CN105567856A - Genotype detection method of fad2 gene of cabbage type rape - Google Patents
Genotype detection method of fad2 gene of cabbage type rape Download PDFInfo
- Publication number
- CN105567856A CN105567856A CN201610118411.XA CN201610118411A CN105567856A CN 105567856 A CN105567856 A CN 105567856A CN 201610118411 A CN201610118411 A CN 201610118411A CN 105567856 A CN105567856 A CN 105567856A
- Authority
- CN
- China
- Prior art keywords
- fad2
- fad2 gene
- gene
- nucleotide
- oleic acid
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6869—Methods for sequencing
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
- C12Q1/6895—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms for plants, fungi or algae
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Organic Chemistry (AREA)
- Engineering & Computer Science (AREA)
- Zoology (AREA)
- Analytical Chemistry (AREA)
- Wood Science & Technology (AREA)
- Health & Medical Sciences (AREA)
- Biotechnology (AREA)
- Microbiology (AREA)
- Molecular Biology (AREA)
- Immunology (AREA)
- Biophysics (AREA)
- Physics & Mathematics (AREA)
- Biochemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Botany (AREA)
- Mycology (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention provides a classification method, which can be used for quickly and conveniently classifying a genotype of a fad2 gene of cabbage type rape with oleic acid content which is more than 30 percent, and particularly discloses a method for classifying the genotype of the fad2 gene of the cabbage type rape by judging whether basic groups of nucleotides from a forty-first position to a fiftieth position of the fad2 gene of the cabbage type rape are AAAAGTCTGA or not and whether basic groups of nucleotides from a two hundred and thirty-first position to a two hundred and forty-fifth position are TCCCTCACCCTCTCT or not.
Description
Technical field
The present invention relates to oil crops field, be specifically related to a kind of measuring method checking and judge the fad2 gene of swede type rape to belong to fad2-I type or fad2-II type.
Background technology
Swede type rape is the important kind in three large rapeseed germplasms, also be the oil crops of a south China cultivated area quasi-representative widely, its lipid acid composition is divided into saturated fatty acid and unsaturated fatty acids, unsaturated fatty acids is to the health of human body, and the reparation after the degeneration-resistant and damage of plant all has vital role.Fad2 genes encoding oleic acid dehydrogenase, it is the key enzyme that plant produces polyunsaturated fatty acids, is also the important enzyme regulating and controlling oleic acid content in swede type rape.At present in double-low rapeseed kind, oleic acid is main fatty acid, and content is the highest, is secondly linoleic acid plus linolenic acid.Usually through the oleic acid content suppressing the expression of Fad2 gene to improve rape
Existing research emphasis is often by the means such as conventional breeding and molecular breeding, improve the oleic acid content in rape, and the sequence characteristic of corresponding regulatory gene is seldom studied, the sequence characteristic of research gene, certain basis established by the material that the downstream work carrying out targetedly being correlated with may produce more high-quality in the future.
Prior art is by design primer, and then the encoding sequence obtaining fad2 gene with pcr amplification utilizes DNAMAN6.0 software, analyzes the sequence characteristic of fad2 gene order, finds out the sequence difference increasing out with different templates; By sequence difference, the oleic acid content of preliminary clear and definite rape, for improving the correlative study of rape oleic acid in the future further.In order to find the difference of differing materials in gene order, needing to carry out gene amplification and examining order with different templates respectively, working more loaded down with trivial details.
The rape of current cultivation high gas oil ratio content, often through hybridization or the method for mutagenesis, time required for hybridization is long, that breaks between gene is unfavorable chain sometimes very difficult, mutagenesis is to the selection of mutagenic compound, treatment time and the factors such as concentration and number of processes all need constantly experiment finally to determine, therefore often can not get desirable result, even if it is consuming time oversize to obtain desirable result; The present invention is by cloning fad2 gene, checking order and gene comparision, realize fast typing, it is the key constraints (complete functional protein of encoding) affecting the raising of rape oleic acid for fad2-I, later stage can adopt and build the method such as RNAi carrier or co-suppression, and the content of rape oleic acid is improved rapidly within a short period of time
Existing research emphasis cultivates kind often by the means such as conventional breeding and molecular breeding, measure the oleic acid content in rape, as the direct basis whether certain material is high-oleic acid material, and the sequence characteristic of corresponding regulatory gene is seldom studied, the sequence characteristic of research gene, the downstream that screening material carries out being correlated with targetedly works, and can establish important basis to selecting, cultivating the high-oleic acid material of more high-quality.
Summary of the invention
The invention provides a kind of measuring method of the swede type rape containing high gas oil ratio, containing following steps:
The 41st base to 50 Nucleotide measuring the fad2 gene of oleic acid is AAAAGTCTGA, and the 231st base to 245 Nucleotide is TCCCTCACCCTCTCT, then the fad2 gene of described swede type rape belongs to fad2-I type;
Or the 41st base to 50 Nucleotide of the fad2 gene measuring oleic acid is GCTCCCCCGG, the 231st base deletion to 245 Nucleotide, then the fad2 gene of described swede type rape belongs to fad2-II type;
Further, described measuring method comprises following steps:
(1) the fad2 gene of swede type rape is extracted;
(2) pcr amplification is carried out to the fad2 gene that step (1) obtains;
(3) to the amplified production order-checking that step (2) prepares, the base sequence of the Nucleotide of described fad2 gene is obtained;
(4) the 41st base to 50 Nucleotide measuring the fad2 gene of oleic acid is AAAAGTCTGA, and the 231st base to 245 Nucleotide is TCCCTCACCCTCTCT, and the fad2 genes encoding of this oleic acid obtains continuous albumen; Then the fad2 gene of described swede type rape belongs to fad2-I type;
Or the 41st base to 50 Nucleotide of the fad2 gene measuring oleic acid is GCTCCCCCGG, 231st base deletion to 245 Nucleotide, the fad2 genes encoding of this oleic acid obtains discontinuous albumen, then the fad2 gene of described swede type rape belongs to fad2-II type;
Further, described measuring method is made up of following steps:
PCR reaction system:
Genomic dna or cDNA2 μ L, the each 0.5 μ L of upstream and downstream primer, 10mMdNTPS0.8 μ L, ESTaqDNAPolymerase (5U/ μ L) 0.8 μ L, 10 × PolymeraseBuffer3 μ L, sterilized water volume complements to 30 μ L (this gene does not have intron, does the gene order difference that template amplification obtains very little with genomic dna or Cdna)
Response procedures: 94 DEG C of 4min, 94 DEG C of 40sec, 60 DEG C of 40sec, 72 DEG C of 100secfor35cycles, 72 DEG C of 7min.
The primer sequence of pcr amplification:
Bnfad2-F:ATGGGTGCAGGTGGAAGAATGCAAG
Bnfad2-R:TCATAACTTATTGTTGTACCAGAACACACC
The method of gene comparision:
Sequence alignment utilizes DNAMAN6.0 software, version 6.0.3.99, choice menus sequence (S), Multiple Sequence Alignment (M) is selected below comparison (A), " file " button is clicked in the window " sequence and file " ejected, select suitable sequential file, foundation sequence is nucleotide sequence or protein sequence, select DNA or protein, select next step, in " mode " window, if comparison dna sequence, make hook " attempt use double-strand " is front, click next step, if compare protein sequence, this step can be omitted, next step is clicked in " Multiple Sequence Alignment " window, all the other parameters set according to system default value, " completing " button is clicked in " multiple ratio to " window, the result interface of " Multiple Sequence Alignment " can be entered
Present invention also offers described measuring method checking and judging that the fad2 gene of swede type rape belongs to the purposes of FAD2-I type or FAD2-II type.
In addition, present invention also offers a kind of PCR method detecting swede type rape fad2 gene type, comprising:
(1) genomic dna or the cDNA2 μ L of the fad2 gene of swede type rape is got, each 0.5 μ L, the 10mMdNTPS0.8 μ L of upstream and downstream primer, the ESTaqDNAPolymerase0.8 μ L of 5U/ μ L, 10 × PolymeraseBuffer3 μ L, sterilized water volume complements to 30 μ L, for subsequent use;
(2) mixture step (1) prepared keeps 4 minutes in 94 DEG C, and 94 DEG C keep 40 seconds, and 60 DEG C keep 40 seconds, and 72 DEG C keep 100 seconds, carry out 35 circulations, then keep 7 minutes in 72 DEG C.
The primer sequence of pcr amplification:
Bnfad2-F:ATGGGTGCAGGTGGAAGAATGCAAG
Bnfad2-R:TCATAACTTATTGTTGTACCAGAACACACC
(3) check order; The 41st base to 50 Nucleotide measuring the fad2 gene of oleic acid is AAAAGTCTGA, and the 231st base to 245 Nucleotide is TCCCTCACCCTCTCT, then the fad2 gene of described swede type rape belongs to fad2-I type;
Or the 41st base to 50 Nucleotide of the fad2 gene measuring oleic acid is GCTCCCCCGG, the 231st base deletion to 245 Nucleotide, then the fad2 gene of described swede type rape belongs to fad2-II type.
The technical term that the present invention is used:
Genotype: the nucleotide sequence due to swede type rape fad2 gene exists the different distinguished sequence of two classes, and the distinguished sequence that this two class is different is called as different genotype.
Double-low rapeseed: the rape simultaneously with low erucic acid and low glucosinolate characteristic
PCR: polymerase chain reaction, a kind of at specific primer, under polysaccharase and four kinds of Nucleotide participate in, through steps such as denaturation, sex change, annealing, extensions, reach the technology of rapid amplifying specific DNA fragment
Premature termination: Nucleotide is generally translate into protein from initiator codon ATG, until terminator codon (TGA, TAA, TAG) translation stops immediately, if in the terminator codon of normal sequence except end, middle appearance one or several terminator codons, then stop translation, the protein sequence obtained is imperfect
High-oleic acid material: through physics or chemomorphosis, or the rape material that the oleic acid content of self-assembling formation is high, represent with G in oleic acid content general >60%, figure.Relation (the Zhou Yongming of extremely significant negative correlation is there is between the erucic acid of swede type rape and oleic acid, the heredity of several primary fat acid content in swede type rape seed, [J] Acta Agronomica Sinica, 1987), therefore canola can be considered to high gas oil ratio rape.According to the industry standard that The Ministry of Agriculture of the People's Republic of China, MOA 2000 publicizes and implements---the regulation of Canola Oil NY416-2000, the content of canola oleic acid is between 50%-66%, according to another the regulation of rapeseed oil GB1536-2004, the oleic acid content of Canola Oil is between 51%-70%, in conjunction with the regulation of above-mentioned document and national standard, the oleic acid content >60% of the high gas oil ratio rape that the present invention relates to, can be considered to high gas oil ratio rape.High-oleic acid material is herein the seed of swede type rape maintenance line 100B, through Flight Mutagenesis+iterating sodium complex mutation, and the offspring of oleic acid proterties genetic stability after too much generation plantation.Oleic acid content 62.60%
The control material of high-oleic acid material: the starting materials not doing any process, represents with CK in figure.The control material of high-oleic acid material of the present invention is without any process, grows under the state of nature of field, the seed of the swede type rape maintenance line 100B of results, oleic acid content 56.57%.
The control material of high-oleic acid material and high-oleic acid material, because oleic acid content is all more than 30%, therefore is referred to as the rape material of oleic acid content >30%.
Beneficial effect of the present invention:
(1) by genotypic comparison and the analysis of fad2 gene, the oleic acid content of rape can be determined tentatively rapidly.
Rape due to fad2 gene pairs swede type rape has the effect of negative regulation, and the gene copy of coding intact proteins is most important to oleic acid content.Therefore the copy number of fad2-I more (complete continuous albumen of encoding), oleic acid content is lower; Fad2-II is due to discontinuous albumen of encoding, and therefore the copy number of fad2-II is more, and oleic acid content is higher
(2) in conjunction with the genotypic quick differentiation of fad2 gene, can find rapidly and can go out the genotype of albumen by complete translation, thus follow-up related work can be carried out fast ".
By discovery of checking order in a large number, the 41st base to 50 Nucleotide measuring the fad2 gene of oleic acid is AAAAGTCTGA, and the 231st base to 245 Nucleotide is TCCCTCACCCTCTCT, can be judged as rapidly fad2-I type; The 41st base to 50 Nucleotide measuring the fad2 gene of oleic acid is GCTCCCCCGG, and the 231st base to 245 Nucleotide must be just disappearance, can be judged as rapidly fad2-II type
The rape of current cultivation high gas oil ratio content, often through hybridization or the method for mutagenesis, time required for hybridization is long, that breaks between gene is unfavorable chain sometimes very difficult, mutagenesis is to the selection of mutagenic compound, treatment time and the factors such as concentration and number of processes all need constantly experiment finally to determine, therefore often can not get desirable result, even if it is consuming time oversize to obtain desirable result; The present invention is directed to the fast typing of fad2 gene, is the key constraints (complete functional protein of encoding) affecting the raising of rape oleic acid for fad2-I.Later stage can adopt and build the method such as RNAi carrier or co-suppression, and the content of rape oleic acid is improved rapidly within a short period of time.
Obviously, according to foregoing of the present invention, according to ordinary technical knowledge and the customary means of this area, under the prerequisite not departing from the above-mentioned basic fundamental thought of the present invention, the amendment of other various ways, replacement or change can also be made.
Below with the specific implementation method of embodiment form, foregoing of the present invention is being described in further detail, but is should not be construed as following embodiment for limiting protection scope of the present invention.It is below embodiment.
Accompanying drawing explanation
The comparison result figure of the fad2 gene in Fig. 1 a, Fig. 1 b, Fig. 1 c high-oleic acid material and the fad2 gene order of the genebank number of logging in AY57731; See embodiment one they (4), the choning and sequencing of gene.
The comparison result figure of the fad2 gene of the control material of Fig. 2 a, Fig. 2 b high-oleic acid material and the fad2 gene order of the genebank number of logging in AY57731; See embodiment one they (4), the choning and sequencing of gene.
The comparison result figure of the protein sequence that the fad2 gene of the fad2 gene in Fig. 3 high-oleic acid material and the genebank number of logging in AY57731 is translated respectively.
The comparison result figure of the protein sequence that the fad2 gene of the fad2 gene in the control material of Fig. 4 high-oleic acid material and the genebank number of logging in AY57731 is translated respectively.
It is below embodiment
Embodiment one
(1) seed of swede type rape maintenance line 100B is got, through Flight Mutagenesis+iterating sodium complex mutation, the offspring of oleic acid proterties genetic stability after too much generation plantation, i.e. the clone 18,29,31,43,49 of high-oleic acid material fad2 gene of the present invention, oleic acid content 62.60%; Also the rape material of the high gas oil ratio content of self-assembling formation can be used carry out this experiment.The general >60% of high gas oil ratio content, represents with G.
Get without any process, grow under the state of nature of field, the seed of the swede type rape maintenance line 100B of results, be i.e. the clone 6,13,19,53,55 of the control material fad2 gene of high-oleic acid material of the present invention, oleic acid content 56.57%; Control material CK represents.
(2) according to Peng Qi 2011 Nian doctor Diplomarbeit (Peng Qi, the clone of relative new gene is formed with swede type rape fatty acid component, 2011, Ph.D. Dissertation, Agricultural University Of Hunan, grid database/CNKI knows in China) in about fad2 gene describe, the sequence numbering having disclosed this gene in Genbank is: the genebank number of logging in AY57731, the encoding sequence of this gene is found in ncbi database, design primer by DNAMAN6.0, primer sequence is as shown in the nucleotide sequence of sequence table SEQ IDNO.1 and SEQIDNO.2.
(3) the complete encoding sequence of this gene is obtained by pcr amplification.PCR response procedures is: 94 degree 4 minutes, 94 degree 40 seconds, 60 degree 40 seconds, 72 degree 100 seconds, 35 circulations, 72 degree of insulations 7 minutes.
(4) Cloning and sequencing of the gene carried out;
The sequence of the clone 18,29,31,43,49 of high-oleic acid material fad2 gene is as shown in the nucleotide sequence of sequence table SEQ IDNO.3, SEQIDNO.4, SEQIDNO.5, SEQIDNO.6, SEQIDNO.7; Shown in sequence comparison's schematic diagram is shown in that Figure of description 1a, Fig. 1 b, Fig. 1 c jointly.
The albumen of the clone 18 sequence translation of high-oleic acid material fad2 gene ruptures, stops in advance, includes cleave proteins sequence SEQIDNO.8, SEQIDNO.24, SEQIDNO.25, SEQIDNO.26, SEQIDNO.27, SEQIDNO.28, SEQIDNO.29, SEQIDNO.30 totally eight protein/polypeptide fragments;
The albumen of the clone 29 sequence translation of high-oleic acid material fad2 gene ruptures, stops in advance, includes SEQIDNO.9, SEQIDNO.31, SEQIDNO.32, SEQIDNO.33, SEQIDNO.34, SEQIDNO.35, SEQIDNO.36, SEQIDNO.37 totally eight protein/polypeptide fragments of cleave proteins sequence;
The aminoacid sequence of the albumen of the clone 31 sequence translation of high-oleic acid material fad2 gene is complete, and its aminoacid sequence is as shown in the aminoacid sequence of sequence SEQIDNO.10;
The aminoacid sequence of the albumen of the clone 43 sequence translation of high-oleic acid material fad2 gene is complete, and its aminoacid sequence is as shown in the aminoacid sequence of sequence SEQIDNO.11;
The albumen of the clone 49 sequence translation of high-oleic acid material fad2 gene ruptures, stops in advance, includes cleave proteins sequence SEQIDNO.12, SEQIDNO.38 totally two protein/polypeptide fragments; Sequence comparison's schematic diagram is shown in shown in Figure of description 3.
The sequence of the clone 6,13,19,53,55 of the control material fad2 gene of high-oleic acid material, respectively as shown in the nucleotide sequence of sequence table SEQ IDNO.13, SEQIDNO.14, SEQIDNO.15, SEQIDNO.16, SEQIDNO.17; Sequence comparison's schematic diagram is shown in shown in Figure of description 2a, Fig. 2 b.
The albumen of the clone 6 sequence translation of the control material fad2 gene of high-oleic acid material ruptures, stops in advance, includes cleave proteins sequence SEQIDNO.18, SEQIDNO.39 totally two protein/polypeptide fragments;
The albumen of the clone 13 sequence translation of the control material fad2 gene of high-oleic acid material ruptures, stops in advance, includes cleave proteins sequence SEQIDNO.19, SEQIDNO.40, SEQIDNO.41, SEQIDNO.42, SEQIDNO.43, SEQIDNO.44 totally six protein/polypeptide fragments;
The aminoacid sequence of the albumen of the clone 19 sequence translation of the control material fad2 gene of high-oleic acid material is complete, and its aminoacid sequence is as shown in the aminoacid sequence of sequence SEQIDNO.20;
The aminoacid sequence of the albumen of the clone 53 sequence translation of the control material fad2 gene of high-oleic acid material is complete, and its aminoacid sequence is as shown in the aminoacid sequence of sequence SEQIDNO.21;
The aminoacid sequence of the albumen of the clone 55 sequence translation of the control material fad2 gene of high-oleic acid material is complete, and its aminoacid sequence is as shown in the aminoacid sequence of sequence SEQIDNO.22; Amino acid sequences alignment's result schematic diagram is shown in shown in Figure of description 4.
Fad2 gene (the genebank number of logging in AY57731) translates the aminoacid sequence of albumen as shown in sequence table SEQ IDNO.23.
(5) function utilizing the multiple sequence in DNAMAN6.0 software to compare carries out the comparison of gene order, finds the feature of sequence difference between different genotype, and precognition can the genotype of complete coding in advance.
Experimental result
Can find out from Fig. 1 (Fig. 1 a, Fig. 1 b, Fig. 1 c) and Fig. 2 (Fig. 2 a, Fig. 2 b), fad2 gene in the control material of high-oleic acid material and high-oleic acid material can be divided into two classes: the first kind from the 41st to the base of 50 Nucleotide be AAAAGTCTGA, it is TCCCTCACCCTCTCT the 231st base to 245 Nucleotide, Equations of The Second Kind is from being GCTCCCCCGG from the 41st to the base of 50 Nucleotide, and it is the 231st base deletion to 245 Nucleotide.As can be seen from Fig. 3 and Fig. 4, first kind fad2 genotype only in high-oleic acid material material can translate complete albumen, and the Equations of The Second Kind fad2 gene in the control material of high-oleic acid material and high-oleic acid material exists premature termination phenomenon in various degree in the process of translation albumen.
Use the method for this area routine to proceed to goal gene to express target protein, and carry out plant oleic acid content verification method just, concrete grammar can with reference to following steps:
(1) RNAi expression vector of this area routine is chosen, transformation Agrobacterium GV3101, carries out PCR checking with the primers of hygromycin gene, ensures that plasmid successfully proceeds to Agrobacterium, Agrobacterium mono-clonal adds qs glycerin, and-80 DEG C of Refrigerator stores are for subsequent use.
(2) bacterial classification got containing destination carrier is having setting-out cultivation on corresponding antibiotic LB flat board, the condition of 28 DEG C
Lower cultivation 24-36h, activated spawn;
(3) inoculate Agrobacterium mono-clonal in corresponding antibiotic LB liquid nutrient medium, under the condition of 28 DEG C, 200r/min shaking culture to OD value is about 1-3;
(4) the centrifugal 10min of 4000r/min, collects in thalline to suspension and mixes.Suspension proportioning: Ms substratum+sucrose (15%me, m)+6BA (0.01mg/m1)+silwet-77 (0.05%)
(5) initial bloom stage of well-grown swede type rape in its natural state, first gets rid of the flower opened, and retains bud;
(6) brassica napus inflorescence is inverted, bud is immersed in suspension down, stop 10s;
(7) take out the bud in suspension, carry out bagging;
(8) prepare new suspension, carry out second time after 48h and contaminate, carry out the 3rd time again after the 48h after second time dip-dye and contaminate, after bagging to white knot pod, take off paper bag.Time ripe, results seed, obtains and transforms T1 generation.
(9) T1 is for seed in carrying out resistance screening containing on corresponding antibiotic MS substratum, and leaf look turns green, root elongation be considered as transfer-gen plant;
(10), after plant to be planted grows 3-4 sheet true leaf, extract the DNA of true leaf, carry out PCR with the primers of hygromycin gene and again verify the verity guaranteeing transfer-gen plant;
(11) be accredited as real transfer-gen plant and be transplanted to land for growing field crops self-sow, period to be suitable for, get related tissue and extract RNA, the fluorescence quantitative PCR detection of FAD2 gene is carried out in reverse transcription, and whether the fragment that inspection builds can make the down-regulated expression of this gene,
(12) seed of maturation is carried out to the mensuration of lipid acid composition, detect the change of oleic acid content.
Claims (6)
1. a measuring method for the swede type rape containing high gas oil ratio, containing following steps:
The 41st base to 50 Nucleotide measuring the fad2 gene of oleic acid is AAAAGTCTGA, and the 231st base to 245 Nucleotide is TCCCTCACCCTCTCT, then the fad2 gene of described swede type rape belongs to fad2-I type;
Or the 41st base to 50 Nucleotide of the fad2 gene measuring oleic acid is GCTCCCCCGG, the 231st base deletion to 245 Nucleotide, then the fad2 gene of described swede type rape belongs to fad2-II type.
2. measuring method according to claim 1, is characterized in that comprising following steps:
(1) the fad2 gene of swede type rape is extracted;
(2) pcr amplification is carried out to the fad2 gene that step (1) obtains;
(3) to the amplified production order-checking that step (2) prepares, the base sequence of the Nucleotide of described fad2 gene is obtained;
(4) the 41st base to 50 Nucleotide measuring the fad2 gene of oleic acid is AAAAGTCTGA, and the 231st base to 245 Nucleotide is TCCCTCACCCTCTCT, and the fad2 gene of described swede type rape belongs to fad2-I type;
Or the 41st base to 50 Nucleotide of the fad2 gene measuring oleic acid is GCTCCCCCGG, the 231st base deletion to 245 Nucleotide, then the fad2 gene of described swede type rape belongs to fad2-II type.
3. measuring method according to claim 2, is characterized in that, the fad2 genes encoding measuring oleic acid goes out continuous albumen, then the fad2 gene of described swede type rape belongs to fad2-I type;
Or the fad2 genes encoding measuring oleic acid goes out discontinuous albumen, then the fad2 gene of described swede type rape belongs to fad2-II type.
4. the pcr amplification of fad2 gene according to claim 2, comprises the following steps composition:
(1) genomic dna or the cDNA2 μ L of the fad2 gene of swede type rape is got, each 0.5 μ L, the 10mMdNTPS0.8 μ L of upstream and downstream primer, the ESTaqDNAPolymerase0.8 μ L of 5U/ μ L, 10 × PolymeraseBuffer3 μ L, sterilized water volume complements to 30 μ L, for subsequent use;
(2) mixture step (1) prepared keeps 4 minutes in 94 DEG C, and 94 DEG C keep 40 seconds, and 60 DEG C keep 40 seconds, and 72 DEG C keep 100 seconds, carry out 35 circulations, then keep 7 minutes in 72 DEG C.
The primer sequence of pcr amplification: Bnfad2-F:ATGGGTGCAGGTGGAAGAATGCAAG;
Bnfad2-R:TCATAACTTATTGTTGTACCAGAACACACC。
5. the measuring method described in any one of claim 1-4 is in inspection and judge whether swede type rape belongs to the purposes of high gas oil ratio rape.
6. detect a genotypic PCR method for swede type rape fad2 gene, comprising:
(1) genomic dna or the cDNA2 μ L of the fad2 gene of swede type rape is got, each 0.5 μ L, the 10mMdNTPS0.8 μ L of upstream and downstream primer, the ESTaqDNAPolymerase0.8 μ L of 5U/ μ L, 10 × PolymeraseBuffer3 μ L, sterilized water volume complements to 30 μ L, for subsequent use;
(2) mixture step (1) prepared keeps 4 minutes in 94 DEG C, and 94 DEG C keep 40 seconds, and 60 DEG C keep 40 seconds, and 72 DEG C keep 100 seconds, carry out 35 circulations, then keep 7 minutes in 72 DEG C;
The primer sequence of pcr amplification:
Bnfad2-F:ATGGGTGCAGGTGGAAGAATGCAAG,
Bnfad2-R:TCATAACTTATTGTTGTACCAGAACACACC;
(3) check order; The 41st base to 50 Nucleotide measuring the fad2 gene of oleic acid is AAAAGTCTGA, and the 231st base to 245 Nucleotide is TCCCTCACCCTCTCT, then the fad2 gene of described swede type rape belongs to fad2-I type;
Or the 41st base to 50 Nucleotide of the fad2 gene measuring oleic acid is GCTCCCCCGG, the 231st base deletion to 245 Nucleotide, then the fad2 gene of described swede type rape belongs to fad2-II type.
Priority Applications (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
CN201610118411.XA CN105567856B (en) | 2016-03-02 | 2016-03-02 | A kind of genotype detection method of the fad2 genes of cabbage type rape |
Applications Claiming Priority (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
CN201610118411.XA CN105567856B (en) | 2016-03-02 | 2016-03-02 | A kind of genotype detection method of the fad2 genes of cabbage type rape |
Publications (2)
Publication Number | Publication Date |
---|---|
CN105567856A true CN105567856A (en) | 2016-05-11 |
CN105567856B CN105567856B (en) | 2018-11-13 |
Family
ID=55878472
Family Applications (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
CN201610118411.XA Expired - Fee Related CN105567856B (en) | 2016-03-02 | 2016-03-02 | A kind of genotype detection method of the fad2 genes of cabbage type rape |
Country Status (1)
Country | Link |
---|---|
CN (1) | CN105567856B (en) |
Families Citing this family (1)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
CN110760608B (en) * | 2019-12-02 | 2020-07-14 | 浙江省农业科学院 | Rape BnFAD2 gene high oleic acid allelic mutation and development and application of SNP marker primer thereof |
Citations (2)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
CN101550414A (en) * | 2008-12-31 | 2009-10-07 | 刘春林 | Method for obtaining cole with high oleic acid and low erucic acid by dual-approach gene expression synchronous suppression |
CN101824472A (en) * | 2009-12-28 | 2010-09-08 | 华中农业大学 | Cabbage type rape high oleic acid molecular marker, preparation method and application thereof |
-
2016
- 2016-03-02 CN CN201610118411.XA patent/CN105567856B/en not_active Expired - Fee Related
Patent Citations (2)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
CN101550414A (en) * | 2008-12-31 | 2009-10-07 | 刘春林 | Method for obtaining cole with high oleic acid and low erucic acid by dual-approach gene expression synchronous suppression |
CN101824472A (en) * | 2009-12-28 | 2010-09-08 | 华中农业大学 | Cabbage type rape high oleic acid molecular marker, preparation method and application thereof |
Non-Patent Citations (4)
Title |
---|
JIN HEE JUNG ET AL.: "Identification of functional BrFAD2-1 gene encoding microsomal delta-12 fatty acid desaturase from Brassica rapa and development of Brassica napus containing high oleic acid contents", 《PLANT CELL REP》 * |
肖钢等: "六个甘蓝型油菜油酸脱氢酶(FAD2)假基因的克隆和分析", 《作物学报》 * |
肖钢等: "甘蓝型油菜油酸脱氢酶基因(fad2)多个拷贝的发现及分析", 《作物学报》 * |
陈光尧等: "不同芥酸含量油菜品系FAD2基因克隆测序分析", 《生物学杂志》 * |
Also Published As
Publication number | Publication date |
---|---|
CN105567856B (en) | 2018-11-13 |
Similar Documents
Publication | Publication Date | Title |
---|---|---|
CN105543270A (en) | Double resistance CRISPR/Cas9 carrier and application | |
CN106164272A (en) | The plant modified | |
CN112961231B (en) | Male sterile gene ZmbHLH122 and application thereof in creating maize male sterile line | |
CN103695438B (en) | Arabidopsis MYB family transcription factor AtMYB17 gene, coded sequence and application thereof | |
CN110903368B (en) | Gene for controlling female character of corn, kit for creating female sterile line of corn, mutant genotype and method | |
CN105695477A (en) | Male sterile mutant oss125 and use thereof | |
CN101413006B (en) | Drought-induced rice flower specific promoter and use thereof | |
CN105567856A (en) | Genotype detection method of fad2 gene of cabbage type rape | |
CN109456396A (en) | A kind of protein, molecular labeling and the application of Senescence of Rice and fringe type controlling gene HK73 and its coding | |
CN101955938A (en) | DNA fragment for inhibiting expression of omega secaline gene in wheat 1B/1R translocation line and application thereof | |
CN108866075A (en) | Influence variable sheer and application that tomato fruit color forms controlling gene YFT2 | |
CN109161551A (en) | Wild cabbage BoMS1 gene and its application in initiative sterile material | |
CN102153637B (en) | Wild soybean LEAFY transcription factor and coding gene and application of wild soybean LEAFY transcription factor | |
CN108409844A (en) | Applications of the protein TaNRT2.5 in regulating and controlling plant products | |
CN107779456A (en) | M. truncatula MtWOX11 genes and its application in seed fatty acid content is improved | |
CN110407922B (en) | Rice cold-resistant gene qSCT11 and application thereof | |
CN102321644A (en) | Control gene of rice panicle pedicel length and application thereof | |
CN105695479A (en) | Symmetry gene CmCYC2c of chrysanthemum morifolium and application of symmetry gene CmCYC2c | |
CN106397562B (en) | Application of the protein G mGATA44 in regulation plant grain weight | |
CN102115751A (en) | Rape BnPABP 5 gene and application of promoter thereof | |
CN104513825A (en) | Wheat salt-tolerant gene TaNAS1 and application thereof | |
CN103243114B (en) | Fusion gene, protein expressed by same and application thereof | |
CN105177008B (en) | II type H of corn+The deletion mutant of pyrophosphatase gene promoter and its application | |
CN117210490B (en) | PCHR gene for regulating and controlling malus plant self-flower fructification and application thereof | |
CN103981196B (en) | PFP gene is controlling the application in rice seedling thermotolerance |
Legal Events
Date | Code | Title | Description |
---|---|---|---|
C06 | Publication | ||
PB01 | Publication | ||
C10 | Entry into substantive examination | ||
SE01 | Entry into force of request for substantive examination | ||
GR01 | Patent grant | ||
GR01 | Patent grant | ||
CF01 | Termination of patent right due to non-payment of annual fee | ||
CF01 | Termination of patent right due to non-payment of annual fee |
Granted publication date: 20181113 Termination date: 20190302 |