CN105596930A

CN105596930A - Fermentation microorganism Chinese herb preparation for tracheopathy and preparation method and application of fermentation microorganism Chinese herb

Info

Publication number: CN105596930A
Application number: CN201610061678.XA
Authority: CN
Inventors: 李业明; 李兴尧
Original assignee: Individual
Current assignee: Individual
Priority date: 2016-01-28
Filing date: 2016-01-28
Publication date: 2016-05-25

Abstract

The invention relates to the field of fermentation microorganism Chinese herb preparations, in particular to a fermentation microorganism Chinese herb preparation for treating respiratory system diseases and derived diseases of the respiratory system diseases and a preparation method and application of the fermentation microorganism Chinese herb preparation. The fermentation microorganism Chinese herb preparation is obtained by fermenting oyster mushrooms in Chinese herb materials. The Chinese herb materials include tendril-leaved fritillary bulb, common coltsfoot flowers, liquorice roots, radix trichosanthis, radix scutellariae, honeysuckle flowers, radix sophorae subprostratae, blackberrykiky rhizomes, pinellia ternate, rhizoma atractylodis macrocephalae, platycodon roots, fructus trichosanthis, radix stemonae, rhizoma anemarrhenae, rhizoma phragmitis, rhizoma arisaematis, rhizoma cynanchi stauntonii, bile arisaema, gomphrena globosa, radix asteris, semen lepidii, root bark of white mulberry, lucid ganoderma, Japanese ardisia herb, radix ophiopogonis, lily, radix glehniae, schisandra chinensis, grifola umbellate, poria cocos and ginseng, tabasheer, stiff silkworms, radix aristolochiae fangchi, apricot kernels, cortex magnoliae officinalis, momordica grosvenori, earthworms, spreading hedyotis herb, herba ajugae, folium pyrrosiae, folium isatidis and radix astragali. The fermentation microorganism Chinese herb preparation has the effects of relieving coughs and asthma, clearing away heat and relieving exterior syndromes, moistening the lung and tonifying the spleen, tonifying qi and eliminating phlegm, and the like. All the used raw medicinal materials are traditional Chinese herbs, and the dosages of the raw medicinal materials are within the pharmacopeia and national standard range, so that the fermentation microorganism Chinese herb preparation is free of toxic and side effects, safe and reliable.

Description

Fermentative microorganism Chinese medicine preparation of a kind of tracheopathy and preparation method thereof and application

Technical field

The present invention relates to fermentative microorganism field of traditional Chinese, is that one is treated respiratory disease and spread out specificallyFermentative microorganism Chinese medicine preparation of raw disease and its preparation method and application.

Background technology

Treat clinically at present the respiratory system diseases such as acute/chronic bronchitis, asthma, pulmonary emphysema, pulmonary heart disease, cold coughSick and derivative disease, doctor trained in Western medicine adopts anti-inflammatory, the anti-quick and spasmolysis therapy such as relieving asthma more, gently adopt aminophylline, receptor agonist,Cholinolytic class, steroids and medium discharge the medicine controls such as retardance class, and effect is undesirable, cures the symptoms, not the disease, and is difficult to radical cure, conventionallyWith side effect, and long-term use is easily developed immunity to drugs; Heavy adopt the method such as operation, not only expense is high, also can give diseasePeople brings economical and painful greatly mentally. And the medicine that the traditional Chinese medical science adopts often adopts to increase for the long patient of the course of disease and takes medicine timeNumber, two the method for taking medicine maintain curative effect mitigate the disease, bring very big burden to body metabolism organ, and long-term use can causeBacterial drug resistance.

Summary of the invention

The present invention is directed to the problems referred to above, provide one to treat that acute and chronic bronchitis, cough are panted, cold cough, heavy breathingBreathe heavily, the fermentative microorganism Chinese medicine of the respiratory disease such as pulmonary emphysema, pulmonary heart disease, cor pulmonale, lung cancer and derivative disease thereofPreparation and its preparation method and application, this fermentative microorganism Chinese medicine preparation has relieving cough and asthma, relieving superficies by cooling, moistening lung invigorating the spleen, benefitThe effects such as gas eliminates the phlegm.

For achieving the above object, the technical solution used in the present invention is:

A fermentative microorganism Chinese medicine preparation for tracheopathy, the gained that ferments in Chinese medicine material of picking up the ears, described Chinese medicine is formerMaterial is meter by weight: Bulbus Fritillariae Cirrhosae 20-50 part, tussilago 20-50 part, Radix Glycyrrhizae 20-50 part, root of Chinese trichosanthes 20-50 part, root of large-flowered skullcap 20-50 parts, honeysuckle 20-50 part, subprostrate sophora 20-50 part, blackberry lily 20-50 part, tuber of pinellia 20-50 part, bighead atractylodes rhizome 20-50 part, balloonflower root 20-50Part, Snakegourd Fruit 20-50 part, tuber of stemona 20-50 part, wind-weed 20-50 part, reed rhizome 20-50 part, rhizoma arisaematis 20-50 part, Cynanchum glaucescens 20-50 part,Arisaema cum bile 15-45 part, globe amaranth 20-50 part, aster 20-50 part, lepidium seed 20-50 part, root bark of white mulberry 20-50 part, glossy ganoderma 20-50Part, ardisia japonica 20-50 part, the tuber of dwarf lilyturf 15-45 part, lily 20-50 part, radix glehniae 20-50 part, fruit of Chinese magnoliavine 20-50 part, pig a kind of reed mentioned in ancient books 20-50 parts, Fu ginseng 20-50 part, tabasheer 20-50 part, stiff silkworm 20-50 part, stone solution 20-50 part, almond 20-50 part, Mangnolia officinalis 20-50 part,Momordica grosvenori 20-50 part, earthworm 20-50 part, Herba Hedyotidis Diffusae 20-50 part, ajuga decumbens 20-50 part, pyrrosia lingua 20-50 part, largeLeafiness 20-50 part and Radix Astragali 20-50 part;

Described picking up the ears as Pleurotussp., has been deposited in " Chinese microorganism strain preservation pipe on April 14th, 2014Reason committee common micro-organisms " center ", No. 3, Yard 1, BeiChen xi Road, Chaoyang District, Beijing City, deposit number is CGMCCNo.9060。

Described Chinese medicine material is counted by weight: 20 parts of Bulbus Fritillariae Cirrhosaes, 20 parts of tussilagoes, 20 parts, Radix Glycyrrhizae, 20 parts of roots of Chinese trichosanthes, Huang20 parts of a kind of reed mentioned in ancient books, 20 parts of honeysuckles, 20 parts of subprostrate sophoras, 20 parts of blackberry lilys, 20 parts of the tuber of pinellia, 20 parts of the bighead atractylodes rhizomes, 20 parts of balloonflower roots, 20 parts of Snakegourd Fruits, the tuber of stemona20 parts, 20 parts of the wind-weeds, 20 parts of reed rhizomes, 20 parts of rhizoma arisaematis, 20 parts of Cynanchum glaucescens, 15 parts of arisaema cum bile, 20 parts of globe amaranths, 20 parts of asters, Roripa20 parts of Li, 20 parts of the root barks of white mulberry, 20 parts of glossy ganodermas, 20 parts of ardisia japonicas, 15 parts of the tubers of dwarf lilyturf, 20 parts of lilies, 20 parts of radix glehniaes, the fruit of Chinese magnoliavine 20Part, 20 parts of pig a kind of reed mentioned in ancient books, 20 parts of Fu ginsengs, 20 parts of tabasheers, 20 parts of stiff silkworms, 20 parts of stone solutions, 20 parts, almond, 20 parts of Mangnolia officinalis, 20 parts of Momordica grosvenoris,20 parts of 20 parts of earthworms, 20 parts of Herba Hedyotidis Diffusaes, 20 parts of ajuga decumbens, 20 parts of pyrrosia linguas, 20 parts of folium isatidis and the Radixs Astragali.

A kind of preparation method of fermentative microorganism Chinese medicine preparation of tracheopathy:

(1) count by weight Bulbus Fritillariae Cirrhosae 20-50 part, tussilago 20-50 part, Radix Glycyrrhizae 20-50 part, root of Chinese trichosanthes 20-50Part, root of large-flowered skullcap 20-50 part, honeysuckle 20-50 part, subprostrate sophora 20-50 part, blackberry lily 20-50 part, tuber of pinellia 20-50 part, bighead atractylodes rhizome 20-50 part,Balloonflower root 20-50 part, Snakegourd Fruit 20-50 part, tuber of stemona 20-50 part, wind-weed 20-50 part, reed rhizome 20-50 part, rhizoma arisaematis 20-50 part, whiteFront 20-50 part, arisaema cum bile 15-45 part, globe amaranth 20-50 part, aster 20-50 part, lepidium seed 20-50 part, root bark of white mulberry 20-50Part, glossy ganoderma 20-50 part, ardisia japonica 20-50 part, the tuber of dwarf lilyturf 15-45 part, lily 20-50 part, radix glehniae 20-50 part, fruit of Chinese magnoliavine 20-50 parts, pig a kind of reed mentioned in ancient books 20-50 part, Fu ginseng 20-50 part, tabasheer 20-50 part, stiff silkworm 20-50 part, stone solution 20-50 part, almond 20-50 part,Mangnolia officinalis 20-50 part, Momordica grosvenori 20-50 part, earthworm 20-50 part, Herba Hedyotidis Diffusae 20-50 part, ajuga decumbens 20-50 part, stoneThe Chinese medicine material of Wei 20-50 part, folium isatidis 20-50 part and Radix Astragali 20-50 part mixes, stand-by;

(2) will pick up the ears to be inoculated in above-mentioned Chinese medicine material and ferment, gained fermentate furnishing pasty state is fermented tcm preparation;

Described picking up the ears (Pleurotussp.), has been deposited in " Chinese microorganism strain preservation pipe on April 14th, 2014Reason committee common micro-organisms " center ", deposit number is CGMCCNo.9060.

Described step (2) is that the amount of 1-5% is inoculated in Chinese medicine material by mass percentage by picking up the ears, and at 35-65 DEG CBottom fermentation 1-7 days.

Described tunning can be made into powder, tablet, pill, capsule and pill, capsule, emulsion, syrup or oral liquid.

A kind of medicine preparation is as the application in the medicine of preparation prevention or treatment respiratory disease and derivative disease thereof.

Described respiratory disease and derivative disease thereof comprise that cough is panted, cold cough, acute and chronic bronchitis, heavy breathingBreathe heavily, pulmonary emphysema, pulmonary heart disease, lung cancer, cor pulmonale.

The fermentative microorganism Chinese medicine preparation of preparing with said method can be for the preparation of prevention or treatment respiratory diseaseAnd the medicine of derivative disease, described respiratory disease and derivative disease thereof comprise that cough is panted, cold cough, acute and chronicBronchitis, asthma, pulmonary emphysema, pulmonary heart disease, lung cancer, cor pulmonale etc.

The present invention's Effect of Chinese Medicine Qing thermal detoxification used, kidney tonifying benefit lung, receive gas under gas Dingchuan, apocenosis, purging intense heat eliminating dampness, cough-relieving, vent one's spleenPipe spasm, tonifying lung kidney, reinforcing stomach reg fluid, the tonifying Qi of eliminating the phlegm, cough-relieving, push away Chen Zhixin, promote the integrality of body cell, increase disease-resistant exempting fromEpidemic disease power, eliminates body harmful substance, is that the pathologic structure after curing can recover normal completely; The present invention is pure fermentative microorganismChinese medicine preparation, safe without toxic side effect; In addition, the present invention is inheriting on science of Chinese drug processing fermentation method basis, in conjunction with modern biologicalThe fermentation technique of engineering, utilizes and picks up the ears Chinese medicine to carry out fermentation process, has increased curative effect and the utilization rate of medicine.

Detailed description of the invention

Embodiment 1

The preparation of fermentative microorganism Chinese medicine preparation powder:

1. meter by weight, get 20 parts of Bulbus Fritillariae Cirrhosaes, 20 parts of tussilagoes, 20 parts, Radix Glycyrrhizae, 20 parts of roots of Chinese trichosanthes, 20 parts of the roots of large-flowered skullcap,20 parts of honeysuckles, 20 parts of subprostrate sophoras, 20 parts of blackberry lilys, 20 parts of the tuber of pinellia, 20 parts of the bighead atractylodes rhizomes, 20 parts of balloonflower roots, 20 parts of Snakegourd Fruits, 20 parts of the tubers of stemona, know20 parts of mothers, 20 parts of reed rhizomes, 20 parts of rhizoma arisaematis, 20 parts of Cynanchum glaucescens, 15 parts of arisaema cum bile, 20 parts of globe amaranths, 20 parts of asters, lepidium seed 20Part, 20 parts of the root barks of white mulberry, 20 parts of glossy ganodermas, 20 parts of ardisia japonicas, 15 parts of the tubers of dwarf lilyturf, 20 parts of lilies, 20 parts of radix glehniaes, 20 parts, the fruit of Chinese magnoliavine, pig20 parts of a kind of reed mentioned in ancient books, 20 parts of Fu ginsengs, 20 parts of tabasheers, 20 parts of stiff silkworms, 20 parts of stone solutions, 20 parts, almond, 20 parts of Mangnolia officinalis, 20 parts of Momordica grosvenoris, earthwormThe Chinese medicine material medicine that 20 parts, 20 parts of Herba Hedyotidis Diffusaes, 20 parts of ajuga decumbens, 20 parts of pyrrosia linguas, 20 parts of folium isatidis and the Radix Astragali are 20 parts,Co-grinding, crosses 100 mesh sieves, mixes and makes Chinese medicine mixing fine powders;

2. the PDA solid medium of picking up the ears to be inoculated in, 20 DEG C, cultivate single bacterium colony of the purifying of must picking up the ears 70 hours.

3. single bacterium colony is picked up the ears to be inoculated in above-mentioned Chinese medicine mixing fine powders by mass fraction 3% inoculum concentration 65 DEG C of fermentations 7My god, obtain product;

4. above-mentioned product is dried, is pulverized, and crosses 120 mesh sieves, and gained fine powder is powder.

Described picking up the ears (Pleurotussp.) carried out to DNA detection:

(1) DNA extracts

Extract kit (MPBiomedicals, SantaAna, CA) with FastDNASPIN soil DNA and extract fungiDNA。

(2) pcr amplification

Pcr amplification primer:

ITS1：5’CTTGGTCATTTAGAGGAAGTAA3'

ITS4:5’TCCTCCGCTTATTGATATGC3'

Pcr amplification program

(3) order-checking

PCR product is entrusted to the order-checking of Shanghai bioengineering Co., Ltd

Gene order result:

CTCTCCGGGGGGAACCTTGGGGAGGGTCCTTTAATGATTCCCTTAGGGAGTGGTGGTGGCCTTTAGGGGCCAGGTCCCGGTTCCATAGTTTTTTCACCCCCCGTGGACTTTTGAAAGGTTTGGGGAATTGTTTTTCCAATTGTTCAGATTGGTTTGCTGGGATTTAAACGTCTCGGTGTGACTACGCAGTCTATTTACTTACCCCCCCCCAAAGGAAGTTTTCGAAAGTCCATTAAAGGGCCCTGGGCCTTTTAACCCTTAATCCAACTTTCACCAAGGATTTTTTGGCTTTTGCCATGAAGGAAGAAGCAAGGAAAATGGGTAAAGAAAGGGAAATGCCGAAATCCAGGGATCCTTGGATTCTTGGACCCCCCCTGCCCCCCCTGGTATTTCGGGGGGCCAGCCCGGTTGGGGGGCCATTAATTTTTCAAATCCCTTTGGTTTTTTTCCAATTGTGATGTTTGGATTGTTGGGGGCTGCTGGCCTTGACAGGTCGGCTCCTCTTAAATGCATTAGCAGGACTTCTCATTGCCTCTGCGCATGATGTGATAATTATCACTCATCAATAGCACGCATGAATAGAGTCCAGCTCTCTAATCGTCCGCAAGGACAATTTGACAATTGACCTCAAATCAGGTAGACAGCCGGATTCT

(4) comparison result, through NCBI (NationalCenterofBiotechnologyInformation[www.ncbi.nlm.nih.gov]) database comparison, result is as follows: PleurotusostreatusisolateNW42618SribosomalRNAgene (accession number: EU622251.1)

Pleurotusostreatus picks up the ears.

Embodiment 2

1. meter by weight, get 30 parts of Bulbus Fritillariae Cirrhosaes, 30 parts of tussilagoes, 30 parts, Radix Glycyrrhizae, 30 parts of roots of Chinese trichosanthes, 40 parts of the roots of large-flowered skullcap,40 parts of honeysuckles, 40 parts of subprostrate sophoras, 40 parts of blackberry lilys, 40 parts of the tuber of pinellia, 20 parts of the bighead atractylodes rhizomes, 30 parts of balloonflower roots, 30 parts of Snakegourd Fruits, 40 parts of the tubers of stemona, know40 parts of mothers, 40 parts of reed rhizomes, 40 parts of rhizoma arisaematis, 40 parts of Cynanchum glaucescens, 30 parts of arisaema cum bile, 30 parts of globe amaranths, 30 parts of asters, lepidium seed 30Part, 30 parts of the root barks of white mulberry, 30 parts of glossy ganodermas, 30 parts of ardisia japonicas, 40 parts of the tubers of dwarf lilyturf, 20 parts of lilies, 20 parts of radix glehniaes, 30 parts, the fruit of Chinese magnoliavine, pig30 parts of a kind of reed mentioned in ancient books, 30 parts of Fu ginsengs, 30 parts of tabasheers, 40 parts of stiff silkworms, 40 parts of stone solutions, 40 parts, almond, 40 parts of Mangnolia officinalis, 40 parts of Momordica grosvenoris, earthwormThe Chinese medicine material medicine that 20 parts, 20 parts of Herba Hedyotidis Diffusaes, 30 parts of ajuga decumbens, 30 parts of pyrrosia linguas, 30 parts of folium isatidis and the Radix Astragali are 40 parts,Co-grinding, crosses 100 mesh sieves, mixes and makes Chinese medicine mixing fine powders;

2. the PDA solid medium of picking up the ears to be inoculated in, 35 DEG C, cultivate single bacterium colony of the purifying of must picking up the ears 120 hours.

Embodiment 3

Acute toxicity test:

Tested medicine is fermentative microorganism Chinese medicine preparation powder prepared by above-described embodiment 1, and it is mixed with aqua sterilisa44% and 33% concentration (g/ml) is for experiment. Animal subject is Kunming kind closed colony small white mouse, and body weight 18-22g, by middle traditional Chinese medical scienceUniversity of section Experimental Animal Center provides, the animal used as test quality certification number: distant real bar closes word and closes word 008 with distant essence No. 1.

(1) get 20 of small white mouses, male and female half and half, fasting be can't help water 17 hours, weighs;

(2) according to dosage the tested medicine of gastric infusion 44% concentration of 22g/kg (g/ml) (being no more than animal can connectThe maximum volume 1ml/20g being subject to), after administration, conventional raising, observes 7 days;

(3) according to dosage 16.5g/kg again and again the tested medicine of gastric infusion 33% concentration (g/ml) (be no more than animalReceptible maximum volume 1ml/20g), after administration, conventional raising, observes 7 days.

Result shows, the random spring that occurs dapping in 10 minutes after administration of the animal subject in above-mentioned steps (2), to IRThe irritated Agitation that waits, approximately continues 6 and as a child replied; Find 6 of animal deads inferior morning, account for 30% of animal subject sum(6/20); Dead animal is dissected and is visually observed the important organs such as the heart, liver,spleen,kidney, lung, and no abnormality seen changes; In 24 hours, be deadThe animal subject of dying all can be got well during experimental observation. Animal subject in above-mentioned steps (3) has no by drug poisoning and drawsThe abnormal change rising.

To sum up, the maximal tolerance dose of a gastric infusion of fermentative microorganism Chinese medicine preparation powder small white mouse of the present invention is largeIn or equal 16.5g/kg, be less than 22g/kg. This dosage is more than or equal to the clinical dosage of admitting to try out (in 60kg) every day165 times of 0.1g/kg day, are less than its 220 times, with reference to requirement (Chinese people's republicanism of new Chinese medicine toxicity test securityThe Ministry of Public Health of state: provisions for new drugs approval " about the amendment and supplement regulation of Chinese medicine part ", play execution on September 1st, 1992). Therefore thisInvent the clinical adult's dosage of described fermentative microorganism Chinese medicine preparation powder 3g/ time, it is safe that day takes 2 times.

Embodiment 6

Antiinflammatory action test:

Tested medicine is fermentative microorganism Chinese medicine preparation powder prepared by above-described embodiment 1, is mixed with 6.6% with aqua sterilisaConcentration (g/ml) is for experiment. Animal subject is Kunming kind closed colony small white mouse, and body weight 18-22g, is tested by Chinese Medical Sciences UniversityAnimal center provides. The animal used as test quality certification number: distant real bar closes word and closes word 008 with distant essence No. 1.

(1) get 40 of tested small white mouses, male and female half and half, fasting be can't help water 17 hours, weighs, and is divided at random 4 groups, everyOrganize 10, male and female half and half;

(2) according to the form below 1 gastric infusion, once a day, successive administration (is no more than the receptible maximum volume of animal in 3 days1ml/20g)；3×22÷1000

(3) after last administration 1 hour, by the scorching method of caused by dimethylbenzene xylene, auris dextra was smeared caused by dimethylbenzene xylene inflammation, after 20 minutes, puts to death little BaiMouse, cuts two ear same area auricles with the card punch of diameter 7mm, and assay balance is weighed, using two auricle weight differences as swellingDegree, by the significance of difference of the more each experimental group of t method of inspection and control group, result is listed table 1 in.

The antiinflammatory action of small white mouse ear swelling due to table 1 fermentative microorganism Chinese medicine preparation of the present invention paraxylene

* P < 0.05, * * P < 0.01 (with control group comparison)

As seen from the above table, fermentative microorganism Chinese medicine preparation of the present invention can obviously suppress the small white mouse due to dimethylbenzeneEar swelling, has antiinflammatory action.

Embodiment 6

Tracheitis clinical effect trial:

Clinical data: tested case be all defined as respectively acute bronchitis, chronic bronchitis, asthma, pulmonary heart disease,Pulmonary emphysema case.

Acute bronchitis patient's 86 examples, the male sex's 46 examples, women's 40 examples, age 14-60 year; All meet following diagnosis markAccurate.

The clinical criteria of acute bronchitis disease: 1. morbidity is anxious, often occurs after the infection of the upper respiratory tract that excitant is dryCough, or have a small amount of sputum crudum, sense of discomfort or dull pain after companion's breastbone, can have mucopurulent sputum while having bacterium to infect. Bronchial spasmTime have asthma, constitutional symptom to have slight chilly, fever, 38 DEG C of left and right of body temperature. 2. physical signs of lung feminine gender or two pulmonary respiration sounds are coarse,Or audible dry, the bubble that are dispersed in. 3. blood leucocyte number is mostly normal, and bacterium increases while infection. 4. chest X-ray justOften, or have an increased bronchovascular shadows. 5. the course of disease is generally self limiting, and constitutional symptom disappears for 3～5 days, and the cough symptom of coughing up phlegm can be prolonged sometimesWithin continuous 2～3 weeks, just disappear. 6. should get rid of pertussis, pneumonia, Bronchopneumonia, lung bronchogenic carcinoma, pulmonary tuberculosis etc.

Chronic bronchitis patient 110 examples, the male sex's 60 examples, women's 50 examples, age 35-60 year, course of disease 3-8; All symbolsClose following diagnostic criteria.

The clinical criteria of chronic bronchitis: 1. Main Basis medical history and clinical symptoms, getting rid of its of the heart, lungAfter his illness, there are chronic cough, expectoration repeatedly to show effect, at least continue 3 months in annual, occur that continuously more than 2 years person can examineDisconnected; 2. annual morbidity not enough March, and have clear and definite objective determination according to the also diagnosable chronic bronchitis such as (as x-ray).

Asthmatic patient 100 examples, the male sex's 55 examples, women's 45 examples, age 15-65 year, course of disease 2-10; All meet followingDiagnostic criteria.

The clinical criteria of asthma: 1. repeatedly outbreak pant, out of breath, uncomfortable in chest or cough, can at two lungs while 2. outbreakHear wheezing sound, expiratory flow retard; 3. above-mentioned symptom and sign can be alleviated or spontaneous remission through treatment.

Patients with cor pulmonale 15 examples, the male sex's 9 examples, women's 6 examples, age 45-70 year, course of disease 3-6; All meet following diagnosisStandard.

Pulmonary heart disease clinical criteria: selecting tcm diagnosis pulmonary heart disease is standard: have a delicate constitution, expiratory dyspnea, limbs withoutPower, feeling of oppression and pain in the chest, cough are breathed hard, edema of lower extremity. As meet above symptom and can make a definite diagnosis pulmonary heart disease.

Pulmonary emphysema patient's 50 examples, the male sex's 28 examples, women's 22 examples, age 40-60 year, course of disease 4-11; All meet followingDiagnostic criteria.

Pulmonary emphysema clinical criteria: 1. have the medical history such as chronic bronchitis, bronchial astehma. 2. morbidity slowly, have formerDisease symptom is as cough, expectoration etc. In early days, when work, breathe hard, and increase the weight of with disease progression, and subtract with tired, body weightLight and DB. 3. early stage Non Apparent Abnormality body weight, typical person has emphysematous chest, and hypopnea, language weaken, lung voiced soundBoundary moves down, and border of cardiac dullness dwindles, and breathes and extends. 4. chest x-ray inspection: lung peripheral vessels reduces, attenuates, diaphram declines, flattens,Mobility weakens, podiod is vertical, long and narrow or have a pulmonary belb.

Methods for the treatment of: tested medicine is fermentative microorganism Chinese medicine preparation powder prepared by embodiment 1,2g/ time, one day twoInferior, ante cibum warm boiled water; During fermentative microorganism Chinese medicine preparation powder treatment prepared by clinical use embodiment 1, patient is not allUse other treatment means.

Clinical efficacy:

Acute bronchitis clinical efficacy: by following clinical efficacy criterion, in 86 routine acute bronchitis patients, 81Example acute bronchitis patient cures, and wherein 77 routine patient cured in 2 weeks, and other 4 routine patient 3-4 weeks cure; Effective 2 examples, haveImitate 1 example, invalid 2 examples; Cure rate 94.2%, efficient 97.7%.

The clinical efficacy criterion of acute bronchitis disease: 1. clinical cure: clinical symptom disappearance, functional activity recoversNormally; 2. effective: clinical symptoms are clearly better; 3. effective: clinical symptoms part takes a turn for the better; 4. invalid: clinical symptoms sign is without changingBecome.

Chronic bronchitis clinical efficacy: by following clinical efficacy criterion, in 110 routine chronic bronchitis patients,95 routine chronic bronchitis patients are cured, and wherein 80 routine patient cures for 3 months, within other 15 routine patient 4-5 months, cure; Effective 11Example, effective 1 example, invalid 3 examples; Cure rate 86.4%, efficient 97.3%.

The clinical efficacy criterion of chronic bronchitis: 1. cure: clinical symptoms and pulmonary rale obviously disappear, XLine Chest X-rays shade disappears; 2. effective: clinical symptoms disappear substantially, pulmonary rale obviously reduces, X-ray chest-fluoroscopy dash area absorbs;3. effective: clinical symptoms part is improved, pulmonary rale reduces, and X-ray chest-fluoroscopy shade small part absorbs; 4. invalid: the state of an illness is without obviouslyImprove or increase the weight of to some extent.

Asthma clinical efficacy: by following clinical efficacy criterion, 115 routine asthma patient clinicals are cured 73 examples, itsIn 41 example 3 months cure, 22 routine patients 5 months cure, 10 routine patients 6 months cure; Effective patient: 23 examples; Effectively patient: 9Example; Invalid patient: 10 examples; Cure rate 63.5%, efficient 91.3%.

The clinical efficacy criterion of asthma: 1. cure: the symptom of panting and lung's wheezing sound disappear; 2. effective: to pantSymptom and lung's wheezing sound are clearly better; 3. effective: the symptom of panting and lung's wheezing sound part are improved; 4. invalid: the symptom of pantingAnd lung's wheezing sound is without change.

Pulmonary heart disease clinical efficacy: by following clinical efficacy criterion, 15 routine patients with cor pulmonale, take medicine 1 of the present inventionAfter month, symptom all has alleviation, takes after 3 months, and each symptom is obviously improved, the routine patients with cor pulmonale of clinical testing 15, and effective 9 examples, haveImitate 4 examples, invalid 2 examples; Efficient 86.7%.

Pulmonary heart disease clinical efficacy criterion: 1. effective: physique strengthens, with it energetically, feeling of oppression and pain in the chest, expiratory dyspnea, underThe symptoms such as limb oedema are obviously alleviated; 2. effective: physique strengthens, and the symptoms such as feeling of oppression and pain in the chest, expiratory dyspnea, edema of lower extremity have alleviation;3. invalid: above symptom is unchanged.

Pulmonary emphysema clinical efficacy: by following clinical efficacy criterion, cure 37 examples in 50 routine patients, wherein 24 examples are curedTime is 3-5 month, and 8 routine patient's healing times are 6-8 month, and 5 routine patient's healing times are 10-12 month; Effective 7 examples, haveImitate 2 examples, invalid 4 examples; Cure rate 74%, efficient 92%.

Pulmonary emphysema curative effect judging standard: 1. clinical cure: breathe hard, the clinical sign such as expiratory dyspnea disappears, functional activity is extensiveMultiple normal; 2. effective: clinical symptoms are clearly better; 3. effective: clinical symptoms part takes a turn for the better; 4. invalid: clinical symptoms and x-ray inspectionLook into without changing.

Further illustrate effect of the present invention below in conjunction with concrete case:

Case 1: XX recklessly, man, 43 years old, Shenyang City, Liaoning Province, suffered from chronic bronchitis 5 years, and every winter-spring season outbreak is brightAobvious. In May, 2013 is because cough, the yellow phlegm of pyoptysis are in my institute's treatment. Be diagnosed as through the court: chronic bronchitis. Through adopting the present inventionThe minimizing of after traditional Chinese medical herbal treatment 2 months, coughing, cough up phlegm, after have continuous treatment after 3 months symptom substantially disappear, so far without recurrence.

Case 2: XX recklessly, man, 60 years old, people from Changyuan County, Henan Province, suffered from pulmonary heart disease 3 years, and in March, 2012 is because of cough, gas uncomfortable in chestShort, asthma, weakness of limbs, the slight oedema of lower limb, in my institute's treatment, is diagnosed as through the court: pulmonary heart disease. Through adopting the traditional Chinese medical science of the present inventionTreatment by Chinese herbs took effect after 3 months, treated continuously again health rehabilitation gradually after 6 months, and breathing, diet, activity all have clear improvement.

Model case 3: Song XX, female, 59 years old, Liao Nengsheng people from Shenyang City, suffered from pulmonary emphysema 9 years, coughs throughout the year and breathes heavily incessantly. 2013April 4 because coughing, cough up phlegm, uncomfortable in chest, asthma Lai Wo institute hospitalization, be diagnosed as through the court: pulmonary emphysema. In adopting the present inventionDoctor treatment by Chinese herbs after 3 months symptom be clearly better, continue to strengthen again treatment 6 months after symptom substantially eliminate, so far without recur.

In sum, fermentative microorganism Chinese medicine preparation of the present invention to essential the acute and chronic bronchus without complicationScorching patient's cure rate is very high, and effect is very obvious, efficient all more than 97%; In addition to diseases such as asthma, pulmonary emphysema, pulmonary heart diseasesDisease is efficient is not less than 85%. After tested patient takes medicine, appetite and body weight generally increase, and the state of mind takes a turn for the better. Before and after taking medicineControlled observation, this fermentative microorganism Chinese medicine preparation has anti-inflammatory cough-relieving function, can increase body's immunity. Drug effect is obvious,And have no side effect, medication is convenient, safe and reliable.

Claims

1. a fermentative microorganism Chinese medicine preparation for tracheopathy, is characterized in that: the gained that ferments in Chinese medicine material of picking up the ears, instituteStating Chinese medicine material counts by weight: Bulbus Fritillariae Cirrhosae 20-50 part, tussilago 20-50 part, Radix Glycyrrhizae 20-50 part, root of Chinese trichosanthes 20-50 part,Root of large-flowered skullcap 20-50 part, honeysuckle 20-50 part, subprostrate sophora 20-50 part, blackberry lily 20-50 part, tuber of pinellia 20-50 part, bighead atractylodes rhizome 20-50 part, tangerineStalk 20-50 part, Snakegourd Fruit 20-50 part, tuber of stemona 20-50 part, wind-weed 20-50 part, reed rhizome 20-50 part, rhizoma arisaematis 20-50 part, Cynanchum glaucescens20-50 part, arisaema cum bile 15-45 part, globe amaranth 20-50 part, aster 20-50 part, lepidium seed 20-50 part, root bark of white mulberry 20-50 part,Glossy ganoderma 20-50 part, ardisia japonica 20-50 part, the tuber of dwarf lilyturf 15-45 part, lily 20-50 part, radix glehniae 20-50 part, fruit of Chinese magnoliavine 20-50Part, pig a kind of reed mentioned in ancient books 20-50 part, Fu ginseng 20-50 part, tabasheer 20-50 part, stiff silkworm 20-50 part, stone solution 20-50 part, almond 20-50 part, thickMend 20-50 part, Momordica grosvenori 20-50 part, earthworm 20-50 part, Herba Hedyotidis Diffusae 20-50 part, ajuga decumbens 20-50 part, pyrrosia lingua20-50 part, folium isatidis 20-50 part and Radix Astragali 20-50 part;

Described picking up the ears as Pleurotussp., has been deposited in " Chinese microorganism strain preservation management committee on April 14th, 2014Member's meeting common micro-organisms " center ", deposit number is CGMCCNo.9060.

2. by the fermentative microorganism Chinese medicine preparation of tracheopathy claimed in claim 1, it is characterized in that: described Chinese medicine material is by heavyAmount umber meter: 20 parts of Bulbus Fritillariae Cirrhosaes, 20 parts of tussilagoes, 20 parts, Radix Glycyrrhizae, 20 parts of roots of Chinese trichosanthes, 20 parts of the roots of large-flowered skullcap, 20 parts of honeysuckles, subprostrate sophora 20Part, 20 parts of blackberry lilys, 20 parts of the tuber of pinellia, 20 parts of the bighead atractylodes rhizomes, 20 parts of balloonflower roots, 20 parts of Snakegourd Fruits, 20 parts of the tubers of stemona, 20 parts of the wind-weeds, reed rhizome 20 part, days20 parts of Southern Stars, 20 parts of Cynanchum glaucescens, 15 parts of arisaema cum bile, 20 parts of globe amaranths, 20 parts of asters, 20 parts of lepidium seeds, 20 parts of the root barks of white mulberry, glossy ganoderma 20Part, 20 parts of ardisia japonicas, 15 parts of the tubers of dwarf lilyturf, 20 parts of lilies, 20 parts of radix glehniaes, 20 parts, the fruit of Chinese magnoliavine, 20 parts of pig a kind of reed mentioned in ancient books, Fu join 20 parts, tabasheer20 parts, 20 parts of stiff silkworms, 20 parts of stone solutions, 20 parts, almond, 20 parts of Mangnolia officinalis, 20 parts of Momordica grosvenoris, 20 parts of earthworms, 20 parts of Herba Hedyotidis Diffusaes,20 parts of 20 parts of ajuga decumbens, 20 parts of pyrrosia linguas, 20 parts of folium isatidis and the Radixs Astragali.

3. a preparation method for the fermentative microorganism Chinese medicine preparation of tracheopathy described in claim 1, is characterized in that:

(1) count by weight Bulbus Fritillariae Cirrhosae 20-50 part, tussilago 20-50 part, Radix Glycyrrhizae 20-50 part, root of Chinese trichosanthes 20-50 part, HuangA kind of reed mentioned in ancient books 20-50 part, honeysuckle 20-50 part, subprostrate sophora 20-50 part, blackberry lily 20-50 part, tuber of pinellia 20-50 part, bighead atractylodes rhizome 20-50 part, balloonflower root20-50 part, Snakegourd Fruit 20-50 part, tuber of stemona 20-50 part, wind-weed 20-50 part, reed rhizome 20-50 part, rhizoma arisaematis 20-50 part, Cynanchum glaucescens 20-50 parts, arisaema cum bile 15-45 part, globe amaranth 20-50 part, aster 20-50 part, lepidium seed 20-50 part, root bark of white mulberry 20-50 part, glossy ganoderma20-50 part, ardisia japonica 20-50 part, the tuber of dwarf lilyturf 15-45 part, lily 20-50 part, radix glehniae 20-50 part, fruit of Chinese magnoliavine 20-50 part, pigA kind of reed mentioned in ancient books 20-50 part, Fu ginseng 20-50 part, tabasheer 20-50 part, stiff silkworm 20-50 part, stone solution 20-50 part, almond 20-50 part, Mangnolia officinalis 20-50 parts, Momordica grosvenori 20-50 part, earthworm 20-50 part, Herba Hedyotidis Diffusae 20-50 part, ajuga decumbens 20-50 part, pyrrosia lingua 20-50The Chinese medicine material of part, folium isatidis 20-50 part and Radix Astragali 20-50 part mixes, stand-by;

Described picking up the ears (Pleurotussp.), has been deposited in " Chinese microorganism strain preservation management committee on April 14th, 2014Member's meeting common micro-organisms " center ", deposit number is CGMCCNo.9060.

4. by the preparation method of the fermentative microorganism Chinese medicine preparation of tracheopathy claimed in claim 3, it is characterized in that: described stepSuddenly (2) are inoculated in the amount of picking up the ears by mass percentage as 1-5% in Chinese medicine material, and at 35-65 DEG C of bottom fermentation 1-7 days.

5. by the preparation method of the fermentative microorganism Chinese medicine preparation of tracheopathy claimed in claim 3, it is characterized in that: describedFerment product can be made into powder, tablet, pill, capsule and pill, capsule, emulsion, syrup or oral liquid.

6. a medicine preparation claimed in claim 1 is as the medicine of preparing prevention or treatment respiratory disease and derivative disease thereofApplication in thing.

7. by the application of the fermentative microorganism Chinese medicine preparation of gas producing tube disease described in claim 6, it is characterized in that: described breathing isSystem disease and derivative disease thereof comprise that cough is panted, cold cough, acute and chronic bronchitis, asthma, pulmonary emphysema, pulmonary heart disease, lungCancer, cor pulmonale.