CN105624161A - Seed and cotton fiber preferential expression promoter PSDP_d and application thereof - Google Patents

Abstract

The invention belongs to the technical field of gene engineering, and particularly relates to a seed and cotton fiber preferential expression promoter PSDP_d and application thereof to provide a new option for improving cotton varieties. According to the technical scheme, the nucleotide sequence of the seed and cotton fiber preferential expression promoter PSDP_d is shown as SEQ ID No.1. The seed and cotton fiber preferential expression promoter PSDP_d further includes an expression carrier with the nucleotide sequence shown as SEQ ID No.1, and a host comprising the expression carrier. The invention further relates to application of the promoter. The promoter can be used for genetic improvement on plant seeds or cotton fibers.

Description

A kind of seed and cotton fiber predominant expression promotor PSDP_d and application thereof

Technical field

The invention belongs to gene engineering technology field, specifically relate to promotor and the application thereof of a kind of seed and cotton fiber predominant expression.

Background technology

Cotton (GossypiumhirsutumL.) is the first big natural fiber crop in the world, and as important textile raw material, cotton fibre has important economic worth. Cotton is again the most important oil crops, and according to statistics, cotton is the big oil crops of China the 3rd, the big oil crops in the world the 6th. The output of cotton in nearly ten years (2004��2013) whole nation is stabilized between 6,000,000 tons to 7,500,000 tons (China Statistical Yearbook 2014), the whole nation about has the cottonseed output of 1500��1,800 ten thousand tons every year, containing abundant protein and fat in cottonseed, it it is a huge available stock.

Cotton fibre is the specific a kind of seed coat cell of cotton, be from ovule epidermic cell differentiate unicellular, this characteristic just determines cotton seeds and grows the indivisible relation between growing with fiber. Cotton fiber is important textile industry raw material, and China is cotton textiles consumption and big export country, and therefore, Cotton Production occupies important status in Chinese national economy. The fibrous quality of Cotton in China kind can be improved rapidly, it is directly connected to the survival and development of the industry such as the ups and downs and textile production processing, Weaving device manufacture, foreign export of Cotton in China industry. Although utilizing traditional breeding method once to achieve very big success in cotton variety improvement, but over nearly 20 years, World cotton kind has reached a plateau in output, utilizes existing genetic resources and breeding technique to be difficult to increase substantially output of cotton (MeredithW.R.BetterCrops200084 (4): 6��9) again. Simple dependence conventional breeding improving cotton fiber quality is quite difficult.

This is because: 1) the quality trait gene such as cotton fiber brute force, fineness and lint yield exist negative chain, and conventional breeding method is difficult to the negative correlation broken in this kind of heredity; 2) cotton cultivar of China mainly upland cotton, and fine fiber Quality Gene mainly comes from the sea island cotton (fibre strength and fineness) etc. of plucked instrument Bai Shi cotton (fibre strength) of diploid, Gossypium anomalum (fibre strength and fineness) and tetraploid, these excellent property utilize the method for genetically engineered can break the genetic block between species, realize the directed transfer of goal gene, there is the advantages such as offspring is easy to stable, and breeding cycle is short simultaneously. But, the importing of foreign gene to plant-growth and may grow generation deleterious effect. In this case, genetic expression needs to be limited in the destination organization of expectation. Promotor be RNA polymerase can the section of DNA molecule of specific recognition, be also exactly make the position transcribing beginning. In the regulation and control of genetic expression, transcribing is the first step of gene expression regulation, is also a crucial step (Lewi, 2005 gene VIII669��705, Beijing: scientific publication society). Promotor is very big on the expression time of foreign gene in organism, position and level impact, is the critical elements of gene engineering expression carrier. In the genetically engineered of cotton fiber quality improves, often need foreign gene special or advantageously express in fibrocyte, thus reduce foreign gene to the impact of cotton normal growth. If adopting cotton fiber advantage promotor, then the expression major control that can make goal gene is in the fibre. In addition, cotton fibre is grown by seed coat cell elongation, and the yield and quality of fiber can be formed and have an impact by the growth conditions of seed equally. Therefore, the clone of cotton fiber or seed advantage promotor, to the gene functional research of cotton fiber development and the genetically engineered improvement of fibrous quality, has very important value.

Forefathers, by utilizing fiber specific promoter, attempt the quality being improved cotton fiber by biotechnology, existing successfully report. (the JohnME such as John, KellerG.MetabolicProc.Natl.Acad.Sci., USA1996, under 93:12768-12773) acetyl-CoA reductase gene (phaB) and PHB synthase gene (phaC) are placed in respectively the control of fiber specific promoter E6 and FbL2A and proceed to upland cotton, successfully obtain simultaneously express phaB and phaC gene transgene cotton. Transgene cotton analysis finds the specifically expressing not only having phaB and phaC in cotton strain fiber, and containing PHB particle. HPLC analytical results shows: the synthesis of PHB starts from Post flowering 10d, and every gram of fiber dry weight contains the PHB of about 30-3440 �� g and is maintained to fiber maturation, and the existence of PHB improves the thermal insulation properties of fiber really.

The research work that another focus that in cotton fibre, rather people pay close attention to is Auburn university of U.S. Daniell is improved in genetically engineered. Daniell (HenryDaniell, BeltwideCottonConferences, 1998,595��598) the poly-body (protein-basedpolymers of albumen of Val-Pro-Gly-Val-Gly repeating unit is attempted to contain coding, PBPs) gene genetic converting cotton, makes cotton cells energy specifically expressing go out PBPs albumen. PBPs albumen is extensively present in nature, and such as the elastin in Mammals reticular tissue, containing the repetitive sequence being made up of multiple amino acid in molecule, PBPs molecule often shows stronger elasticity (coefficient of elasticity 10.6��10.9Pa). Daniell (HenryDaniell, BeltwideCottonConferences, 1998,595��598) think and PHBs is introduced cotton fibre, elasticity and the intensity being expected to improve fiber on the one hand, the raising of protein content in another aspect fiber, fibrous absorbent ability strengthens, to the also corresponding enhancing of the avidity of dyestuff, this is that current conventional breeding method is not accomplished.

The importance of specific promoter in cotton gene engineering breeding, in the work of the people such as Zhang more outstanding (Zhang, etal, NatureBiotechnology, the 2011,29:453-458) of performance. Zhang etc. utilize monoclonal antibody hybridization in situ technique that IAA is carried out cellular localization, it has been found that IAA is in the initial cell middle and high concentration accumulation of cotton fiber on the same day of blooming; Then there is no obvious IAA signal without fiber mutant, show that the initial of cotton fiber cell is had a very important role by IAA. Cotton fiber cell by ovule outer integument cells of superficial layer through differentiation projection, elongation and formed. Research shows, only the epidermic cell (accounting for about 10%) of Post flowering projection within 5 days can grow the macrofiber becoming and having spinning and be worth. They, according to " growth hormone is in the distribution of cotton fiber protrusion cell Semi-polarity " this discovery, analyze the reason that forefathers utilize growth hormone improvement cotton fiber failure. Think that the feature polar contribution of growth hormone and cotton fiber cell must grown combines, utilize specific promoter that growth hormone synthase gene is carried out the accuracy controlling on privileged site, time and intensity, the object of fibres modified yield and quality can be reached. So they will from petunia and expression activity district at ovule exterior skin, the time that controlling gene is expressed before flowering 2 days to the Post flowering FBP7 promotor of 8 days, merge with growth hormone biosynthesis gene iaaM and import in cotton. Transgene cotton phenotype analytical result shows, not only ovule surface fiber number increases, ginning outturn is improved, and fiber fineness is also improved, and namely the yield and quality of transgene cotton fiber is synchronously improved. Pioneer company division vice president MichaelLassner thinks, this research " what clearly demonstrate that promotor selects the importance on character improvement " (" Facultyof1000 ", on September 14th, 2011). " present the bright prospect of a new generation genetically modified crops " (JeffreyChen, NatureBiotechnology, 2011,29 (5): 407-409).

Cotton seeds or the fiber specific promoter immense value in cotton gene engineering improves, makes this kind of promotor be cloned. But, the promotor that can be used for cotton gene improvement at present is still very limited, therefore, obtain more cotton seeds or fiber predominant expression promotor, not only to genetically engineered improvement and the fiber development gene function research of cotton fiber from now on, and the bio-reactor utilizing heterologous gene all had important utility value.

Summary of the invention

It is an object of the invention to provide a kind of seed and cotton fiber predominant expression promotor PSDP_d, described promotor has the nucleotide sequence as shown in SEQIDNo.1.

Further, present invention also offers the expression vector containing described PSDP_d promotor. Wherein said expression vector preferred plant expression vector, it is more preferable to the carrier of structure as shown in Figure 6.

Further, the present invention also provides the transformant of above-mentioned expression vector, and wherein said transformant is agrobacterium tumefaciens.

It is a further object to provide the application of above-mentioned PSDP_d promotor in preparation transgenic plant.

It is a further object to provide the application of above-mentioned expression vector in preparation transgenic plant, wherein said transgenic plant are transgene cotton and tomato.

Another object of the present invention is to provide a kind of method that the PSDP_d of utilization promotor prepares transgenic plant, comprises the steps:

(1) promotor with sequence as shown in SEQIDNo.1 is built;

(2) described promotor is operationally inserted in expression vector, build plant expression vector;

(3) plant expression vector step (2) obtained transforms host, obtains transformant;

(4) described transformant is transformed plant, obtain transgenic plant.

Another object of the present invention is to provide a kind of method that the PSDP_d of utilization promotor prepares transgene cotton, comprises the steps:

(1) promotor with sequence as shown in SEQIDNo.1 is built;

(2) described promotor is operationally inserted in expression vector, build plant expression vector;

(3) plant expression vector step (2) obtained transforms host, obtains transformant;

(4) by described transformant converting cotton, transgene cotton is obtained.

The seed of the present invention and cotton fiber advantage promoter sequence, it is at least containing the nucleotide sequence shown in SEQIDNO.1, this sequence is design primer according to cotton GhSDP gene order, adopts PCR method, and the length obtained is the PSDP_d promoter sequence of 2822bp. containing various plants hormone such as Plant hormones regulators,gibberellins response element GARE (TCTGTTG577-583) in sequence, growth hormone response element TGA-box (TGACGTAA1768-1775), GCN4 (TGTGTCA1441-1447) the specifically expressing element that dormin response element ABRE (CACGTG645-650) jasmonic response element TGACG-motif (TGACG1768-1772) is relevant with endosperm specific, environment stress reacts such as low temperature LTR (CCGAAA587-593), injury WUN (TCATTACGAA1777-1786), the related elements such as pressure TC-enrichment iteron (GTTTTCTTAC813-822587-596). this sequence also comprises multiple anaerobic induction element ARE (TGGTTT2226-2231,2299-2304,2397-2404,2482-2487), the MBS (TAACTG108-114) relevant with myb transcription factor binding site, the circadian (CAANNNNATC626-632752-758) that cell cycle is relevant with diel rhythm, a large amount of cis-regulating element such as multiple GATA-box, CATA-box, AAGAA-motif and the core sequence TATAA being combined with TFII. detected by GUS histochemical stain in transgenic Fructus Lycopersici esculenti and transgene cotton, it was demonstrated that this promoters driven gus gene is predominant expression in transgenic Fructus Lycopersici esculenti seed and upland cotton fiber cell.

In the present invention, adopt gene engineering method, PSDP_d promotor is inserted in suitable expression vector and can obtain the plant expression vector containing this promotor.

The host of above-mentioned plant expression vector transforming appropriate can be obtained the transformant of the present invention by the present invention. Concrete, adopt electric shocking method to be transformed in agrobacterium tumefaciens lba4404 by the plant expression vector containing PSDP_d promotor to obtain transformant.

The PSDP_d promotor of the present invention and reporter gene are built plant expression vector, described plant expression vector is transformed host and obtains the transformant containing PSDP_d promotor, and obtain transgenic plant with described transformant conversion plant. Described transgenic plant are preferably tomato or upland cotton.

The useful effect of the present invention: obtain cotton fiber and the promotor PSDP_d of seed predominant expression, this promotor has seed specific expression activity in tomato, upland cotton has fiber and seed predominant expression characteristic, for genetically engineered improvement tomato, cotton seeds and fiber and seed provide new selection and effective approach as bio-reactor.

Accompanying drawing explanation

Fig. 1 represents the expression amount (RelativeExpression) of GhSDP gene in upland cotton different tissues;

Taking the cDNA in upland cotton root, children's stem, leaf, cotyledon, hypocotyl, calyx, petal, ovule on the same day of blooming, the ovule of Post flowering 9d and the fiber of Post flowering 9d as template, through the result of real-time quantitative PCR amplification; The expression amount of this gene in ovule on the same day of blooming, Post flowering 9d ovule and fiber and leaf is very low, and in hypocotyl, cotyledon, children's stem, petal and root, expression amount is higher lower, and expression in calyx is the highest.

Fig. 2 represents the expression amount (RelativeExpression) of GhSDP gene at upland cotton fiber different development stage;

Taking the cDNA in the fiber of ovule on the same day of blooming, Post flowering 5d, 9d, 13d, 15d, 17d, 19d and 21d as template, through real-time quantitative PCR amplification, this gene is in the whole growth course of fiber, and the expression of middle and later periods is higher than early stage, wherein Post flowering 15d reaches the highest, then continues high expression level. The expression of this gene belongs to fiber intermediary and later stages predominant expressed gene.

Fig. 3 represents the nucleotide sequence figure of PSDP_d promotor;

Containing multiple cis-regulating element in this sequence.

Fig. 4 represents the plasmid map that PSDP_d promotor is cloned on pEASY-Blunt carrier;

The wherein main element marking of carrier, pUCorigin Plasmid replication origins; AmpicillinresistanceORF: ampicillin resistance gene; KanamycinresistanceORF: kalamycin resistance gene; All the other are restriction endonuclease sites.

The structure schema of Fig. 5 upland cotton PSDP_d promoter expression vector;

The structure iron of Fig. 6 PSDP_d promoter expression vector pBI101-PSDP_d;

The main element marking of carrier in Fig. 5 and Fig. 6, reporigin Plasmid replication origins; NPTII: neomycin phosphotransferase gene; GUS: ��-gluconic acid glycoside enzyme gene; NOSterminator:NOS gene terminator; NOSPromoter:NOS composition promotor; LB, RB:T-DNA insert left and right border.

Fig. 7 represents that the PCR turning PSDP_d �� GUS fusion gene tomato verifies result;

DL2K is standard molecular weight DNA (Mark2000), K-2��K-21 is different transgenic lines, CK^-For non-transgenic comparison. Result display K2, K8, K18, K9 and K14 are transgenic positive plant, and all the other strains are transgene negative plant.

Fig. 8 represents the GUS coloration result turned in PSDP_d �� GUS fusion gene tomato;

Gus gene predominant expression in transgenic Fructus Lycopersici esculenti seed and kind fur is not expressed in stem, leaf. Wherein, A: the seedling sprouting latter 5 days; B: true leaf; C: crosscut children's stem; D: crosscut bud; The amplification of ovule part in G:D; E: the tamato fruit of crosscut young fruit period (IMG); The enlarged view of seed fraction in H:E; F: the tamato fruit of the green ripe phase (MG) of crosscut; The enlarged view of seed fraction in I:F; J: the tamato fruit of crosscut broken look phase (Br); The enlarged view of seed fraction in K:J; L: the tamato fruit in crosscut ripening stage (Ri).

Fig. 9 represents that the PCR turning PSDP_d �� GUS fusion gene cotton verifies result;

DL2K is standard molecular weight DNA (Mark2000), C1��C13 is different transgenic lines, CK^-For non-transgenic comparison. Result display C1, C2, C5 and C11 are transgenic positive plant, and all the other strains are transgene negative plant.

Figure 10 represents the GUS coloration result turning PSDP_d �� GUS fusion gene upland cotton;

Gus gene is at carpopodium, children's epidermal hair of stem, the petal of the day before yesterday of blooming, sepal and grows the blue signal all observing GUS dyeing in the ovule of four different times and fiber at the ovule on the same day of blooming, fiber, shows that gus gene has expression in these tissues. But in blade, find no the expression of gus gene. The blue signal of GUS occurs from the cotton ovule on the same day of blooming surface, the quick elongation phase grown at fiber especially, secondary wall synthesis phase fiber specific cell there is strong GUS positive signal to exist, shows that this promotor has fiber intermediary and later stages predominant expression characteristic in upland cotton. Wherein A: blade; B: the crosscut of stem; C: the amplification of stem; D: sepal; E: petal; F: carpopodium; G: the rip cutting of cotton boll on the same day of blooming; H: the ovule on the same day of blooming; I: Post flowering 5d cotton boll crosscut; The ovule fiber of J: Post flowering 10d; K: Post flowering 15d cotton boll crosscut; L: Post flowering 25d cotton boll crosscut; M: Post flowering 40d cotton boll crosscut; N: Post flowering 45d cotton boll crosscut.

Figure 11 represents the GUS Enzyme activity assay result turning PSDP_d �� GUS fusion gene upland cotton;

Detection turns the GUS enzymic activity of PSDP_d �� GUS fusion gene upland cotton different tissues, and in the visible transgene cotton petal of result, sepal, pistil and carpopodium, GUS enzymic activity is lower between 1.2��7.3nmol/mg/min. Detecting the ovule of the same day of blooming to Post flowering 40d, GUS enzyme is lived equally very low between 1.78��2.13nmol/mg/min. The fiber of detection Post flowering 5d to Post flowering 40d, its GUS enzyme is lived very high between 73.00��412.1nmol/mg/min, it is seen that the middle and later periods predominant expression that this promotor is mainly grown at fiber.

Embodiment

Below in conjunction with accompanying drawing, the present invention is described in further detail, but below illustrate and the present invention is not limited, any distortion to the present invention and change, as long as not departing from the spirit of the present invention, all should belong to the scope that claims of the present invention define.

It is common commercially available that reagent medicine in present example does not do being of concrete explanation, and material method does not do equal reference " molecular cloning experiment guide " (Sambrook and Russell, 2001) of concrete explanation.

Each extraction and quantitative PCR analysis organizing RNA of embodiment 1 upland cotton

EASYspin plant RNA rapid extraction test kit (Aidlab) is utilized to extract the RNA of each tissue of cotton. Carry out the reverse transcription of cDNA mono-chain with reference to RevertAidFirstStrandcDNASynthesisKit (MBI) specification sheets, analyze template as quantitative RT-PCR. Adopt the relative expression quantity of iQSYBRGreenSupermix (BIO-RAD) reagent analysis goal gene. Internal standard gene selects the Ghhis3 gene (AF024716) of upland cotton, and primer is that Ghhis1 and Ghhis2 is respectively as shown in SEQIDNO.8 and SEQIDNO.9; GhSDP gene quantification PCR primer is that GhSDP-RTup and GhSDP-RTdn is respectively as shown in SEQIDNO.2 and SEQIDNO.3. Amplification condition is: 95 DEG C of denaturation 3min; 95 DEG C of sex change 20s, 56 DEG C of annealing 20s, 72 DEG C extend 30s, 40 circulations.

Utilize Bio-RadCFX3.0 software, by calculating goal gene and interior target ratio in each material, the relative expression quantity of goal gene in different organ and tissue can be obtained. Result as shown in Figure 1, express lower in the blade of wild-type upland cotton, ovule (Post flowering 0d and 9d), fiber (Post flowering 9d), and the expression in calyx and hypocotyl is higher by this gene; Compare the expression discovery of the different steps that this gene is grown at fiber further: the fiber after Post flowering 15d is expressed higher, show that this gene belongs to fiber and grows middle and later periods predominant expressed gene.

The clone of embodiment 2 upland cotton PSDP_d promotor

Adopt Ai Delai biotech firm novel plant genomic dna rapid extraction test kit, the genomic dna of upland cotton Ji cotton 14 (this upland cotton kind is so kind as to give) is extracted by Agricultural University Of Hebei professor Ma Zhiying according to the method for specification sheets, with special primer PSDP_d-up and PSDP_d-dn (SEQIDNO.4 and 5) of this promotor of design and synthesis, taking above-mentioned DNA as template, increase this promoter sequence. Amplification system is as follows: 10 �� PCRbufferforKODPlus5 �� L, 25mmolMgSO₄5 �� L, 2mmol/LdNTPs2 �� L, primer PSDP_d-up (5 ��m of ol/L) 2 �� L, primer PSDP_d-dn (5 ��m of ol/L) 2 �� L, KODPlus polysaccharase 1U/ �� L, upland cotton DNA is about 60ng, and distilled water complements to 50 �� L. amplification program is: 94 DEG C, 2min, 94 DEG C, 15sec, 53 DEG C, 30sec, 68 DEG C, 2min, 35 circulations. after having increased, agarose electrophoresis also reclaims corresponding DNA band, it is cloned on pEASY_Blunt blunt vector according to the method for specification sheets, positive colony sends the handsome company in Shanghai sequence verification to, obtains pEASY-PSDP_d carrier (see Fig. 4) and PSDP_d promoter sequence as shown in SEQIDNO.1. utilize analysis software (PlantCARE, http://intra.psb.ugent.be:8080/PlantCARE/), from plant promoter database, this sequence is carried out promoter regulation element analysis, find this sequence to contain various plants hormone such as Plant hormones regulators,gibberellins response element GARE (TCTGTTG577-583), growth hormone response element TGA-box (TGACGTAA1768-1775), GCN4 (TGTGTCA1441-1447) the specifically expressing element that dormin response element ABRE (CACGTG645-650) jasmonic response element TGACG-motif (TGACG1768-1772) is relevant with endosperm specific, environment stress reacts such as low temperature LTR (CCGAAA587-593), injury WUN (TCATTACGAA1777-1786), the related elements such as pressure TC-enrichment iteron (GTTTTCTTAC813-822587-596). this sequence also comprises multiple anaerobic induction element ARE (TGGTTT2226-2231,2299-2304,2397-2404,2482-2487), the MBS (TAACTG108-114) relevant with myb transcription factor binding site, the circadian (CAANNNNATC626-632752-758) that cell cycle is relevant with diel rhythm, a large amount of cis-regulating element such as multiple GATA-box, CATA-box, AAGAA-motif and the core sequence TATAA (Fig. 3) being combined with TFII.

Embodiment 3DNA fragment reclaims, expression vector establishment intestinal bacteria transform

After the agarose electrophoresis of DNA terminates, under ultraviolet lamp, cut the sepharose block containing object fragment with clean blade, reclaim corresponding DNA fragmentation according to the method for test kit (Roche company), be building up on pBI101. The idiographic flow of vector construction is shown in Fig. 5, first restriction enzyme Spe I and EcoRV is utilized to be cut out by promoter fragment from the cloning vector pEASY-PSDP_d of this promotor, then be cloned in Xba I and Sma I site of expression vector pBI101 and be placed in gus reporter gene upstream, thus build pBI101-PSDP_d just to expression vector (Fig. 6). All restriction enzymes, all purchased from Roche company, operate according to working instructions.

The fragment reclaimed with the linked system of carrier segments is: 10 �� T4DNA is connected damping fluid 1 �� L, vector DNA fragment 1 �� L, and external source connects product D NA fragment 1 �� L, T4DNA ligase enzyme 1 �� L, supplies volume to 10 �� L with distilled water. Wherein, vector DNA fragment is connected product D NA fragment mol ratio with external source is 1 3,16 DEG C of connection 12h. Afterwards connection product is converted in bacillus coli DH 5 alpha.

The genetic transformation of embodiment 4 agriculture bacillus and tomato and cotton

With electric shocking method, the plant expression carrier plasmid built is imported Agrobacterium LBA4404.

According to the step of OMEGA company plasmid extraction kit (D6943-01) specification sheets, extract pBI101-PSDP_d plant expression carrier plasmid, with reference to Bio-RADMicroPulser user's specification sheets, by Electroporation conversion, this plasmid is proceeded in Agrobacterium LBA4404.

The genetic transformation of tomato: utilize agriculture bacillus mediated cotyledon conversion method (J.S.C.VanRoekel, B.Damm, L.S.Melchers, A.HoekemaFactorsinfluencingtransformationfrequencyoftoma to (Lycopersiconesculentum) PlantCellRep., 12 (1993), pp.644 647), tomato is carried out genetic transformation, tomato material is the kind red lead purchased from the local market of farm produce. The transgenic Fructus Lycopersici esculenti plant of acquisition is screened by the method for pcr amplification, adopt Ai Delai biotech firm novel plant genomic dna rapid extraction test kit, extract the DNA of transgenic Fructus Lycopersici esculenti according to the method for specification sheets, then the plant that PCR is positive is planted in greenhouse, Routine Management.

The genetic transformation of upland cotton: adopt agriculture bacillus mediated method that upland cotton Ji cotton 14 is carried out genetic transformation (Luoetal., 2007), the transgenic cotton plant of acquisition is screened by the method for pcr amplification, adopt Ai Delai biotech firm novel plant genomic dna rapid extraction test kit, the DNA of transgene cotton is extracted according to the method for specification sheets, then pcr amplification qualification is carried out, the seedling of the positive is placed in clear water, cultivate rear transplanting in 1 week to, in greenhouse, carrying out normal management for 22 DEG C.

The PCR checking of embodiment 5 transfer-gen plant

Adopt Ai Delai biotech firm novel plant genomic dna rapid extraction test kit, extract the DNA of transgenic Fructus Lycopersici esculenti and cotton according to the method for specification sheets. Sequences Design special primer GUS-1:AGCGTAATGCTCTACACCACG (SEQIDNO.6) according to gus reporter gene and GUS-2:GTAATGCGAGGTACGGTAGG (SEQIDNO.7) are for specific PCR amplification. Transfer-gen plant DNA carries out the condition of PCR amplification in vitro checking: reaction cumulative volume is 25 �� L, comprises 10 �� LATaqbuffer2.5 �� L, often kind of dNTP100 ��m of ol/L, 1.5mmol/LMgCl₂, template DNA 10ng, each 400nmol/L of upstream and downstream primer, 1 unit LATaqDNA polysaccharase (TaKaRa company).

Amplification condition: 94 DEG C of sex change 4min, continues with 94 DEG C of sex change 30s, 55 DEG C of annealing 30s, 72 DEG C of extensions 1min, 35 circulations totally, and last 72 DEG C extend 10min.

Amplified production containing ethidium bromide 1% sepharose on the voltage electrophoresis of 5V/cm after, under ultraviolet lamp observe take pictures.

The PCR checking of transgenic Fructus Lycopersici esculenti the results are shown in Figure 7, and result shows that K2, K8, K18, K9 and K14 are transgenic positive plant, and all the other strains are transgene negative plant.

The PCR checking of transgene cotton the results are shown in Figure 9, and result shows that transgenic line is positive strain.

The histochemical stain of embodiment 6GUS and observation

Get fresh transgenic Fructus Lycopersici esculenti, upland cotton material, it is cut into small pieces in rearmounted 1.5mL centrifuge tube, add GUS staining fluid (10mmol/LEDTA, 100mmol/L sodium phosphate buffer pH7.0,0.1mol/LK₃[Fe(CN)₆], 0.1mol/LK₄[Fe(CN)₆], 0.1% (V/V) TritonX-100,5mg/mlX-Glue). Containing the centrifuge tube of vegetable material and GUS dye liquor, 37.0 DEG C of permanent temperature incubators will be put into, dyeing 3h. Most backward remove staining fluid, after 70% ethanol decolorization, observe and take a picture.

The GUS coloration result turned in pBI101-PSDP_d gene tomato is shown in Fig. 8, and result display gus gene predominant expression in transgenic Fructus Lycopersici esculenti seed and kind fur is not expressed in stem, leaf. Namely this promotor has tomato seeds predominant expression specificity.

The GUS coloration result turning pBI101-PSDP_d gene upland cotton is shown in Figure 10, found that at carpopodium, children's epidermal hair of stem, the petal of the day before yesterday of blooming, sepal and grow the blue signal all observing GUS dyeing in the ovule of four different times and fiber at the ovule on the same day of blooming, fiber, show that gus gene has expression in these tissues. But in blade, find no the expression of gus gene. The blue signal of GUS occurs from the cotton ovule on the same day of blooming surface, the quick elongation phase grown at fiber especially, secondary wall synthesis phase fiber specific cell there is strong GUS positive signal to exist, show that this promotor has fiber intermediary and later stages predominant expression characteristic in upland cotton, in the genetically engineered of fibrocyte improves, may be used for driving goal gene to express in the middle and later periods that fibrocyte is grown, there is important using value.

The Enzyme activity assay of GUS in embodiment 7 transgene cotton

Gus gene encoding beta-glucosidase, this enzyme is a kind of lytic enzyme. Taking 4-methyl umbelliferone acyl-��-D glucuronide (4-MUG) as substrate, GUS catalysis its be hydrolyzed to 4-methyl umbelliferone (4-MU) and ��-D glucuronic acid. Hydroxyl in 4-MU molecule dissociate after by the optical excitation of 365nm, produce the fluorescence of 455nm, available spectrophotofluorometer is quantitative.

The extraction of a, GUS crude enzyme liquid

Select the transgene cotton bloomed, mark flowering time of listing the same day of blooming. Get the ovule of Post flowering 0d, 5d, 15d, 25d, 40d and the fiber sample of Post flowering 5d, 15d, 25d, 40d. Ordinary method is to sepal, petal, pistil and carpopodium sampling. Being put plant sample to be measured and grind to form powder in liquid nitrogen, homogenate made by the GUS enzyme extraction damping fluid adding 2 times of volumes, places 1h on ice. In the centrifugal 10min of 13000rpm/min, collecting supernatant, Bradford method measures the content of total protein in GUS crude enzyme liquid.

The making of b, 4-MU typical curve

First, with a small amount of N, dinethylformamide dissolves 4-MU solid, is then diluted to the mother liquor of 1mmol/L with distilled water. Secondly, the high density gradient sample that with reaction terminating liquid, 4-MU mother liquor is diluted to 100 ��m of ol/L, 80 ��m of ol/L, 60 ��m of ol/L, 40 ��m of ol/L and 20 ��m of ol/L, and the lower concentration gradient sample of 10 ��m of ol/L, 8 ��m of ol/L, 6 ��m of ol/L, 4 ��m of ol/L and 2 ��m of ol/L. At exciting light 360nm, measuring the fluorescence intensity of each sample, take reaction terminating liquid as blank when launching light 460nm, often kind of a concentration samples arranges 3 repetitions, by calculating mean value drawing standard curve.

The fluorometric assay that c, GUS enzyme is lived

Preheating reaction buffer in 37 DEG C of water-baths, simultaneously in 6 96 micropore elisa plates, adds reaction terminating liquid with 180 �� l/ holes. Sample centrifuge tube adds reaction buffer and the 5 �� lGUS crude enzyme liquids of 195 �� l preheatings, mixed even, take out 20 �� l immediately and join in No. 1 plate, this is the sample (as blank during fluorometric assay) during reaction 0, and strictly clocks. Sptting plate is put into and respectively gets 20 �� l reaction solutions when 37 DEG C of water-baths carry out enzyme reaction 20min and join No. 2 plates.

Fluorescent measures taking No. 1 plate as blank, with exciting light 360nm in microplate reader, measures the fluorescence intensity of No. 2 plate each sample when launching light 460nm. Select corresponding typical curve according to the fluorescence intensity level obtained, go out 4-MU content in No. 2 plates by regression equation calculation. Enzyme activity unit is defined as: it is a unit that every minute hydrolysis 4-MUG generates the enzyme amount of 1nmol4-MU. The expression activity of gus gene represents with the enzyme activity of every milligram of total protein, i.e. 4-MUnmol/mg/min.

The detected result of transgene cotton different tissues GUS enzymic activity is known: in petal, sepal, pistil and carpopodium, GUS enzymic activity is lower between 1.2��7.3nmol/mg/min. Bloom and lived equally very low between 1.78��2.13nmol/mg/min to the GUS enzyme of Post flowering 40d ovule the same day. But Post flowering 5d lives very high between 73.00��412.1nmol/mg/min to the GUS enzyme of Post flowering 40d fiber, vertex, between 15d to 25d, proves the middle and later periods predominant expression that this promotor is mainly grown at fiber again.

Above-described embodiment shows, the PSDP_d promotor length of nucleotides of the present invention clone is 2822bp, after this promotor and reporter gene merge, reporter gene can be instructed in tomato at seed and to plant expression in fur; Upland cotton can be instructed reporter gene grow middle and later periods predominant expression at fibrocyte. Above detailed description of the present invention does not limit the present invention, and the technician of this area can make various distortion and change according to the present invention, as long as not departing from the spirit of the present invention, all should belong to the scope that claims of the present invention define.

Claims (10)

1. a seed and cotton fiber predominant expression promotor PSDP_d, it is characterised in that, the nucleotide sequence of described PSDP_d promotor is as shown in SEQIDNo.1.

2. one kind contains the expression vector of PSDP_d promotor described in claim 1.

3. expression vector as claimed in claim 2, it is characterised in that, described expression vector is plant expression vector.

4. carrier as claimed in claim 2, it is characterised in that: described expression vector has structure as shown in Figure 6.

5. the transformant containing the promotor described in claim 1.

6. PSDP_d promotor according to claim 1 is in the application prepared in transgenic plant.

7. apply as claimed in claim 6, it is characterised in that, described plant is cotton or tomato.

8. apply as claimed in claim 6, it is characterised in that described PSDP_d promotor downstream is connected goal gene, build plant expression vector, transformed host plant.

9. utilization PSDP_d promotor described in requirement 1 of having the right prepares a method for transgenic plant, comprises the steps:

(1) promotor with sequence as shown in SEQIDNo.1 is built;

(2) described promotor is operationally inserted in expression vector, build plant expression vector;

(3) plant expression vector step (2) obtained transforms host, obtains transformant;

(4) described transformant is transformed plant, obtain transgenic plant.

10. utilize PSDP_d promotor described in claim 1 to prepare a method for transgene cotton, comprise the steps:

(1) promotor with sequence as shown in SEQIDNo.1 is built;

(2) described promotor is operationally inserted in expression vector, build plant expression vector;

(3) plant expression vector step (2) obtained transforms host, obtains transformant;

(4) by described transformant converting cotton, transgene cotton is obtained.