CN106701941B

CN106701941B - SNP molecular marker related to apple alternaria leaf spot resistance and application thereof

Info

Publication number: CN106701941B
Application number: CN201611209258.8A
Authority: CN
Inventors: 李天忠; 张秋雷; 张懿
Original assignee: China Agricultural University
Current assignee: China Agricultural University
Priority date: 2016-12-23
Filing date: 2016-12-23
Publication date: 2020-06-30
Anticipated expiration: 2036-12-23
Also published as: CN106701941A

Abstract

The invention provides an SNP molecular marker related to apple alternaria leaf spot resistance, the SNP molecular marker is positioned on a promoter of a miRNA primary transcript Md-MIRLn12-277 for regulating the apple alternaria leaf spot resistance, the nucleotide sequence of the SNP molecular marker is shown as SEQ ID NO:1, and the resistance of an apple variety with a 378bp base T to the apple alternaria leaf spot is obviously higher than that of the apple variety with a base G. The molecular marker can be used as a molecular marker of apple alternaria leaf spot resistance of apple cultivars, and is used for screening apple alternaria leaf spot resistance resources and breeding resistant apple varieties.

Description

SNP molecular marker related to apple alternaria leaf spot resistance and application thereof

Technical Field

The invention relates to the field of plant molecular biology, in particular to an SNP molecular marker related to apple alternaria leaf spot resistance and application thereof.

Background

The alternaria leaf spot of the apple is one of the most main fungal diseases of the apple, and can influence plant metabolism by releasing various virulence factors and effector factors to leaves so that the leaves have peroxide accumulation and cell death. A series of researches show that when pathogenic bacteria invade plants, receptor kinase located in a cytoplasmic membrane activates signal pathways such as downstream MAPK and the like after the pathogenic bacteria are identified so as to enable the plants to generate disease resistance (PTI pathway); pathogenic bacteria can evolve a series of effect factors to overcome the disease resistance of the plants due to the disease resistance of the plants; in order to identify the effector of pathogenic bacteria, plants have evolved a series of disease resistance genes (R genes) that activate the disease resistance response (ETI pathway), and mirnas are important regulators for regulating the disease resistance genes.

The traditional method adopts medicaments to prevent and treat diseases, which can affect food safety or cause environmental pollution. The identification method of PCR amplification and sequencing by designing a specific primer can screen the resistance resources of the alternaria leaf spot of the apple, and the selective breeding of the resistant apple variety is the most effective way for solving the problem.

Disclosure of Invention

The invention aims to provide an SNP molecular marker related to apple alternaria leaf spot resistance and application thereof.

The invention takes an infected variety 'golden crown' as a test material, screens miRNA with expression difference of more than 2 times before and after inoculation of Alternaria alternata Alternaria leaf-spmalii (ALT1) by miRNA secondary sequencing, obtains a new miRNA, and names the new miRNA as Md-miRLn12(SEQ ID NO: 5). After the leaves of the apple susceptible variety are inoculated with ALT1, the expression of Md-MIRLn12 and the primary transcript Md-MIRLn12-277 thereof can be obviously increased, but the resistant variety has no obvious change; therefore, the Md-MIRLn12-277 and the promoter region thereof are cloned and compared, and the resistant variety is found to have the same sequence with the susceptible variety Md-MIRLn12-277, but the promoter region has 3 bases different, wherein, the-1186 bp SNP site is the site for determining the activity of the Md-MIRLn12-277 promoter. Therefore, the inventor develops a molecular marker for breeding the alternaria leaf spot resistant apple variety through the SNP locus.

In order to achieve the purpose, the SNP molecular marker related to the apple alternaria leaf spot resistance is located on a promoter of a primary transcript Md-MIRLn12-277 of Md-MIRLn12 for regulating the apple alternaria leaf spot resistance, the nucleotide sequence of the SNP molecular marker is shown as SEQ ID NO:1, and the apple variety with the base T at 378bp of the sequence has higher resistance to the apple alternaria leaf spot than the apple variety with the base G at the position. The nucleotide sequence of the primary transcript Md-MIRLn12-277 of Md-MIRLn12 for regulating the resistance of apple alternaria leaf spot is shown as SEQ ID NO. 4.

The invention also provides a primer for detecting the SNP molecular marker related to the apple alternaria leaf spot resistance, which comprises a forward primer F5 '-AACACAGGGAGCACTTCTATTG-3' and a reverse primer R5 '-GTCCGTTATTATACGAATAATTGG-3'.

The invention also provides application of the SNP molecular marker related to the alternaria leaf spot disease resistance of the apples in identifying resistant varieties and susceptible varieties of the alternaria leaf spot disease, which comprises the following steps:

1) extracting genome DNA of an apple plant to be detected;

2) carrying out PCR amplification reaction by using the primers F and R and using the genome DNA of the apple plant to be detected as a template;

3) detecting a PCR amplification product, wherein if the base at 378bp in the sequence of the amplification product is T, the apple plant to be detected belongs to the apple alternaria leaf spot resistance variety; if the base at 378bp in the amplification product sequence is G, the apple plant to be detected belongs to the apple alternaria leaf spot disease susceptible variety.

Specifically, the resistance of different apple cultivars to apple alternaria leaf spot can be judged according to sequencing base difference and sequencing peak patterns. In the resistant variety, the Md-MIRLn12-277 promoter sequence-1186 bp position is T, and the sequencing peak diagram is T single peak; in a neutral variety, G and T exist at the position of 1186bp of an Md-MIRLn12-277 promoter sequence, and sequencing peak maps are G and T sets of peaks; in the susceptible variety, G is at the position of Md-MIRLn12-277 promoter sequence-1186 bp, and the sequencing peak graph is G single peak.

The invention also provides a kit containing the primer and used for detecting the alternaria leaf spot resistance apple varieties.

The invention also provides application of the SNP molecular marker related to the apple alternaria leaf spot resistance in apple molecular marker assisted breeding.

The invention also provides a primary transcript Md-MIRLn12-277 of Md-MIRLn12 for regulating and controlling apple alternaria leaf spot resistance, and the nucleotide sequence of the primary transcript is shown as SEQ ID NO. 4. The mature miRNA encoded by the gene is Md-miRLn12(SEQ ID NO: 5). The expression of Md-miRLn12 is inhibited in apple alternaria leaf spot disease susceptible apple plants, so that the resistance of susceptible varieties to apple alternaria leaf spot disease can be improved; meanwhile, Md-miRLn12 is overexpressed in apple alternaria leaf spot resistant apple plants, so that the disease resistance of resistant varieties to apple alternaria leaf spot can be reduced.

The invention also provides an expression vector, and the expression vector carries an expression cassette containing a mimic target tandem sequence (STTM, the sequence is shown as SEQ ID NO: 6) of Md-mirlin 12.

The expression vector carrying the gene of interest can be introduced into Plant cells by conventional biotechnological methods using Ti plasmids, Plant viral vectors, direct DNA transformation, microinjection, electroporation, etc. (Weissbach, 1998, Method for Plant Molecular Biology VIII, academic Press, New York, pp.411-463; Geiserson and Corey, 1998, Plant Molecular Biology, 2)^ndEdition)。

The invention further provides application of Md-miRLn12 in regulation and control of apple alternaria leaf spot disease resistance, and the resistance of a diseased plant to the apple alternaria leaf spot disease is improved by inhibiting the expression of Md-miRLn12 in a diseased apple plant of the apple leaf spot disease by means of genetic engineering.

In a preferred embodiment of the present invention, the synthetic Md-miRLn12 mimic target gene tandem sequence (STTM, sequence shown in SEQ ID NO: 6) was constructed into pFGC5941 vector (between NcoI and BamHI cleavage sites), and transiently expressed in susceptible apple varieties using Agrobacterium (GV3101) mediated method to improve disease resistance of transgenic plants.

The invention has the following advantages:

the method can effectively solve the problems that the food safety is affected or the environment pollution is caused by the control of the apple alternaria leaf spot disease by the medicament, solves the problem of breeding resistant varieties by designing the identification method of PCR amplification and sequencing by the specific primers, can screen apple alternaria leaf spot resistance resources, and simultaneously solves the problems that the hybridization technology is difficult, the time consumption is long and the identification is inconvenient for fruit tree transgenosis. The method provided by the invention is rapid, sensitive, high in accuracy, simple and convenient, and can be applied to the Malus plants.

Drawings

FIG. 1 shows the expression changes of Md-miRLn2 in the resistant variety 'Hanfu' and the susceptible variety 'Jinguan' respectively at 1 hour, 2 hours, 24 hours and 48 hours after ALT1 inoculation in example 1 of the present invention, and the non-inoculated expression level was used as a control (0 hour).

FIG. 2 shows that the disease resistance of susceptible varieties can be enhanced by silencing Md-miRLn12 in susceptible varieties 'golden crown' in example 2 of the invention. Wherein, A: a vector schematic; b: inoculating agrobacterium tumefaciens-mediated transient expression susceptible variety 'golden crown' tissue culture seedlings for 4 days, and detecting the expression quantity of Md-miRLn12 by Northern after inoculating for 48 hours; c: inoculating the agrobacterium-mediated transient expression susceptible variety 'golden crown' tissue culture seedlings 4 days later, and detecting morbidity and disease symptoms 48 hours later; WT represents no transient expression of 'golden crown' tissue culture seedlings; SC represents that scratch does not instantaneously express 'golden crown' tissue culture seedlings; EV represents pFGC5941 no-load transient expression 'golden crown' tissue culture seedling; STTM-Md-miRLn12 represents pFGC5941 vector silencing Md-miRLn12 for transient expression of 'gold crown' tissue culture seedlings.

FIG. 3 shows that the disease resistance of the disease-resistant variety can be reduced by over-expressing Md-miRLn12 in the disease-resistant variety 'Hanfu' in example 2 of the present invention. Wherein, A: a vector schematic; b: inoculating agrobacterium-mediated transient expression resistant variety 'Hanfu' tissue culture seedlings for 4 days, and detecting the expression quantity of Md-miRLn12 by Northern after inoculating for 48 hours; c: inoculating agrobacterium-mediated transient expression resistant variety 'Hanfu' tissue culture seedlings for 4 days, and detecting morbidity and diseases after inoculating for 48 hours; WT represents no transient expression 'hanfu' tissue culture seedlings; SC represents that scratch does not instantaneously express 'Hanfu' tissue culture seedlings; EV represents pFGC5941 no-load transient expression 'Hanfu' tissue culture seedlings; OE-Md-mirlin 12 represents pFGC5941 vector over-expressing Md-mirlin 12 for transient expression of 'Hanfu' tissue culture seedlings.

FIG. 4 shows the results of comparing the promoter sequences of the susceptible variety ` golden crown ` Md-MIRLn12-277 and the resistant variety ` Hanfu ` Md-MIRLn12-277 in example 3 of the present invention.

FIG. 5 shows GUS staining and GUS activity detection results before and after inoculation of Agrobacterium-mediated transient expression of 'golden crown' and 'Hanfu' apple tissue culture seedlings after GUS fusion of promoters of 'Hanfu' of resistant variety and 'golden crown' Md-MIRLn12-277 of susceptible variety in example 3 of the present invention. Wherein, A: respectively fusing a 'Hanfu' Md-MIRLn12-277 promoter of a resistant variety and a 'golden crown' Md-MIRLn12-277 promoter of an susceptible variety with GUS vectors; b: after the promoters of the resistant variety 'Hanfu' and the susceptible variety 'golden crown' Md-MIRLn12-277 are fused with GUS respectively, agrobacterium-mediated transient expression of the 'golden crown' and 'Hanfu' apple tissue culture seedlings is inoculated for 4 days, and GUS staining and GUS activity detection are carried out after 48 hours of inoculation.

FIG. 6 shows the GUS activity detection results before and after inoculation of Agrobacterium-mediated transient expression of 'gold crown' and 'Hanfu' apple tissue culture seedlings, after GUS fusion of the 'Hanfu' Md-MIRLn12-277 promoter of the resistant variety and the 'gold crown' Md-MIRLn12-277 promoter of the susceptible variety at the mutation-1186 bp position in example 3 of the present invention. Wherein, A: a GUS vector schematic diagram is fused with a 'Hanfu' Md-MIRLn12-277 promoter of a resistance variety and a 'golden crown' Md-MIRLn12-277 promoter of an infection variety at a mutation position of-1186 bp; b: after the mutant-1186 bp resistant variety 'Hanfu' and the susceptible variety 'golden crown' Md-MIRLn12-277 promoter are fused with GUS respectively, agrobacterium-mediated transient expression of 'golden crown' and 'Hanfu' apple tissue culture seedlings is inoculated for 4 days, and GUS staining and GUS activity detection are carried out after inoculation for 48 hours.

FIG. 7 is the PCR amplification electrophoresis picture of promoter sequence (1563bp) of 35 apple varieties Md-MIRLn12-277 in example 4 of the invention. Wherein M is a DNA molecular weight standard, and 1-35 are respectively 'Hanfu', 'II 8-19', 'Stark short golden crown', 'cockscomb', 'Honey gold', 'red summer', 'Stark short', 'willow', 'Gushuai', 'Letika', 'Cejia tegam', 'Joja', '60-4' -Bailuomalin ',' early golden crown ',' initial smile ',' Qing Glu No. 1 ',' female wandering team member ',' Jinsha Laura ',' Nalan ',' Meilatasuh ',' Mosco ',' Fuji ',' early born ovum 'of crane', 'ideal', 'Klloser' transparent ',' red gold ',' Ruiguan 'Roui', 'Rongguan', 'Rough' and 'Rough' of flowers, the Huang 'and the Ma' of Bing, the Ma nationality 'of the flowers, the early generation crane', 'Alga' of the flowers, the Lanjia Ma, the Ma flowers, the Ma.

FIG. 8 shows the results of analysis of sequencing peaks in example 4 of the present invention to determine the resistance of different apple cultivars to alternaria leaf spot in apple. Wherein, the upper graph represents resistant varieties, the middle graph represents neutral varieties, and the lower graph represents susceptible varieties. In the resistant variety, the Md-MIRLn12-277 promoter sequence-1186 bp position is T, and the sequencing peak diagram is T single peak; in a neutral variety, G and T exist at the position of 1186bp of an Md-MIRLn12-277 promoter sequence, and sequencing peak maps are G and T sets of peaks; in the susceptible variety, G is at the position of Md-MIRLn12-277 promoter sequence-1186 bp, and the sequencing peak graph is G single peak.

FIG. 9 shows the expression levels of Md-MIRLn12 and Md-MIRLn12-277 of 35 apple cultivars after inoculation of ALT1 for 1 hour, 2 hours, 24 hours and 48 hours by fluorescent quantitative PCR in example 4 of the present invention. In the resistant variety, the expression level of Md-MIRLn12 and Md-MIRLn12-277 is lower after the strain ALT1 is inoculated; in the susceptible strain, the expression levels of Md-MIRLn12 and Md-MIRLn12-277 are higher after the strain ALT1 is inoculated. The expression level of non-inoculated cells was used as a control (0 hour).

Detailed Description

The following examples are intended to illustrate the invention but are not intended to limit the scope of the invention. Unless otherwise indicated, the examples follow conventional experimental conditions, such as the Molecular Cloning handbook, Sambrook et al (Sambrook J & Russell DW, Molecular Cloning: a Laboratory Manual,2001), or the conditions as recommended by the manufacturer's instructions.

Example 1 discovery of Md-miRLn12

Screening miRNA with expression difference of more than 2 times before and after inoculation of apple alternaria alternata Alternaria leaf spot (ALT1) by taking a susceptible variety 'golden crown' as a test material, comparing the miRNA with miRBase (http:// www.mirbase.org /) and apple genome (https:// www.rosaceae.org /) to obtain a new miRNA, naming the new miRNA as Md-miRLn12(SEQ ID NO:5), and obtaining Md-miRLn12 primary transcript Md-miRLn12-277(SEQ ID NO:4) after inoculation of ALT1 on apple susceptible variety leaves, wherein the expression of Md-miRLn12 and Md-miRLn12-277 can be obviously increased, but the resistant variety has NO obvious change; therefore, the Md-MIRLn12-277 and the promoter region thereof are cloned and compared, and the resistant variety is found to have the same sequence with the susceptible variety Md-MIRLn12-277, but the promoter region has 3 bases difference. Through GUS staining and GUS activity detection experiments, the Md-MIRLn12-277 promoter-1186 bp SNP locus is a locus for determining the activity of the Md-MIRLn12-277 promoter. The SNP locus can be used for developing a molecular marker for breeding the alternaria leaf spot resistant apple variety.

The specific method comprises the following steps:

1. plant total RNA extraction

(1)1g of each tissue sample of apple 'golden crown' is quickly ground in liquid nitrogen, then transferred into a 2mL centrifuge tube filled with preheated CTAB (700 mu L), shaken and uniformly mixed, and then subjected to 65 ℃ water bath for 30min, and is reversely mixed once every 10 min;

(2) adding 700 μ L of CI (chloroform/isoamyl alcohol volume ratio 24:1), and mixing by inversion for 1 min;

(3)4℃13000rpm 10min；

(4) taking the supernatant, adding CI with the same volume, reversing and uniformly mixing for 1 min;

(5)4℃13000rpm 10min；

(6) transfer the supernatant to another container containing 0.1 volume of 3M/L Na₂Adding isopropanol with the same volume into the centrifuge tube of the AC, and storing for more than 1 hour at the temperature of minus 70 ℃.

(7) 10000rpm for 20min at 4 ℃, then discarding the supernatant and drying the liquid;

(8) adding 70% ethanol, cleaning, and precipitating for 2 times;

(9) centrifuging at 10000rpm for 15min, discarding the supernatant, and reversing the centrifuge tube onto absorbent paper to dry, and finally dissolving in 80 μ L sterile water.

Removal of DNA from total RNA:

(1) the following ingredients were added to a 1.5mL PCR tube:

(2) mixing the above materials, and treating at 37 deg.C for 30 min; add 100. mu.L RNase-free water (0.1% DEPC treated water); adding equal volume CI and mixing;

(3) centrifuging at 4 deg.C 10000rpm for 20 min; adding equal volume of CI into the supernatant, reversing and mixing uniformly, and centrifuging at 4 ℃ and 10000rpm for 20 min;

(4) taking supernatant, 2.5 times of absolute ethyl alcohol by volume, and precipitating for 2 hours at-70 ℃; centrifuging at 10000rpm for 20min at 4 deg.C; discarding the supernatant, drying the precipitate, adding 75% ethanol for cleaning, and centrifuging at 10000rpm for 5 min;

(5) blowing the precipitate with a blower at low temperature, dissolving in 30-50 μ L DEPC water or RNase-free water, and storing at-70 deg.C.

(6) Integrity is detected by 1% agarose gel electrophoresis, and the concentration of RNA is calculated by absorbance at 260nm of an ultraviolet spectrophotometer.

2. Reverse transcription reaction System and procedure

The reverse transcription reaction system is as follows:

RNA 2μg

specific stem-loop primer (10. mu.M) 1. mu.L

DEPC water make up to 12 μ L

The sample was loaded on ice and mixed well, centrifuged briefly, 5min at 70 ℃ and then immediately placed on ice for 5 min.

The reaction system is as follows:

flicking, mixing, centrifuging for a short time at 42 deg.C for 1 hr, and 70 deg.C for 10 min.

The reverse transcription product is cooled and stored in a refrigerator at the temperature of 80 ℃ below zero or directly used for PCR reaction.

3. Fluorescent quantitative reaction system

Md-mirlin 12 specific primers (F: tgcactagcgtgtttgaacaag, R: acatcgtatcgtgaag) were designed and fluorescence quantification was performed on Applied Biosystems 7500 using SYBR Green fluorescent quantitation premix (TIANGEN, FP121221) and the PCR reaction program was as follows: 95 ℃ and 15 mins; 10sec at 95 ℃ and 30sec at 60 ℃ for 40 cycles. Results utilize 2^-ΔΔCtMethods were performed for statistical analysis (Livak and Schmittgen, 2001).

After inoculation with apple alternaria leaf spot pathogen (ALT1), the expression changes of Md-miRLn2 in the resistant variety 'Hanfu' and the susceptible variety 'golden crown' are shown in FIG. 1.

Example 2 acquisition of Gene Md-mirlin 12 for regulating resistance to apple alternaria leaf Spot

A mock target gene tandem sequence (STTM, sequence shown in SEQ ID NO: 6) of synthetic Md-miRLn12 was constructed into the pFGC5941 vector (between the NcoI and BamHI cleavage sites) to silence endogenous Md-miRLn 12. The agrobacterium-mediated (GV3101) transient expression susceptible variety 'golden crown' apple tissue culture seedling leaf, ALT1 is inoculated after 4 days, and the detection result after 2 days shows that the expression level of Md-miRLn12 is reduced, the incidence of leaf is obviously reduced, and the disease is mild. It is demonstrated that silencing Md-miRLn12 in susceptible varieties 'golden crown' can enhance disease resistance of susceptible varieties (FIG. 2).

The Md-miRLn12 primary transcript Md-miRLn12-277 sequence was constructed into pFGC5941 vector for overexpression of Md-miRLn 12. The agrobacterium-mediated (GV3101) transient expression resistant variety 'Hanfu' tissue culture seedling leaf is inoculated with bacterium ALT1 after 4 days, and detection after 48 hours of inoculation shows that the disease incidence is increased and the disease is serious while the expression of Md-mirlin 12 is increased. The disease resistance of the disease-resistant variety can be reduced by over-expressing Md-miRLn12 in the disease-resistant variety 'Hanfu' (FIG. 3).

The specific method comprises the following steps:

1. detection of miRNA by Northern method

Synthesis of 5' -end modified, homooctyl-labeled Md-mirlin 12 and U6 probes (Md-mirlin 12_ Probe: AGGGAGCAAATCTTGTTCAAA; U6_ Probe: CTCGATTTATGCGTGTCATCCTTGC) 60. mu.g of RNA (CTAB extraction) was added to a 2 × loading buffer at 95 ℃ for 5min, followed by cooling at 4 ℃ and applied to a 15% polyacrylamide gel (containing 7M urea), electrophoresis at 100V in 1 × TBS buffer for 3h, electrophoresis at 300mA in 1 × TBS buffer at 4 ℃ on a nylon membrane, 1200mJ UV-crosslinked for 2mins, prehybridization, hybridization, membrane washing and signal detection using a Hippon hybridization detection kit (Mylab corporation).

2. Agrobacterium transformation

(1) A tube of prepared competent cells was taken and gently suspended after complete lysis on ice.

(2) Adding 5-10 μ L plant expression vector plasmid, mixing, and standing on ice for 30 min.

(3) Quenching in liquid nitrogen for 1 min.

(4) Heat shock at 37 deg.C for 5min, and standing on ice for 2 min.

(5) Add 500. mu.L YEP medium and shake-culture at 28 ℃ and 140rpm for 4-6 h.

(6) Centrifuge at 4000rpm for 3min at room temperature, remove about 400. mu.L of supernatant, and suspend the cells with the remaining medium.

(7) Bacteria were plated on solid YEP medium plus antibiotics (50mg/L Km, 20mg/L Rif).

(8) The plates were cultured in an inverted format at 28 deg.C (24-48 h).

3. Agrobacterium-mediated transient expression

Culturing the 'golden crown' and 'Hanfu' tissue culture seedlings in an illumination culture box at 25 ℃ and 50% humidity, keeping the day and night length at 16-8h and illumination intensity at 200 mu mol.m-²·s-¹. When 5-6 true leaves of the plants are unfolded, numbering each individual plant, taking one true leaf for storage, and injecting agrobacterium tumefaciens. See Bai et al (Bai et al.2011) for methods of agrobacterium injection.

(1) Pre-culturing: YEP 2ml (50mg/L Km, 20mg/L Rif), Agrobacterium plaque or Glycerol bacteria 28 ℃, 180rpm culture overnight.

(2) The culture comprises the following steps: YEP medium 4ml (adding corresponding antibiotics and 10. mu.M acetosyringone), adding 1/50 volumes of bacterial liquid (80. mu.L), culturing at 28 ℃ and 180rpm for 12-16 h.

(3) Centrifuging at room temperature 10000rpm for 1min, removing culture medium, and suspending the thallus with 1-2ml suspension (vortex shaking).

Adding 10 μ L of the bacterial solution into 990 μ L of the suspension, and measuring OD with spectrophotometer₆₀₀Adjusting the suspension to OD₆₀₀1.0. Standing at room temperature for 2-5 h.

Suspension liquid: (10mM MES-KOH (pH5.2), 10mM MgCl ₂100 μ M acetosyringone).

(4) Before use, the suspension was vortexed or pipetted to aspirate the suspension and the suspension was aspirated using a 1ml syringe without a needle.

(5) Keeping away from veins, after making a small hole on the blade by using a syringe needle, pressing the small hole by using the syringe filled with the bacterial liquid, pressing the small hole in the opposite direction of the blade by using a finger of the other hand, slowly and forcefully injecting the bacterial liquid into the blade, and the color of the injected part becomes lighter. Each leaf injected 1-2 holes.

(6) And 4 days for observation.

EXAMPLE 3 cloning and comparison of promoter Activity of Md-MIRLn12-277 promoter sequences of susceptible and resistant varieties

The ALT1 is inoculated with tissue culture seedling leaves of 'Hanfu' and 'golden crown' of apples, and detection shows that the expression of susceptible varieties 'golden crown' Md-miRLn12 and Md-miRLn12-277 are increased after inoculation for 48 hours, while the expression of resistant varieties 'Hanfu' Md-miRLn12 and Md-miRLn12-277 are lower. Therefore, the Md-MIRLn12-277 promoter region is cloned, and three SNP differential sites of a susceptible variety 'golden crown' and a resistant variety 'Hanfu' are found, wherein the SNP differential sites are-1506 bp (C-T), -1186bp (G-T) and-175 bp (A-G) respectively. (FIG. 4)

After GUS (glucuronidase) is fused with promoters of 'Hanfu' and 'golden crown' Md-MIRLn12-277 of resistant varieties and susceptible varieties respectively, the promoters are respectively constructed on a vector pCAMBIA1305, and agrobacterium-mediated transient expression of 'golden crown' and 'Hanfu' apple tissue culture seedling leaves is realized, and detection results show that the promoters of the Md-MIRLn12-277 of the susceptible varieties have stronger promoter activity, while the promoters of the Md-MIRLn12-277 of the resistant varieties have weaker activity. (FIG. 5)

When-1186 bp (G-T) is mutated, the activity of the promoter of the resistant variety Md-MIRLn12-277 is recovered; g at the site of promoter-1186 bp of infected variety Md-MIRLn12-277 is mutated into T post-fusion GUS of resistant variety, and the T post-fusion GUS is respectively constructed on a vector pCAMBIA1305, respectively and agrobacterium-mediated transient expression of 'golden crown' apple tissue culture seedling leaves is performed after 4 days, and detection after inoculation for 48 hours shows that the activity of promoter of infected variety Md-MIRLn12-277 is reduced. It is proved that the activity of the resistant variety Md-MIRLn12-277 promoter-1186 bp (T-G) is reduced due to base substitution. (FIG. 6)

The GUS staining method was as follows:

putting apple plant into a container containing 0.2M NaH₂PO₄·2H₂O，0.2M NaH₂PO₄·12H₂O, 100mM X-Gluc and 10% methanol in GUS staining solution, incubating for two days at 37 ℃, and observing the staining after 70% ethanol decoloration overnight.

The GUS activity detection method comprises the following steps:

(1) taking about 100mg of fresh plant tissue, rapidly freezing the biological material by using liquid nitrogen, and then grinding the tissue in a mortar by adopting a liquid nitrogen grinding mode. If not immediately ground, the liquid nitrogen-frozen plant tissue may be stored in a freezer at-80 ℃.

(2) The ground and disrupted tissue was transferred to an EP tube and 1ml of GUS extraction buffer was immediately added and mixed well.

(3) Centrifuge at 12000rpm for 5min at 4 deg.C, transfer the supernatant to another clean EP tube, and place on ice for use.

(4) Mu.l, 2. mu.l, 4. mu.l, 8. mu.l, 12. mu.l, 16. mu.l and 20. mu.l of BSA standard solutions were added to 7 EP tubes, and the mixture was made up to the same volume of 20. mu.l with water. Add 980. mu.l Coomassie brilliant blue G250 solution, mix well, and let stand on ice for 5 min. The absorbance at 595nm was measured with an ultraviolet spectrophotometer. A standard curve was made of protein concentration (mg/ml) versus absorbance A595.

(5) Taking 10 mu l of protein sample to be detected, adding 10 mu l of water, adding 980 mu l of Coomassie brilliant blue G250 solution, fully mixing, and standing on ice for 5 min. The absorbance at 595nm was measured with an ultraviolet spectrophotometer. Substituting the formula to obtain the concentration of the protein sample.

(6) Mu.l of the protein supernatant was added to 400. mu.l of GUS extraction buffer preheated at 37 ℃ and then 500. mu.l of MUG substrate was added thereto, and the mixture was incubated at 37 ℃. 200ul of the mixed reactant is respectively added into 800ul of the reaction termination solution at 0min, 15min, 30min, 45min and 60min, and the mixed reactant is stored at room temperature in a dark place.

(7) Fluorescence intensity values at different time points were measured with a fluorescence spectrophotometer at an excitation wavelength of 365nm, an emission wavelength of 455nm and a slit of 10 nm.

(8) The change in fluorescence intensity per unit time was obtained by plotting the fluorescence intensity value against the reaction time.

(9) The change in fluorescence intensity per unit time per unit mass of protein was determined by dividing the change in fluorescence intensity per unit time by the amount of protein participating in the reaction.

Example 4 development and utilization of SNP primers

In this example, 35 apple varieties of Malus were collected from leaves with consistent growth vigor in fruit germplasm resource gardens of the national institute of fruit trees of the national academy of agricultural sciences in the city of Xinghua, Liaoning province.

1. Genomic DNA extraction

(1) Grinding 1g leaf with liquid nitrogen, transferring into a 2.0mL centrifuge tube, adding 800. mu.l 2 × CTAB (2% CTAB, 10mM Tris-HCl, 1.4M NaCl, 1% PVP), slightly shaking, mixing, placing in 65 deg.C water bath for 20-40min, and shaking gently for several times.

(2) After cooling to room temperature, an equal volume of chloroform/isoamyl alcohol (24: 1 by volume) was added and centrifuged at 12000rpm for 10 minutes at room temperature.

(3) The supernatant was removed and centrifuged at 12000rpm for 10 minutes with an equal volume of chloroform/isoamyl alcohol (24: 1 by volume).

(4) Adding 2 times volume of anhydrous ethanol into the supernatant, and precipitating at-20 deg.C for 30 min.

(5) Centrifuging at 12000rpm for 10min, discarding the supernatant, washing the precipitate with 75% ethanol twice, air drying the precipitate, and dissolving in appropriate amount of double distilled water.

(6) If necessary, RNA removal treatment was carried out at 37 ℃ for 30 minutes in a ratio of 100. mu.l to 1. mu.l of RNase. Extract once with CI.

Precipitating with ethanol, and dissolving the precipitate in appropriate amount of double distilled water.

(7) Integrity is detected by 1% agarose gel electrophoresis, and DNA concentration is calculated by absorbance at 260nm by an ultraviolet spectrophotometer.

2. Md-MIRLn12-277 promoter sequence cloning

Primers were designed based on the apple genome (https:// www.rosaceae.org /) Md-MIRLn12-277 promoter sequence (MDC 008796.277).

The primer sequences used were as follows:

an upstream primer: 5'-AACACAGGGAGCACTTCTATTG-3'

A downstream primer: 5'-GTCCGTTATTATACGAATAATTGG-3'

The above primers were synthesized by Zhongmeitai and Biotechnology (Beijing) Ltd.

PCR reaction System 2 × Taq MasterMix (Dye) (Beijing Kang is century Biotechnology Co., Ltd., CW 0682A).

The PCR reaction procedure was as follows:

pre-denaturation at 94 ℃ for 3 min; 30 cycles of 94 ℃ for 40s, 61 ℃ for 30s and 72 ℃ for 1 min; finally, extension was carried out at 72 ℃ for 2 min.

And (3) detecting a PCR product: 1% agarose gel is prepared according to the size of the target fragment, 0.1% TAE electrophoresis buffer solution is used for electrophoresis at a voltage of 70-110v for about 15min, ethidium bromide is used for staining, and the size of the PCR product fragment is detected under an ultraviolet lamp, and the result is shown in figure 7.

3. Agarose gel recovery of the fragment of interest

The recovery kit of AXYGEN was used, and the method was as described in the specification.

(1) The agarose containing the DNA fragment of interest was cut, the excess gel was cut off as much as possible, 3 gel volumes of Buffer DE-A were added and mixed intermittently until the gel mass was completely melted.

(2) 0.5 volume of Buffer DE-A added to the mixture was mixed well.

(3) The mixture was transferred to a DNA preparation tube (2ml centrifuge tube), centrifuged at 12,000 × g for 60 seconds, the waste solution in the collection tube was discarded, and the procedure was repeated once.

(4) The preparation tube was placed back into a 2ml centrifuge tube, 500. mu.l Buffer W1 was added, 12,000 × g was centrifuged for 30s, and the waste liquid in the collection tube was decanted.

(5) The prepared tube was placed back in a 2ml centrifuge tube, 700. mu.l of Buffer W2 was added, and 12,000 × g was centrifuged for 30s, and the waste liquid in the tube was discarded, and 700. mu.l of Buffer W2 was added again, and 12,000 × g was centrifuged for 60s in the same manner.

(6) The prepared tube was placed back into a 2ml centrifuge tube and centrifuged at 12,000 × g for 60 s.

(7) The preparation tube was placed in a clean 1.5ml centrifuge tube, 25-30. mu.l of Eluent or deionized water heated to 65 ℃ was added to the center of the preparation membrane, and the membrane was left to stand at room temperature for 1min, 12,000 × g and centrifuged for 60s to elute DNA.

Sequencing by Micheletan and Biotechnology (Beijing) Co., Ltd, and the sequencing result shows that the target fragments are 1563 bp.

4. Bioinformatics analysis of Md-MIRLn12-277 promoter sequence

And performing multi-sequence alignment analysis and sequencing peak map analysis by using DNAMAN (Lynnon BioSoft) and BioEdit software and the like to judge the resistance of different apple cultivars to the apple alternaria leaf spot. In the resistant variety, the Md-MIRLn12-277 promoter sequence-1186 bp position is T, and the sequencing peak diagram is T single peak; in a neutral variety, G and T exist at the position of 1186bp of an Md-MIRLn12-277 promoter sequence, and sequencing peak maps are G and T sets of peaks; in the susceptible variety, G is at the position of Md-MIRLn12-277 promoter sequence-1186 bp, and the sequencing peak graph is G single peak. (Table 1, FIG. 8)

TABLE 1

The results of comparing the promoter sequences of the susceptible variety 'golden crown' and the resistant variety 'Hanfu' Md-MIRLn12-277 are shown in FIG. 4. As can be seen from FIG. 4, the two sequences have 3 bases in total, wherein the base at 378bp is an SNP molecular marker related to the resistance of the apple alternaria leaf spot, and the resistance of the apple variety with the base T to the apple alternaria leaf spot is significantly higher than that of the apple variety with the base G.

The fluorescent quantitative PCR method is adopted, the following primers are designed, and the expression quantity of the Md-MIRLn2 and the Md-MIRLn12-277 inoculated strain ALT1 in 35 apple cultivars is detected, and the resistance to the alternaria leaf spot of the cultivars is consistent. In the resistant variety, the expression level of Md-MIRLn12 and Md-MIRLn12-277 is lower after the strain ALT1 is inoculated; in the susceptible strain, the expression levels of Md-MIRLn12 and Md-MIRLn12-277 are higher after inoculation of the strain ALT1 (FIG. 9).

Primers used for fluorescent quantitative PCR:

Md-miRLn12 neck loop primer: 5'-GTCACATCGTATCGTGAAGCTGCGCAGCTGATGTGACAGGGAGCA-3'

Md-miRLn12 fluorescent quantitative primer: F5'-TGCACTAGCGTGTTTGAACAAG-3' and R5'-ACATCGTATCGTGAAG-3'

Internal reference 5 srna neck ring primer: 5'-GTCACATCGTATCGTGAAGCTGCGCAGCTGATGTGACTGGATTGG-3'

5srRNA fluorescent quantitative primer: F5'-TGCACTAGCGTGTAGAGGAACC-3' and R5'-ACATCGTATCGTGAAG-3'

Md-MIRLn12 primary transcript Md-MIRLn12-277 fluorescent quantitative primer:

F 5’-TGCCGTGACCAAAGCCACATAC-3’

R 5’-TACTCTCTCTCCGTAAATCCATTGG-3’。

although the invention has been described in detail hereinabove with respect to a general description and specific embodiments thereof, it will be apparent to those skilled in the art that modifications or improvements may be made thereto based on the invention. Accordingly, such modifications and improvements are intended to be within the scope of the invention as claimed.

Sequence listing

<110> university of agriculture in China

<120> SNP molecular marker related to apple alternaria leaf spot resistance and application thereof

<130>KHP161118679.3

<160>6

<170>PatentIn version 3.3

<210>1

<211>1563

<212>DNA

<213> apple

<220>

<221>misc_feature

<222>(56)..(56)

<223> n is c or t

<220>

<221>misc_feature

<222>(378)..(378)

<223> n is g or t

<220>

<221>misc_feature

<222>(1388)..(1388)

<223> n is a or g

<400>1

aacacaggga gcacttctat tgatttcaaa tcttagggac cacttctatt gatttnaaat 60

cttagtgact aaagtgagga gttatgcaaa tctcaaaggc cattttggtt aaaaagcctt 120

gaaaatattt gttaatacta cctttcatca tcaattgagg actttgaaaa tatttttttg 180

gggaaataag tcaaaataat tatttttgaa atctaaattt gctaaaatga ttagtctttc 240

aatatgtcgt caatatttag tctttcaata tgtcatcgat atttagcctt tcaatatgtc 300

gttgatatat aattttgatc agtttagcaa atgagatttg atttctaatc attttagccc 360

accttcctca gattgttntg gttgtatata gaaattatga tccaatataa atgagaattc 420

aaaaactaga actactgaac cagtttgatc ggatgaatat ctagaaatgg agatcaagtt 480

aaattaccat ataaaccaaa attttatgtt aatgtatgat gaacatcaaa attataattt 540

acatatataa gcctttgcta cggctagagt taacttatgc tacaagtaag aattctactg 600

taatacattg gaaaatgtaa actgccattt gaactccagt tgaaattaac cctctgaact 660

attttttttt gttaagttaa cctcctgaac tatttgaaat aagccagttg accccttgtt 720

ggtagatttc atctactatt tcatcaaatt caaaggaaga ttagtctttt cttcatcaat 780

tcttacttgt caactataac caacaatgta attatgacat gtgaaaacgg acaatgtaaa 840

catttgattt ttttatgttt cctcagtatg ttatatattt ttgaattaat ttgtgtccat 900

gtgtcaaaat tttattggcg gttatagctg acaagtaaca attaatgatg aaatgactaa 960

tttgtccttg aatttgatag aattgattcc gcaatctaac ggtaatgggt taattgactg 1020

attttaaata gttcgggggg ttaatttacc aaaaaaatag tttaaagggg gtcaaattca 1080

actgggatga tagttcaggg tcaaaccgca ctttacccac attggaatac attgatgcag 1140

agcttccgcc gatcgatagatcttttgtga acgtatttaa actcagttcg gtcatgcaat 1200

tccaagaaat gtatagattg gagcatatac cagatcaagt gcaagtgcaa ctactttatc 1260

cagataacaa atataaacga gtaatgctac atttattatc tacttgtatc ataatttata 1320

tgattcgcaa acgtatgtga atcatctctc tattagaaaa atgaacaaat aaataggtaa 1380

gaataatntt tttttaatat aaattcatca ttcatttaca ccgcatcgtc acatgcgacg 1440

tttcaatcag tcaacttatc acatagattc ttaatataat tctatcgtgg tcaaataaaa 1500

aagcaatgtg aaatcgatca atggaattat aaattccttc caattattcg tataataacg 1560

gac 1563

<210>2

<211>22

<212>DNA

<213> Artificial sequence

<400>2

aacacaggga gcacttctat tg 22

<210>3

<211>24

<212>DNA

<213> Artificial sequence

<400>3

gtccgttatt atacgaataa ttgg 24

<210>4

<211>1582

<212>DNA

<213> apple

<400>4

gacacttcaa ttattggaca gttcgtttct tcttggaaac gtcctgcaat ctgagtcaac 60

ccacagagcg aagtaaataa ataaaatgga gcatttctgc tcaccatcgt tgatatggtg 120

aatgtcgtta tacagctaat catttgtcat gtgttatttc atttaatttt agtgaacttt 180

catattaaat gttatttttt taaattaaaa aaaataacca aagttaaata aaatgacacg 240

tagtagataa ttaagtttac gataaaatta agatggtgaa caaaaatact ctctaaataa 300

aagtgtattt gaaaggtctt ctaacaacgg caacaacaac tacaaaataa taacaatgaa 360

agcgtagtgg gcgacctcaa caaacaaacc tttggtcctt tttcgtttca tgattccatt 420

tccctagtcc gaatacacag taaggagaaa acaaaaaagt cttaggaaat taaaacaaaa 480

gtacagagaa aacaacaagt tttaggaaat caaacttctc aataagggac tatgatcatg 540

ataaaacatc atacaggaca aagtacagta gaggattttg ttttgattcg ttcaataatt 600

gttgcagcca attaactgcc atgacttcgt ttaggaaacc aggcagctcg gaccccttcc 660

tttgacttct tgatcttgac aaaacatttt agccaaggtg gttttcccac atcctccagc 720

agcagtcrgc acaagcatag acaccttttc atccttaagg agcttcatct tcaactcctt 780

caacggcaaa tccaacctga ctgtaactga tggcggttca ggcaccagac gaacacttca 840

ccttttgtgg ctgattagat tagtttttat caccaaactc tcttctattc gagagagaat 900

caaagtttcc ctaaatatgt atgtggattc agtcgtaatg ggtgctctga gaacggcatt 960

tcaaatgctg gttgatgctr taaaatcagt gcaggaggag aatacagtgt tccaacacct 1020

cctgagagac atcaaatcta cactggactc tctacaacca ctcataaaaa aatataacgc 1080

gaaagaggga ctataaaatt ttgcaataca gacagaggag ggagcaaatc ttgttcaaaa 1140

gtccacacgc caactttgct gcacttttga acaagatttg ctccctcctc catctgtatt 1200

gcaaatttgc agtccctctt tcgggttata tttttttatg agtggttgta gagagtcaag 1260

tgtggatttg atgtttctgg ggaggtgttc gaacattgta ttctcctcct cagctggttt 1320

cacagcacaa accgcattta aaatgccgtg accaaagcca catacataat tacgaaaaga 1380

aagagactca aaactcaatt ctcttacata atctgatgaa agaacagaaa ttccaatgga 1440

tttacggaga gagagtaaaa taatctagct tgatgagaaa ctgaggatgt tatgtaagtt 1500

gtttcttcgc gactcggagt ttcagcacac atatatacaa ctcaacgaac gtgttgacca 1560

aataaaaaac acaacgagtt ga 1582

<210>5

<211>21

<212>RNA

<213> apple

<400>5

uuugaacaag auuugcuccc u 21

<210>6

<211>240

<212>DNA

<213> Artificial sequence

<400>6

aaacttgttc tcataaacga gggagttgtt gttgttatgg tctaatttaa atatggtcta 60

aagaagaaga ataaacttgt tctcataaac gagggagttg ttgttgttat ggtctaattt 120

aaatatggtc taaagaagaa gaataaactt gttctcataa acgagggagt tgttgttgtt 180

atggtctaat ttaaatatgg tctaaagaag aagaataaac ttgttctcat aaacgaggga 240

Claims

1. The SNP molecular marker related to the apple alternaria leaf spot resistance is characterized in that the SNP molecular marker is positioned on a promoter of a primary transcript Md-MIRLn12-277 for regulating and controlling the apple alternaria leaf spot Md-MIRLn12, the nucleotide sequence of the SNP molecular marker is shown as SEQ ID NO:1, and the resistance of an apple variety with a 378bp base T to the apple alternaria leaf spot is remarkably higher than that of an apple variety with a G base.

2. The primer for detecting the SNP molecular marker related to apple alternaria leaf spot resistance of claim 1, which comprises

Forward primer F5 '-AACACAGGGAGCACTTCTATTG-3'

And reverse primer R5 '-GTCCGTTATTATACGAATAATTGG-3'.

3. The application of the primer for detecting the SNP molecular marker related to the alternaria leaf spot disease resistance of the apple according to claim 1 in identifying the alternaria leaf spot disease resistant varieties and the susceptible varieties is characterized by comprising the following steps:

1) extracting genome DNA of an apple plant to be detected;

2) carrying out PCR amplification reaction by using the genomic DNA of an apple plant to be detected as a template and using the primers F and R in claim 2;

4. Kit for detecting alternaria leaf spot disease resistant apple varieties containing the primers of claim 2.

5. The application of the primer for detecting the SNP molecular marker related to the apple alternaria leaf spot resistance in claim 1 in apple molecular marker assisted breeding.