt- that reason, directly design two are completely reversed complementation and V containing EcoR, Nco I, Spe I restriction enzyme site H1:5 '-cttgctgtgcgctgtgagacgGATATCCCATGGACTAGTacgattccgccccgtct ca-3 ' and GAL1- HSPt-H1:5 '-tgagacggggcggaatcgtACTAGTCCATGGGATATCcgtctcacagcgcacagca ag-3 ' conduct Big primer (mega-primer), equimolar are to set out with PZPK-GAL1p-HYG-Thsp carrier than RFII reaction system is added The PZPK-GAL1p- that carrier, directly progress RF II clone (as shown in Example 7) construct MCS segment displacement previous step The hyg ORF of HYG-Thsp carrier, constructed carrier are named as pZPK-GAL1p-MCS-Thsp.Structure is as shown in Figure 7.

3. the building of the double expression boxes inducible expression carrier based on GAL1 promoter

Using pZPK-GAL1p-MCS-Thsp carrier as template, primer GAL1-HSPt-p1:5 '-AGCTTGAGCTTG is utilized GATCAGATTGTCGAGGCGAATGGATCGGAAGGCATGGTCG-3 ' and GAL1-HSPt-p1:5 '-CAAACACTGATAGTT TAAACTGAAGGCGGCGCGCACTTCTCTGCACTGCATC-3 ' carries out the amplification of " GAL1p-MCS-Thsp " expression cassette, PCR Product uses RF cloning process is (as shown in Example 7) will after purification through DNA glue recovery purifying kit (purchased from raw work) " GAL1p-MCS-Thsp " expression cassette is equidirectional to be inserted in pZPK-pPGK-hyg-Tnos carrier (Lin XP, Wang YN, Zhang SF, et al.Fems Yeast Res.2014,14:547-555) " pPGK-hyg-Tnos " between expression cassette and RB, There are the intervening sequence of 100bp or so, institute between " pPGK-hyg-Tnos " expression cassette (abbreviation HYG) and " GAL1p-MCS-Thsp " The carrier of acquisition is named as PZPK-HYG-GAL1p-MCS-Thsp, and structure is as shown in Figure 8." pPGK-hyg-Tnos " of the carrier Expression cassette is for screening recon, and " GAL1p-MCS-Thsp " is then for the insertion clone of target gene and inducing expression.

Embodiment 11: expression of the fatty acid hydroxylase in lock Sporobolomyces S.pararoseus JCM 3765

Ricinoleic acid (12-hydroxy-octadeca-cis-9-enoic acid:C18:1-OH) is a kind of very valuable The essential industry raw material of value.Existing source is mainly that plant is squeezed, but resource is restricted.From pathogenic epiphyte --- Ergot (Claviceps purpurea) oleate hydroxylase gene (CpFAH, Genbank registration number: EU661785) is in micro- life Expression in object can provide a new approach for the supply of ricinoleic acid.Oleate hydroxylase base is carried out using PGAL1 promoter Because of the inducing expression of CpFAH, to realize the purpose of the synthetic castor oil acid in circle rhodosporidium toruloides.

1. the building of CpFAH galactolipin inducible expression carrier

This gene, sequence are synthesized according to the raw work full genome in CpFAH (EU661785) gene commission Shanghai reported on NCBI As shown in SEQ ID NO:12 (CpFAH).Primer CpFAH-NcoI-E1:5 '-cggCCATGGACatggcttccgctactcct Gcaatg-3 ' and CpFAH-NcoI-E2:5 '-CCGACTAGTctaGTGGTGGTGGTGGTGGTGctgagtcttcattgaaat- 3 ' be primer, carries out PCR amplification.Pcr amplification product is purified using DNA glue recovery purifying kit (purchased from raw work), and Double digestion is carried out using Nco I, Spe I, and connects the pZPK-HYG-GAL1p-MCS- into same Nco I, Spe I processing Thsp is inserted between promoter GAL1p and terminator Thsp, and the galactolipin inducing expression of success structuring fatty acid hydroxylase carries Body pZPK-HYG-GAL1p-CpFAH-Thsp, structure are as shown in Figure 9.The C-terminal for recombinantly expressing fatty acid hydroxylase introduces 6 × His Tag can be used for Western blot operation.

2. the building of the Agrobacterium tumefaciens attachment containing pZPK-HYG-GAL1p-CpFAH-Thsp carrier

Constructed pZPK-HYG-GAL1p-CpFAH-Thsp carrier is converted using electroporated method to Agrobacterium AGL1 In, picking transformant on the LB plate of Yu Hanyou 50ng/ μ L kanamycins.Kalamycin resistance Agrobacterium-mediated Transformation uses first The method of bacterium colony PCR is verified.Correct transformant is verified, AGL1/ZPK-HYG-GAL1p-CpFAH-Thsp is named as, is protected It deposits spare.

3. CpFAH is integrated into lock 3765 chromosome of Sporobolomyces S.pararoseus JCM through ATMT

Intend pink lock shadow yeast (S.pararoseus) JCM 3765 purchased from China General Microbiological culture presevation management Center (CGMCC).Take a ring activate after S.pararoseus JCM 3765, be inoculated in 5mL YEPD (glucose 20.0g/L, Yeast extract 10.0g/L, peptone 20.0g/L, pH 6.0) in, 25 DEG C, 200r/min is incubated overnight.With sterile water washing After one time, it is adjusted to OD₆₀₀=1-2, it is spare.

The recombinational agrobacterium AGL1/ZPK-HYG-GAL1p-CpFAH-Thsp that step 2 obtains is inoculated in 5mL and contains card that is mould In the LB liquid of plain (100ng/ μ L) and rifampin (80ng/ μ L), 250 DEG C, 200r/min overnight incubation.With sterile water washing one Time, it is adjusted to OD₆₀₀=1-3, it is spare.

Take it is above-mentioned intend pink lock shadow yeast JCM 3765 and each 200 μ L of Agrobacterium dilution, mix, directly drip in induction Plate (5mmol/l glucose, 0.5% glycerol, 1.45g/L potassium dihydrogen phosphate, 2.05g/L dipotassium hydrogen phosphate, 0.15g/L chlorination Sodium, 0.5g/L epsom salt, 66mg/L calcium chloride dihydrate, 2.48g/L green-vitriol, 0.5g/L ammonium sulfate, 40mmol/l MES (2- (N- morpholine) ethanesulfonic acid), 2% agar powder, 200 μm of ol/L acetosyringones) surface filter membrane on, 25 DEG C, culture 2 It.Filter membrane is transferred to galactolipin induction screening flat board (50ng/ μ L hygromycin, 300 μ g/ by aseptic nipper from IM induction plate ML cephalosporin, 1% yeast extract, 2% peptone, 1% raffinose, 2% galactolipin, 1.5 agar powders, PH 6.0) on, 30 DEG C be inverted culture 48h, until transformant occur.

4. intending the bacterium colony PCR identification of the pink lock hygromycin resistant transformed son of shadow yeast JCM 3765

6 3765 transformant of geneticin resistant S.pararoseus JCM access 50mL of random picking contain 50 μ g/mL Galactolipin induced medium (50 μ g/mL hygromycin, 300 μ g/mL cephalosporins, 1% yeast extract, 2% albumen of hygromycin Peptone, 1% raffinose, 2% galactolipin, PH 6.0) in, bead broken wall method described in reference implementation example 3 extracts genomic DNA, It uses CpFAH-NcoI-E1 and CpFAH-NcoI-E2 for primer, carries out PCR identification.The results show that CpFAH is successfully integrated into 3765 genome (not shown) of S.pararoseus JCM.

5. the fermenting experiment that pink lock shadow yeast JCM 3765 produces ricinoleic acid is intended in recombination

3 bacterium colony PCR identifications of picking correctly intend pink 3765 transformant single colonie of lock shadow yeast JCM and are connected to 5mL In YEPD culture medium (glucose 20.0g/L, yeast extract 10.0g/L, peptone 20.0g/L, pH 6.0).Culture for 24 hours, with The inoculum concentration of 1:50 is connected to galactolipin induced medium (the 50 μ g/mL hygromycin, 300 μ g/ that 50mL contains 50 μ g/mL hygromycin ML cephalosporin, 1% yeast extract, 2% peptone, 1% raffinose, 2% galactolipin, PH 6.0) in, as second level kind Son.After secondary seed culture for 24 hours, 5mL is taken to be added in the galactolipin induced medium of 45mL.Terminate fermentation after cultivating 96h.It takes 40mL zymocyte liquid is placed in 50mL round bottom centrifuge tube, and 8000r/min room temperature is centrifuged 5min and collects thallus, is washed with deionized 2 Secondary, 105 DEG C are dried for 24 hours to constant weight.It is cooling in drier after taking-up, record is then weighed, 6mL is added by 1g dry mycelium after weighing 4mL 4mol/l hydrochloric acid is added in the ratio of 4mol/l hydrochloric acid, every pipe, and 78 DEG C of water-baths digest 1h, the chlorine of 2 times of volumes is added after cooling Imitative/methanol (1:1, v/v), sufficiently oscillation mix, and are centrifuged after extracting 1h, chloroform layer is taken to be put into a new centrifuge tube.Water phase It is extracted again with isometric chloroform once, is sufficiently centrifuged after oscillation, takes chloroform layer to be put into above-mentioned new centrifuge tube and merge, and added Enter isometric 0.1% sodium chloride solution, oscillation is centrifuged after mixing.Lower layer's organic phase is carefully extracted with syringe and is injected in advance In ready glass funnel (funnel fills in degreasing cotton in advance, and appropriate anhydrous sodium sulfate is added), to organic molten in funnel In glass oil bottle below this inflow of liquid-based, suitable chloroform is added and rinses funnel 4 times, is flowed into the oil bottle of lower section together, extraction There is the chloroform of grease to carry out Grease Collection using Rotary Evaporators, the oil bottle for having collected grease is put into baking oven drying for 24 hours.

Esterification is carried out to bacterium oil: weighing the grease to be measured of 70.0mg, the CH containing 5%KOH is added₃OH solution 0.5mL, adds Heat reflux 50min, is then added BF₃Methanol solution (V_{BF3 diethyl ether solution}: V_CH3OH=4:10) 0.7mL, continues the 10min that flows back.It is cooling 1mL deionized water and 0.7mL n-hexane are added afterwards, organic phase is sucked out after mixing, is used for gas phase after deionized water is washed twice Chromatography.

6. the detection that pink lock shadow yeast JCM 3765 produces ricinoleic acid is intended in recombination

The transesterification obtained sample of step 5 is dissolved in n-hexane, using document (Meesapyodsuk, D., and Qiu, X.Plant Physiol., 2008,147,1325-1333.) method in is detected, and standard items are ricinoleic acid first Ester (CAS:141-24-2), negative control are the transesterification product of grease that wild type intends pink lock shadow yeast JCM 3765.As a result It has been shown that, be transferred to CpFAH gene intend truly have ricinoleic acid to generate in pink lock shadow yeast JCM3765, content be 280 μ g/mL, Total amount accounts for 62% or more of overall free fatty acid content.

7. CpFAH expression analysis --- Western blot in pink lock shadow yeast JCM 3765 is intended in recombination

Determine that round rhodosporidium toruloides GAL1p promoter can star oleic acid in addition to directly producing phenotype by ricinoleic acid '-hydroxylase gene is outside the expression of lock Sporobolomyces, since the end C- of oleate hydroxylase gene expression product carries 6 × His Tag also passes through the expression of immunoblotting assay oleate hydroxylase gene using anti-His Tag antibody.PCR in above-mentioned steps 4 Identify that correct 6 transformants, random picking 3 access galactolipin induced medium (the 50 μ g/mL hygromycin, 300 μ of 10mL G/mL cephalosporin, 1% yeast extract, 2% peptone, 1% raffinose, 2% galactolipin, PH 6.0) in, in 30 DEG C of shaking tables 48h is cultivated, 4000r/min is centrifuged 10min and collects bacterial strain.After thallus sterile water washing one time, the protein extraction of 400 μ L is added Buffer (8M urea, 65mM DTT, 0.1%Triton X-100,100mM NaCl, 50mM Tris-Cl, 1mM PMSF, 1mM EGTA, 1mM EDTA, pH 7.4) it is resuspended, SDS-PAGE and Western blot analysis is carried out by the step 5 of embodiment 8, The expression (Figure 10) of oleate hydroxylase can be observed.

Embodiment 12: expression of the malate dehydrogenase in Sporobolomyces Sporobolomyces roseus

Malate dehydrogenase (Malic enzyme, ME) is the main generation enzyme of NADPH, provides reducing power for oil synthesis.Such as Fruit is overexpressed the supply that malate dehydrogenase increases NADPH in the oil and fat accumulation phase, and the fat content intracellular of bacterial strain theoretically can be improved.

1. the building of the galactolipin inducible expression carrier of circle rhodosporidium toruloides malate dehydrogenase RtME

It is special according to Scaffold sequence (NCBI accession number: KB722664.1), design where circle rhodosporidium toruloides ME gene Different primer: ME-P1:5 '-atgcccgcacactttgccccctcccagc-3 ' and ME-P2:5 '- Atgcccgcacactttgccccctcccagccc-3 ', it is total with the circle rhodosporidium toruloides CGMCC 2.1389 that embodiment 1 obtains RNA is template, carries out RT-PCR by method shown in embodiment 2, amplification obtains the full length cDNA sequence containing ME.It is returned using DNA After receiving kits PCR product, it is cloned into pMD18-T carrier, is transformed into Escherichia coli (E.coli) DH5 α competent cell. It selects Amp resistant transformants and carries out Zengjing Granule, plasmid extraction.Recombinant plasmid sample send to Dalian TakaRa company and is sequenced, sequence Column result is compared with gene order-checking result, it was demonstrated that include ME encoding gene overall length, sequence as shown in SEQ ID NO:13, (RtME).The plasmid is named as T-ME.

Design primer ME-NcoI-E1:5 '-cggCCATGGACatgcccgcacactttgccccctccca Gcccctcca-3 ' and ME-NcoI-E2:5 '-CCGACTAGTctaGTGATGGTGATGGTGGTG ctgcgcctgctgct-3 ', Using T-ME as template, PCR amplification is carried out.Pcr amplification product is carried out pure using DNA glue recovery purifying kit (purchased from raw work) Change, and carry out double digestion using Nco I, Spe I, and connects the pZPK-HYG-GALp- into same Nco I, Spe I processing MCS-Thsp is inserted between promoter GAL1p and terminator Thsp, and the galactolipin inducing expression for successfully constructing malate dehydrogenase carries Body pZPK-HYG-GAL1p-ME-Thsp, shown (pZPK-HYG-GAL1p-ME-Thsp), structure is as shown in figure 11.Recombinant expression The C-terminal of fatty acid hydroxylase introduces 6 × His Tag, can be used for Western blot operation.

2. the building of the Agrobacterium tumefaciens attachment containing pZPK-HYG-GAL1p-ME-Thsp carrier

Constructed pZPK-HYG-GAL1p-ME-Thsp carrier is converted using electroporated method into Agrobacterium AGL1, in Picking transformant on LB plate containing 50ng/ μ L kanamycins.Kalamycin resistance Agrobacterium-mediated Transformation uses bacterium colony first The method of PCR is verified.Correct transformant is verified, AGL1/ZPK-HYG-GAL1p-ME-Thsp is named as, is saved backup.

3. ME is integrated into pink 8242 chromosome of shadow yeast JCM of Sporobolomyces through ATMT

Pink shadow yeast (Sporobolomyces roseus) JCM 8242 is purchased from Japanese Microbiological Culture Collection The heart (JCM).S.roseus JCM 8242 after taking a ring to activate, being inoculated in 5mL YEPD, (glucose 20.0g/L, yeast extract Object 10.0g/L, peptone 20.0g/L, pH 6.0) in, 25 DEG C, 200r/min is incubated overnight.After sterile water washing one time, adjust It saves to OD₆₀₀=1-2, it is spare.

It is containing kanamycin that the recombinational agrobacterium AGL1/ZPK-HYG-GAL1p-ME-Thsp that step 2 obtains is inoculated in 5mL In the LB liquid of (100ng/ μ L) and rifampin (80ng/ μ L), 250 DEG C, 200r/min overnight incubation.With sterile water washing one Time, it is adjusted to OD₆₀₀=1-3, it is spare.

Above-mentioned pink shadow yeast JCM 8242 and each 200 μ L of Agrobacterium dilution is taken, is mixed, by 13 step 3 of embodiment ATMT operation is carried out, until transformant occurs.

4. the bacterium colony PCR of the hygromycin resistant transformed son of pink shadow yeast JCM 8242 is identified

6 8242 transformant of geneticin resistant S.roseus JCM access 50mL of random picking contain 50ng/ μ L heredity Galactolipin induced medium (50 μ g/mL hygromycin, 300 μ g/mL cephalosporins, 1% yeast extract, 2% albumen of mycin Peptone, 1% raffinose, 2% galactolipin, PH 6.0), bead broken wall method described in reference implementation example 3 extracts genomic DNA, adopts It is primer with ME-NcoI-E1 and ME-NcoI-E2, carries out PCR identification.The results show that ME encoding gene is successfully integrated into 8242 genome (not shown) of S.roseus JCM.

5. recombinating pink 8242 oil fermentation of shadow yeast S.roseus JCM

3 bacterium colony PCR of picking identify correctly pink 8242 transformant single colonie of shadow yeast JCM, by 11 step of embodiment Method shown in rapid 5 is fermented, grease intracellular extracts and analysis.The results show that compared with wild strain S.roseus JCM 8242, the fat content intracellular of recombination S.roseus JCM 8242 for being overexpressed round rhodosporidium toruloides malate dehydrogenase is mentioned by 25% Height increases 80% to 45%.

6. recombinating ME expression analysis --- Western blot in S.roseus JCM 8242

Determine that it is red that round rhodosporidium toruloides GAL1p promoter can star circle in addition to directly increasing performance by oil and fat accumulation Winter spore yeast malate dehydrogenase (RtME) gene is outside the expression of lock Sporobolomyces, since the end C- of RtME expression product carries 6 × His Tag also passes through the expression of immunoblotting assay ME using anti-His Tag antibody.PCR is identified just in above-mentioned steps 4 6 true transformants, random picking 3 access galactolipin induced medium (the 50 μ g/mL hygromycin, 300 μ g/mL heads of 10mL Spore rhzomorph, 1% yeast extract, 2% peptone, 1% raffinose, 2% galactolipin, PH 6.0), in 30 DEG C of shaking table culture 48h, 4000r/min is centrifuged 10min and collects bacterial strain.After thallus sterile water washing one time, the protein extract buffer of 400 μ L is added (8M urea, 65mM DTT, 0.1%Triton X-100,100mM NaCl, 50mM Tris-Cl, 1mM PMSF, 1mM EGTA, 1mM EDTA, pH 7.4) it is resuspended, SDS-PAGE and Western blot analysis, equal observable are carried out by the step 5 of embodiment 8 To the expression (Figure 12) of RtME.

Galactolipin inducing expression of the embodiment 13:GFP in Rhodotorula rhodothece rubra CGMCC 2.279

It is unintelligible in view of rhodothece rubra genetic background, own promoter can not be separated and terminate subcomponent progress target gene Expression, this technology invention establishes rhodothece rubra heredity behaviour using circle rhodosporidium toruloides GALp promoter and Thsp terminator Make system, realizes inducing expression of the GFP in rhodothece rubra CGMCC 2.279.

1. the building of GFP galactolipin inducible expression carrier

According to the amino acid sequence (AFA52654.1) of the GFP reported on NCBI, by circle rhodosporidium toruloides codon preference Property optimize, the raw work full genome in commission Shanghai synthesizes its gene, and sequence is as shown in SEQ ID NO:16 (GFP).Primer GFP- NcoI-E1:5 '-cggCCATGGACatgtcgaagggtgaggagcttttc-3 ' and GFP-NcoI-E2:5 '-CCGACTAGTc TaGTGGTGGTGGTGGTGGTGcttgtagagttcgtccatgccgtg-3 ' is primer, carries out PCR amplification.Pcr amplification product It is purified using DNA glue recovery purifying kit (purchased from raw work), and carries out double digestion using Nco I, Spe I, and connect The pZPK-HYG-GAL1p-MCS-Thsp for entering same Nco I, Spe I processing, is inserted in promoter GAL1p and terminator Thsp Between, the galactolipin inducible expression carrier pZPK-HYG-GAL1p-GFP-Thsp of green fluorescent protein is successfully constructed, structure is as schemed Shown in 13.The C-terminal for recombinantly expressing green fluorescent protein introduces 6 × His Tag, can be used for Western blot operation.

2. the building of the Agrobacterium tumefaciens attachment containing pZPK-HYG-GAL1p-GFP-Thsp carrier

Constructed pZPK-HYG-GAL1p-GFP-Thsp carrier is converted using electroporated method into Agrobacterium AGL1, In picking transformant on the LB plate containing 50ng/ μ L kanamycins.Kalamycin resistance Agrobacterium-mediated Transformation uses bacterium first The method for falling PCR is verified.Correct transformant is verified, AGL1/ZPK-HYG-GAL1p-GFP-Thsp is named as, is saved standby With.

3. GFP is integrated into 2.279 chromosome of rhodothece rubra CGMCC through ATMT

Rhodothece rubra (Rhodotorula rubra) CGMCC 2.279 is purchased from barms collection (purchased from China General Microbiological Culture preservation administrative center (CGMCC).Rhodothece rubra CGMCC 2.279 after taking a ring to activate, is inoculated in 5mL In YEPD (glucose 20.0g/L, yeast extract 10.0g/L, peptone 20.0g/L, pH 6.0), 25 DEG C, 200r/min mistake Night culture.After sterile water washing one time, it is adjusted to OD₆₀₀=1-2, it is spare.

It is containing kanamycin that the recombinational agrobacterium AGL1/ZPK-HYG-GAL1p-GFP-Thsp that step 2 obtains is inoculated in 5mL In the LB liquid of (100ng/ μ L) and rifampin (80ng/ μ L), 250 DEG C, 200r/min overnight incubation.With sterile water washing one Time, it is adjusted to OD₆₀₀=1-3, it is spare.

Take above-mentioned rhodothece rubra CGMCC 2.279 and each 200 μ L of Agrobacterium dilution, mix, by 13 step 3 of embodiment into Row ATMT operation, until transformant occurs.

4. the bacterium colony PCR of the hygromycin resistant transformed son of rhodothece rubra CGMCC 2.279 is identified

6 2.279 transformant of geneticin resistant rhodothece rubra CGMCC access 50mL of random picking contain 50ng/ μ L something lost Pass galactolipin induced medium (50 μ g/mL hygromycin, 300 μ g/mL cephalosporins, 1% yeast extract, 2% albumen of mycin Peptone, 1% raffinose, 2% galactolipin, PH 6.0), bead broken wall method described in reference implementation example 3 extracts genomic DNA, adopts It is primer with GFP-NcoI-E1 and GFP-NcoI-E2, carries out PCR identification.The results show that GFP gene be successfully integrated into it is dark red 2.279 genome (not shown) of yeast CGMCC.

5. the Fluirescence observation of the hygromycin resistant transformed son of rhodothece rubra CGMCC 2.279

3 bacterium colony PCR of picking identify that the correct hygromycin resistant transformed sub- single colonie of rhodothece rubra CGMCC 2.279 is connected to In 5mL YEPD culture medium (glucose 20.0g/L, yeast extract 10.0g/L, peptone 20.0g/L, pH 6.0).Culture For 24 hours, with the inoculum concentration of 1:50 be connected to galactolipin induced medium that 50mL contains 50ng/ μ L hygromycin (50 μ g/mL hygromycin, 300 μ g/mL cephalosporins, 1% yeast extract, 2% peptone, 1% raffinose, 2% galactolipin, PH 6.0), as second level Seed.After secondary seed culture for 24 hours, 5mL is taken to be added in the galactolipin induced medium of 45mL.Terminate fermentation after cultivating 48h.It takes 10 μ L point of bacterium solution in glass slide, covered be placed on fluorescence microscope carry out green fluorescence observation, excitation wavelength 498nm, Launch wavelength 516, green fluorescence can be observed in GFP recombination rhodothece rubra, and compares wild type rhodothece rubra CGMCC 2.279 then There is (not shown) in unstressed configuration.

6. recombinating GFP expression analysis --- Western blot in rhodothece rubra CGMCC 2.279

In addition to directly determining that round rhodosporidium toruloides GAL1p promoter can star GFP red by green fluorescence phenotype Outside the expression of saccharomyces rhodothece rubra, since the end C- of recombination GFP carries 6 × His Tag, also using anti-His Tag antibody Pass through the expression of immunoblotting assay GFP.PCR identifies correct 6 transformants, random picking 3, access in above-mentioned steps 4 Galactolipin induced medium (50 μ g/mL hygromycin, 300 μ g/mL cephalosporins, 1% yeast extract, 2% albumen of 10mL Peptone, 1% raffinose, 2% galactolipin, PH 6.0), 10min collection bacterial strain is centrifuged in 30 DEG C of shaking table cultures 48h, 4000r/min. After thallus sterile water washing one time, protein extract buffer (8M urea, the 65mM DTT, 0.1%Triton of 400 μ L is added X-100,100mM NaCl, 50mM Tris-Cl, 1mM PMSF, 1mM EGTA, 1mM EDTA, pH 7.4) it is resuspended, by implementation The step 5 of example 8 carries out SDS-PAGE and Western blot analysis, and the expression (Figure 14) of GFP can be observed.

Galactolipin inducing expression of the embodiment 14:GFP in Rhodotorula rhodotorula mucilaginosa CGMCC 2.22

It is unintelligible in view of rhodotorula mucilaginosa (Rhodotorula mucilaqinosa) genetic background, itself starting can not be separated Son and the expression for terminating subcomponent progress target gene, this technology invention utilize circle rhodosporidium toruloides GAL1p promoter and Thsp Terminator establishes rhodothece rubra genetic manipulation system, realizes inducing expression of the GFP in rhodotorula mucilaginosa CGMCC 2.22.

1. GFP is integrated into 2.22 chromosome of rhodotorula mucilaginosa CGMCC through ATMT

The recombination agriculture bar AGL1/ZPK-HYG-GAL1p-GFP-Thsp that 13 step 2 of embodiment obtains is inoculated in 5mL and contains card In the LB liquid of that mycin (100ng/ μ L) and rifampin (80ng/ μ L), 250 DEG C, 200r/min overnight incubation.With sterile washing It washs one time, is adjusted to OD₆₀₀=1-3, it is spare.

Rhodotorula mucilaginosa CGMCC 2.22 (is purchased from China General Microbiological culture presevation pipe purchased from barms collection Reason center (CGMCC).Take a ring activate after rhodotorula mucilaginosa CGMCC 2.22, be inoculated in 5mL YEPD (glucose 20.0g/L, Yeast extract 10.0g/L, peptone 20.0g/L, pH 6.0) in, 25 DEG C, 200r/min is incubated overnight.With sterile water washing After one time, it is adjusted to OD₆₀₀=1-2, it is spare.

Take above-mentioned rhodotorula mucilaginosa CGMCC 2.22 and each 200 μ L of Agrobacterium dilution, mix, by 13 step 3 of embodiment into Row ATMT operation, until transformant occurs.

2. the bacterium colony PCR of the hygromycin resistant transformed son of rhodotorula mucilaginosa CGMCC 2.22 is identified

6 2.279 transformant of geneticin resistant rhodothece rubra CGMCC access 50mL of random picking contain 50ng/ μ L something lost Pass galactolipin induced medium (50 μ g/mL hygromycin, 300 μ g/mL cephalosporins, 1% yeast extract, 2% albumen of mycin Peptone, 1% raffinose, 2% galactolipin, PH 6.0), bead broken wall method described in reference implementation example 3 extracts genomic DNA, adopts It is primer with GFP-NcoI-E1 and GFP-NcoI-E2, carries out PCR identification.The results show that be successfully integrated into glue red for GFP gene 2.22 genome (not shown) of yeast CGMCC.

3. the Fluirescence observation of the hygromycin resistant transformed son of rhodotorula mucilaginosa CGMCC 2.22

3 bacterium colony PCR of picking identify the correct hygromycin resistant transformed sub- single colonie of rhodotorula mucilaginosa CGMCC 2.22 by real It applies 13 step 5 of example and carries out strain culturing and micro- sem observation, green fluorescence can be observed in GFP recombination rhodotorula mucilaginosa, and compares wild Then there is (not shown) to raw type rhodotorula mucilaginosa CGMCC 2.22 in unstressed configuration.

4. recombinating GFP expression analysis --- Western blot in rhodotorula mucilaginosa CGMCC 2.22

In addition to directly determining that round rhodosporidium toruloides PGAL1 promoter can star GFP red by green fluorescence phenotype Outside the expression of saccharomyces rhodotorula mucilaginosa CGMCC 2.22, since the end C- of recombination GFP carries 6 × His Tag, also using anti- His Tag antibody passes through the expression of immunoblotting assay GFP.PCR identifies correct 6 transformants in above-mentioned steps 3, chooses at random 3 are taken, galactolipin induced medium (50 μ g/mL hygromycin, 300 μ g/mL cephalosporins, the extraction of 1% yeast of 10mL are accessed Object, 2% peptone, 1% raffinose, 2% galactolipin, PH 6.0), 10min is centrifuged in 30 DEG C of shaking table cultures 48h, 4000r/min Collect bacterial strain.After thallus sterile water washing one time, be added 400 μ L protein extract buffer (8M urea, 65mM DTT, 0.1%Triton X-100,100mM NaCl, 50mMTris-Cl, 1mM PMSF, 1mM EGTA, 1mM EDTA, pH 7.4) It is resuspended, carries out SDS-PAGE and Western blot analysis by the step 5 of embodiment 8, the expression (figure of GFP can be observed 15)。

Embodiment 15: expression of the fatty acid hydroxylase in Rhodotorula Rhodotorula marina

Oleate hydroxylase gene (CpFAH, Genbank registration number: EU661785) from ergot starts in PGAL1 Synthesis of the ricinoleic acid by the sea in rhodotorula is realized under son starting.

1. CpFAH is integrated into 2.4203 chromosome of Rhodotorula marina CGMCC through ATMT

The AGL1/ZPK-HYG-GAL1p-CpFAH-Thsp recombinational agrobacterium that 11 step 2 of embodiment obtains, is inoculated in 5mL In the LB liquid of (100ng/ μ L) and rifampin (80ng/ μ L) containing kanamycin, 250 DEG C, 200r/min overnight incubation.With nothing Bacterium water washing one time, it is adjusted to OD₆₀₀=1-3, it is spare.

Rhodotorula marina (Rhodotorula marina) CGMCC 2.4203 (is purchased from purchased from barms collection China General Microbiological culture presevation administrative center (CGMCC).Rhodotorula marina CGMCC 2.4203 after taking a ring to activate, connects Kind is in 5mL YEPD (glucose 20.0g/L, yeast extract 10.0g/L, peptone 20.0g/L, pH 6.0), and 25 DEG C, 200r/min is incubated overnight.After sterile water washing one time, it is adjusted to OD₆₀₀=1-2, it is spare.

Take above-mentioned quasi- Rhodotorula marina CGMCC 2.4203 and each 200 μ L of Agrobacterium dilution, by 13 step 3 of embodiment into Row ATMT operation, until transformant occurs.

2. the bacterium colony PCR of the hygromycin resistant transformed son of Rhodotorula marina CGMCC 2.4203 is identified

6 2.4203 transformant of geneticin resistant Rhodotorula marina CGMCC access 50mL of random picking contain 50ng/ μ Galactolipin induced medium (50 μ g/mL hygromycin, 300 μ g/mL cephalosporins, 1% yeast extract, 2% egg of L hygromycin White peptone, 1% raffinose, 2% galactolipin, PH 6.0), bead broken wall method described in reference implementation example 3 extracts genomic DNA, It uses CpFAH-NcoI-E1 and CpFAH-NcoI-E2 for primer, carries out PCR identification.The results show that CpFAH is successfully integrated into 2.4203 genome (not shown) of Rhodotorula marina CGMCC.

3. recombinating the fermenting experiment that Rhodotorula marina CGMCC 2.4203 produces ricinoleic acid

3 bacterium colony PCR of picking identify that correct 2.4203 transformant single colonie of Rhodotorula marina CGMCC is connected to 5mL In YEPD culture medium (glucose 20.0g/L, yeast extract 10.0g/L, peptone 20.0g/L, pH 6.0).Culture for 24 hours, with The inoculum concentration of 1:50 is connected to galactolipin induced medium (the 50 μ g/mL hygromycin, 300 μ g/ that 50mL contains 50ng/ μ L hygromycin ML cephalosporin, 1% yeast extract, 2% peptone, 1% raffinose, 2% galactolipin, PH 6.0), as secondary seed. After secondary seed culture for 24 hours, 5mL is taken to be added in the galactolipin induced medium of 45mL.Terminate fermentation after cultivating 96h.Take 40mL Zymocyte liquid is placed in 50mL round bottom centrifuge tube, and 8000r/min room temperature is centrifuged 5min and collects thallus, is washed with deionized 2 times, 105 DEG C are dried for 24 hours to constant weight.Grease extraction is carried out by method shown in embodiment 11 after taking-up and bacterium oil is transesterification.

4. recombinating the detection that Rhodotorula marina CGMCC 2.4203 produces ricinoleic acid

The transesterification obtained sample of step 7 is dissolved in n-hexane, using document (Meesapyodsuk, D., and Qiu, X.Plant Physiol., 2008,147,1325-1333.) method in is detected, and standard items are ricinoleic acid first Ester (CAS:141-24-2), negative control are the transesterification product of grease of wild type Rhodotorula marina CGMCC 2.4203.As a result it shows Show, be transferred in the Rhodotorula marina of CpFAH gene and ricinoleic acid is truly had to generate, content is 292 μ g/mL, and total amount accounts for overall free 63% or more of content of fatty acid.

5. recombinating CpFAH expression analysis --- Western blot in Rhodotorula marina CGMCC 2.4203

Determine that round rhodosporidium toruloides GAL1p promoter can star oleic acid in addition to directly producing phenotype by ricinoleic acid '-hydroxylase gene is by the sea outside the expression of rhodotorula CGMCC 2.4203, since the end C- of oleate hydroxylase gene expression product is taken Band 6 × His Tag also passes through the expression of immunoblotting assay oleate hydroxylase gene using anti-His Tag antibody.Above-mentioned step PCR identifies that correct 6 transformants, random picking 3 access galactolipin induced medium (the 50 μ g/mL tides of 10mL in rapid 4 Mycin, 300 μ g/mL cephalosporins, 1% yeast extract, 2% peptone, 1% raffinose, 2% galactolipin, PH 6.0), in 30 DEG C of shaking table cultures 48h, 4000r/min are centrifuged 10min collection bacterial strain.After thallus sterile water washing one time, it is added 400 μ L's Protein extract buffer (8M urea, 65mM DTT, 0.1%Triton X-100,100mM NaCl, 50mM Tris-Cl, 1mM PMSF, 1mM EGTA, 1mM EDTA, pH 7.4) it is resuspended, SDS-PAGE and Western is carried out by the step 5 of embodiment 8 Blot analysis, can be observed the expression (not shown) of oleate hydroxylase.

Embodiment 16: expression of the inulinase in Rhodotorula grass rhodotorula CGMCC 2.4202

Inulin is polyfructosan, and there are about 30000 various plants to contain Inulin polysaccharide in nature, and the world of inulin produces per year Amount is the second largest plant carbohydrates for being only second to starch up to 350000 tons.In the industry and as biomass material It is witloof and jerusalem artichoke using more production inulin plant.These biomass are generated by exoinulinase processing can be by a variety of micro- lifes The fructose and a small amount of glucose that object utilizes.This technology invention utilizes circle rhodosporidium toruloides GAL1p promoter and Thsp terminator, Grass rhodotorula genetic manipulation system is established, realizes exoinulinase in grass rhodotorula (Rhodotorula Graminis) the inducing expression in CGMCC 2.4202.

1. the building of inulinase galactolipin inducible expression carrier

According to kluyveromyces marxianus exoinulinase amino acid sequence in 2007100159198.8 patent of ZL, according to Circle rhodosporidium toruloides codon preference optimizes, and the raw work in commission Shanghai carries out full genome synthesis, sequence such as SEQ ID NO: (INU) shown in 17.Design primer INU-NcoI-E1:5 '-cggCCATGGACatgcgcttcgcgtactccctcttgctc-3 ' And INU-NcoI-E2:5 '-CCGACTAGTctaGTGATGGTGATGGTGGTGgaggttgaactgggtgacgttg-3 ', with complete Synthesis INU gene is template, carries out PCR amplification.Pcr amplification product using DNA glue recovery purifying kit (purchased from raw work) into Row purifying, and double digestion is carried out using Nco I, Spe I, and connect the pZPK-HYG- into same Nco I, Spe I processing GAL1p-MCS-Thsp is inserted between promoter GAL1p and terminator Thsp, and the galactolipin for successfully constructing inulinase induces table Up to carrier pZPK-HYG-GAL1p-INU-Thsp, structure is as shown in figure 16.The C-terminal introducing 6 of recombinant expression fatty acid hydroxylase × His Tag can be used for Western blot operation.

2. the building of the Agrobacterium tumefaciens attachment containing pZPK-HYG-GAL1p-INU-Thsp carrier

Constructed pZPK-HYG-GAL1p-INU-Thsp carrier is converted using electroporated method into Agrobacterium AGL1, In picking transformant on the LB plate containing 50ng/ μ L kanamycins.Kalamycin resistance Agrobacterium-mediated Transformation uses bacterium first The method for falling PCR is verified.Correct transformant is verified, AGL1/ZPK-HYG-GAL1p-INU-Thsp is named as, is saved standby With.

3. INU is integrated into 2.4202 chromosome of grass rhodotorula CGMCC through ATMT

Grass rhodotorula CGMCC 2.4202 is purchased from Japanese Culture Collection (JCM).After taking a ring to activate Grass rhodotorula CGMCC 2.4202, be inoculated in 5mL YEPD (glucose 20.0g/L, yeast extract 10.0g/L, albumen Peptone 20.0g/L, pH 6.0) in, 25 DEG C, 200r/min is incubated overnight.After sterile water washing one time, it is adjusted to OD₆₀₀=1-2, It is spare.

It is containing kanamycin that the recombinational agrobacterium AGL1/ZPK-HYG-PGAL1-INU-Thsp that step 2 obtains is inoculated in 5mL In the LB liquid of (100ng/ μ L) and rifampin (80ng/ μ L), 250 DEG C, 200r/min overnight incubation.With sterile water washing one Time, it is adjusted to OD₆₀₀=1-3, it is spare.

Above-mentioned grass rhodotorula CGMCC 2.4202 and each 200 μ L of Agrobacterium dilution is taken, is mixed, by 13 step of embodiment 3 carry out ATMT operation, until transformant occurs.

4. the bacterium colony PCR of the hygromycin resistant transformed son of grass rhodotorula CGMCC 2.4202 is identified

6 2.4202 transformant of geneticin resistant grass rhodotorula CGMCC access 50mL of random picking contain 50ng/ μ Galactolipin induced medium (50 μ g/mL hygromycin, 300 μ g/mL cephalosporins, 1% yeast extract, 2% egg of L hygromycin White peptone, 1% raffinose, 2% galactolipin, PH 6.0), bead broken wall method described in reference implementation example 3 extracts genomic DNA, It uses INU-NcoI-E1 and INU-NcoI-E2 for primer, carries out PCR identification.The results show that ME encoding gene is successfully integrated into Enter 2.4202 genome (not shown) of grass rhodotorula CGMCC.

5. carrying out recombination grass rhodotorula oil fermentation by carbon source of inulin

3 bacterium colony PCR of picking identify that correct 2.4202 transformant single colonie of grass rhodotorula CGMCC is connected to 5mL In YEPD culture medium (glucose 20.0g/L, yeast extract 10.0g/L, peptone 20.0g/L, pH 6.0).Culture for 24 hours, with The inoculum concentration of 1:50 is connected to galactolipin induced medium (the 50 μ g/mL hygromycin, 300 μ g/ that 50mL contains 50ng/ μ L hygromycin ML cephalosporin, 1% yeast extract, 2% peptone, 1% raffinose, 2% galactolipin, PH 6.0), as secondary seed. After secondary seed culture for 24 hours, take 10mL that inulin/galactolipin induced medium (the 50 μ g/mL hygromycin, 300 μ g/ of 45mL are added ML cephalosporin, 1% yeast extract, 2% peptone, 4% inulin, 2% galactolipin, PH 6.0) in.Terminate after culture 96h Fermentation.40mL zymocyte liquid is taken to be placed in 50mL round bottom centrifuge tube, 8000r/min room temperature is centrifuged 5min and collects thallus, uses deionization Water washing 2 times, 105 DEG C are dried for 24 hours to constant weight.Grease extraction is carried out by the step 5 of embodiment 11 later.The results show that wild mushroom Strain grass rhodotorula CGMCC 2.4202 is being the oil intracellular that 21% can be accumulated when sole carbon source carries out fermentation 96h using inulin Rouge, and being overexpressed the recombination grass rhodotorula of exoinulinase using inulin is oil intracellular when sole carbon source carries out fermentation 96h Rouge content is then 52%, can convert inulin directly as grease intracellular.

6. recombinating INU expression analysis --- Western blot in grass rhodotorula CGMCC 2.4202

In addition to directly determining that round rhodosporidium toruloides PGAL1 promoter can star circumscribed inulin using phenotype by inulin Enzyme is outside the expression of Rhodotorula, since the end C- of recombination INU expression product carries 6 × His Tag, also using anti-His Tag antibody passes through the expression of immunoblotting assay ME.PCR identifies correct 6 transformants, random picking 3 in above-mentioned steps 4 It is a, access 10mL galactolipin induced medium (50 μ g/mL hygromycin, 300 μ g/mL cephalosporins, 1% yeast extract, 2% peptone, 1% raffinose, 2% galactolipin, PH 6.0), 10min receipts are centrifuged in 30 DEG C of shaking table cultures 48h, 4000r/min Collect bacterial strain.After thallus sterile water washing one time, be added 400 μ L protein extract buffer (8M urea, 65mM DTT, 0.1% Triton X-100,100mM NaCl, 50mM Tris-Cl, 1mM PMSF, 1mM EGTA, 1mM EDTA, pH 7.4) it is resuspended, SDS-PAGE and Western blot analysis is carried out by the step 5 of embodiment 8, the expression (not shown) of INU can be observed.

Galactolipin inducing expression of the embodiment 17:GFP in Rhodotorula rhodotorula glutinis

This technology invention establishes rhodotorula glutinis using circle rhodosporidium toruloides GAL1p promoter and Thsp terminator (Rhodotorula glutinis) genetic manipulation system, realizes inducing expression of the GFP in rhodotorula glutinis NCYC 2666.

1. GFP is integrated into 2666 chromosome of rhodotorula glutinis NCYC through ATMT

The recombination agriculture bar AGL1/ZPK-HYG-GAL1p-GFP-Thsp that 13 step 2 of embodiment obtains is inoculated in 5mL and contains card In the LB liquid of that mycin (100ng/ μ L) and rifampin (80ng/ μ L), 250 DEG C, 200r/min overnight incubation.With sterile washing It washs one time, is adjusted to OD₆₀₀=1-3, it is spare.

Rhodotorula glutinis NCYC 2666 is purchased from United Kingdom National barms collection (National Collection Of Yeast Cultures, NCYC).Rhodotorula glutinis NCYC 2666 after taking a ring to activate, is inoculated in 5mL YEPD (glucose 20.0g/L, yeast extract 10.0g/L, peptone 20.0g/L, pH 6.0) in, 25 DEG C, 200r/min is incubated overnight.With nothing After bacterium water washing one time, it is adjusted to OD₆₀₀=1-2, it is spare.

Above-mentioned rhodotorula glutinis NCYC 2666 and each 200 μ L of Agrobacterium dilution is taken, is mixed, is carried out by 13 step 3 of embodiment ATMT operation, until transformant occurs.

2. the bacterium colony PCR of the hygromycin resistant transformed son of rhodotorula glutinis NCYC 2666 is identified

It is mould that 6 2666 transformant of geneticin resistant rhodotorula glutinis NCYC access 50mL of random picking contain 50ng/ μ L tide Element galactolipin induced medium (50 μ g/mL hygromycin, 300 μ g/mL cephalosporins, 1% yeast extract, 2% peptone, 1% raffinose, 2% galactolipin, PH 6.0), bead broken wall method described in reference implementation example 3 extracts genomic DNA, uses GFP-NcoI-E1 and GFP-NcoI-E2 is primer, carries out PCR identification.The results show that GFP gene, which is successfully integrated into, glues red ferment Female 2666 genome (not shown) of NCYC.

3. the Fluirescence observation of the hygromycin resistant transformed son of rhodotorula glutinis NCYC 2666

3 bacterium colony PCR of picking identify that the correct hygromycin resistant transformed sub- single colonie of rhodotorula glutinis NCYC 2666 is connected to In 5mL YEPD culture medium (glucose 20.0g/L, yeast extract 10.0g/L, peptone 20.0g/L, pH 6.0).Culture For 24 hours, with the inoculum concentration of 1:50 be connected to galactolipin induced medium that 50mL contains 50ng/ μ L hygromycin (50 μ g/mL hygromycin, 300 μ g/mL cephalosporins, 1% yeast extract, 2% peptone, 1% raffinose, 2% galactolipin, PH 6.0), as second level Seed.After secondary seed culture for 24 hours, 5mL is taken to be added in the galactolipin induced medium of 45mL.Terminate fermentation after cultivating 48h.It takes 10 μ L point of bacterium solution in glass slide, covered be placed on fluorescence microscope carry out green fluorescence observation, excitation wavelength 498nm, Launch wavelength 516, green fluorescence can be observed in GFP recombination rhodotorula glutinis NCYC2666, and compares wild type rhodotorula glutinis NCYC There is (not shown) in 2666 unstressed configurations.

4. recombinating GFP expression analysis --- Western blot in rhodotorula mucilaginosa CGMCC 2.22

In addition to directly determining that round rhodosporidium toruloides GAL1p promoter can star GFP red by green fluorescence phenotype Outside the expression of saccharomyces rhodotorula mucilaginosa CGMCC 2.22, since the end C- of recombination GFP carries 6 × His Tag, also using anti- His Tag antibody passes through the expression of immunoblotting assay GFP.PCR identifies correct 6 transformants in above-mentioned steps 4, chooses at random 3 are taken, galactolipin induced medium (50 μ g/mL hygromycin, 300 μ g/mL cephalosporins, the extraction of 1% yeast of 10mL are accessed Object, 2% peptone, 1% raffinose, 2% galactolipin, PH 6.0), 10min is centrifuged in 30 DEG C of shaking table cultures 48h, 4000r/min Collect bacterial strain.After thallus sterile water washing one time, be added 400 μ L protein extract buffer (8M urea, 65mM DTT, 0.1%Triton X-100,100mM NaCl, 50mMTris-Cl, 1mM PMSF, 1mM EGTA, 1mM EDTA, pH 7.4) It is resuspended, carries out SDS-PAGE and Western blot analysis by the step 5 of embodiment 8, the expression that GFP can be observed (is not shown Show).

Claims (11)

1. a kind of galactokinase enzyme promoters, it is characterised in that: nucleotide sequence is as shown in SEQ ID NO:1.

2. a kind of DNA expression cassette of the nucleotide sequence containing galactokinase enzyme promoters described in claim 1.

3. DNA expression cassette according to claim 2, it is characterised in that: also containing nucleotides sequence shown in SEQ ID NO:2 Column are used as terminator, and wherein sequence shown in SEQ ID NO:1 is located at the upstream of sequence shown in SEQ ID NO:2, SEQ ID It is the open reading frame of coding target gene between NO:1 and SEQ ID NO:2.

4. DNA expression cassette described in accordance with the claim 3, it is characterised in that: the open reading frame of the coding target gene CDNA sequence nucleotide sequence as shown in SEQ ID NO:4.

5. a kind of recombinant vector comprising DNA expression cassette described in any one of claim 2-4.

6. recombinant vector according to claim 5, it is characterised in that: the carrier is sequestered or integrating vector.

7. recombinant vector according to claim 6, it is characterised in that: the integrating vector is the double base of mediated by agriculture bacillus Expression vector, or to carry the homologous recombination vector of target gene flank 1500-4000 base homologous recombination arm；It is homologous heavy Group carrier or the episomal vector are selected from E. coli cloning vector or yeast shuttle vector.

8. recombinant vector according to claim 6, it is characterised in that: the carrier be PZPK, pZP2000, pMD18-T, PUC18, pYES2c/t or pYX212.

9. a kind of host cell comprising the described in any item recombinant vectors of claim 5-8.

10. host cell according to claim 9, it is characterised in that: the host cell is Bacillus coli cells or ferment Mother cell.

11. a kind of expression system for oleaginous yeast genetic expression, it is characterised in that: the expression system includes:

(1) improvement expressed in saccharomyces, Sporobolomyces and Rhodotorula bacterial strain can be thrown in Rhodosporidium, lock to carry Body, the improved carrier is by that can be inserted into SEQ ID in integrant expression or the plasmid of free expression in above-mentioned saccharomyces The building of terminator sequence shown in promoter sequence shown in NO:1 and SEQ ID NO:2 obtains, wherein shown in SEQ ID NO:1 Promoter sequence be located at the upstream of terminator sequence shown in SEQ ID NO:2, sequence and SEQ shown in SEQ ID NO:1 It is multiple cloning sites between sequence shown in ID NO:2, and the carrier also includes selected marker；With

(2) target gene open reading frame sequence can operably be inserted into improved carrier described in (1), and make Promoter and terminator in improved carrier described in the target gene and (1) meet the connection of reading frame, and

(3) Rhodosporidium, lock throw saccharomyces, Sporobolomyces and Rhodotorula bacterial strain.