CN101550414A - Method for obtaining cole with high oleic acid and low erucic acid by dual-approach gene expression synchronous suppression - Google Patents
Method for obtaining cole with high oleic acid and low erucic acid by dual-approach gene expression synchronous suppression Download PDFInfo
- Publication number
- CN101550414A CN101550414A CNA2008101868675A CN200810186867A CN101550414A CN 101550414 A CN101550414 A CN 101550414A CN A2008101868675 A CNA2008101868675 A CN A2008101868675A CN 200810186867 A CN200810186867 A CN 200810186867A CN 101550414 A CN101550414 A CN 101550414A
- Authority
- CN
- China
- Prior art keywords
- interference
- approach
- oleic acid
- fragment
- gene
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Images
Landscapes
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
- Breeding Of Plants And Reproduction By Means Of Culturing (AREA)
Abstract
The invention belongs to the field of biotechnology and discloses a method which utilizes the improved RNA interference technology and the genetic engineering measure to carry out interference silence simultaneously to the gene expression of two metabolic pathways (1) and (2) in which the oleic acid is converted into other fatty acid, prevents the oleic acid from being converted into the fatty acids of other types to the most extent and achieves the object of greatly improving the content of the oleic acid and greatly reducing the content of the erucic acid. The embodiment connects the interference fragment of the FAD2 gene on the desaturation pathway (1) and the interference fragment of the FAE1 gene on the chain extension pathway (2) into a syncretized interference fragment and establishes the corresponding interference carrier according to the syncretized interference fragment. By the mediation of agrobacterium LAB4404, the brassica napus is converted, thus obtaining the brassica napus strains which can inherit stably, wherein the oleic acid content of the brassica napus strain is more than 80% and the erucic acid content thereof can not be detected.
Description
Technical field
The present invention relates to utilize the RNA perturbation technique to suppress genetic expression on oleic acid chain extension and two approach of desaturation simultaneously, stop oleic acid further to be metabolized to the lipid acid of other type through these two approach, and then make the oleic acid content in the interior fatty acid component of Semen Brassicae campestris increase considerably the method that descends significantly with content of erucic acid, belong to biological technical field.
Background technology
Oleic acid is a kind of monounsaturated fatty acids (18:1
Δ 9), stability is high, is difficult for smoldering during as high temperature; Can reduce total cholesterol and blood fat in the human body, reduce deleterious low density lipoprotein cholesterol (LDC), keep the level of useful high density lipoprotein cholesterol (HDL) simultaneously.And linolenic acid also reduces the level of useful high density lipoprotein cholesterol when reducing deleterious low density lipoprotein cholesterol.So, think at present that saturated fatty acid is lower than 3%, oleic acid content is greater than 80%, the polyunsaturated fatty acid total amount is that about 8% oil is healthy edible oil.In today of energy dilemma, oleic acid is 18 carbochains, and is suitable with the diesel oil carbon chain lengths, is the ideal source of biofuel.Compare other lipid acid, because oleic acid has these advantages, oleic acid content has become the important research content that current rapeseed quality is improved in the rape oil so improve.Simultaneously, because erucic acid (22:1
Δ 13) can cause animal such as mouse to suffer from myocardium lipidosis, myocardial necrosis and fibrosis take place; And content of erucic acid descends and can increase considerably useful oleic acid content in the Semen Brassicae campestris, therefore, in the national rape variety authorization process, must be low erucic acid or zero erucic acid to one of basic demand of new variety.
Utilize rape material (Becker etc., TheorAppl Genet, 2000, the 101:897-901 of traditional too high oleic acid content of genetic breeding technology seed selection; Plant Breeding, 2001,120:63-66; Crop Science 2001.41:1444-1449), utilizes chemistry or radioinduction also to obtain too high oleic acid mutant strain (Auld etc., Crop Science, 1992,32:657-662; Jiang Ming etc., southwestern agriculture journal, 2003,16 (2): 34-36; Official's spring cloud etc., Acta Agronomica Sinica, 2006,32 (11): 1625-1629), but because swede type rape is an allotrtraploid, heredity separates and the gene regulating complexity, and high-oleic acid material is degenerated easily, so far do not obtain the high-oleic acid material of genetic stability, so can't in rapeseed breeding, be used effectively.Reducing aspect the erucic acid breeding, the effort of the numerous rapeseed breeding men by the seventies and the eighties has obtained a collection of low erucic acid rape material and the kind that has breeding to be worth, and makes that content of erucic acid descends significantly in the rape oil.But in actual production, also not obtaining simultaneously not only is high oleic acid (greater than 80%) but also be the kind or the hybrid of low erucic acid (less than 3%).
Also obtain some high oleic acid rape materials by engineered method, as utilized Antisense RNA Technique (Shi Dongqiao etc., Journal of Agricultural Biotechnology, 2001,9 (4): 359-362; Xiong Xinghua etc., Agricultural University Of Hunan's journal: natural science edition, 2003,29 (3): suppress technology (Stoutjesd etc., Biochemical Society Transactions, 2,000 1882191.), altogether, 28:938-940), RNA perturbation technique (Stoutjesd etc., Plant Physiology, 2002,129 (4): 1723-1731; Chen Wei etc., Mol.Biol., 2006,32 (6): 665-671; Chen Song etc., Jiangsu agricultural journal, 2008,24:130-135), make endogenous oleic acid desaturase (FAD2) gene generation PTGS in the oil crop seeds by using, blocked the further desaturation of oleic acid and generated linolic acid, reach the purpose that improves oleic acid content with this.Utilizing RNA to disturb in soybean makes FAD2 gene generation post-transcriptional silencing improve the technology (number of patent application 200510016632.8) of oleic acid content in soybean and the peanut seed.But all do not obtain the high-oleic acid material of genetic stability by these genetic engineering means.This basic reason wherein is that the pathways metabolism that oleic acid is converted into other lipid acid has two: the desaturation approach 1. with chain extension approach 2. (Fig. 1), and existent method has only suppressed 1. this approach, and simultaneously will be 2. approach also block, the result is difficult to obtain the high-oleic acid material of genetic stability.In addition, we have reported structure FAD2 gene and FAE1 gene RNA interference carrier (Peng Qi in 2007, Liu Chunlin etc., the biotechnology circular, 2007,5:263-266), but do not report how to pass through genetic engineering means yet, utilize the RNA perturbation technique to suppress genetic expression on these two approach simultaneously, finally obtain high oleic acid and low erucic acid transgene rape material.Utilize genetic engineering means to reduce the research of content of erucic acid, also have only the report that suppresses FAE1 genetic expression interference carrier and make up (field antidimmer etc., the oil crops journal, 2007,2:27-31), and do not have further to obtain the report of transfer-gen plant research work.
Be converted into other lipid acid for effectively suppressing oleic acid, obtain stable high oleic acid low erucic acid gene engineering material, the application adopts high efficiency gene silencing methods-RNA perturbation technique and genetic engineering means, 1. two pathways metabolism desaturation approach that oleic acid are converted into other lipid acid disturb silence simultaneously with the genetic expression that 2. the chain extension approach goes up, stop oleic acid to be converted into the lipid acid of other type to greatest extent, when realizing increasing substantially oleic acid content, reduce content of erucic acid significantly.
Summary of the invention
The objective of the invention is to set up a kind of effective inhibition oleic acid and be converted into other lipid acid, and then obtain the high oleic acid of genetic stability and the method for low erucic acid transgene rape.
First goal of the invention of the present invention is achieved through the following technical solutions, and comprises the steps:
1. the seed-specific expression promotor is replaced the non-seed-specific expression promotor on the interference carrier
Select for use a kind of rna interference vector commonly used to be the basis, adopts the combination of identical double digestion, the promotor of expression cassette is replaced with the promotor of seed-specific expression, guarantee to disturb and in seed, carry out (Fig. 2).
1. and 2. on two pathways metabolisms the pcr amplification and the enzyme of katalaze enzyme gene fragment cut back to close
1. 2. choose any katalaze enzyme gene on two approach respectively as being suppressed object with the chain extension approach from the further metabolism of oleic acid for the desaturation approach of other lipid acid, and selected being suppressed is used for interferential nucleic acid fragment sequence on the expressing gene; Utilize Primer Premier5 software, respectively design a pair of corresponding specific PCR primer at these fragments, be forward (Forward) and reverse (Reverse) primer, and, make its 5 ' end add the recognition sequence of same restrictions restriction endonuclease each optional one of primer centering separately.Behind pcr amplification, all can have the recognition sequence (Fig. 3) of same restrictions restriction endonuclease from heterogeneic amplified fragments on 1. and 2. two approach.Pcr amplification product, promptly interference fragment utilizes glue to reclaim test kit and reclaims behind agarose gel electrophoresis.The interference fragment that reclaims is used identical digestion with restriction enzyme respectively.Enzyme is cut after product and is carried out agarose gel electrophoresis separation and the recovery of glue recovery test kit again.
3. reclaiming interference fragment connects and the clone
Reclaim respectively after enzyme cut, from heterogeneic, and have a DNA interference fragment balanced mix of identical sticky end, connect with the T4 ligase enzyme, obtain one have respectively from desaturation 1. with the 2. heterogeneic fusion interference fragment (Fig. 4) of two approach of chain extension.To merge interference fragment and be cloned on the T-carrier, and carry out sequencing and Blastn compare of analysis, determine that according to sequence information whether cloned sequence is from the target dna fragment of choosing on the gene.
4. two approach merge the structure of interference fragment interference carrier
Be inserted into the two ends of one section intron in the interference carrier expression cassette with merging interference fragment respectively with opposite direction, constitute two approach fusion interference fragment interference carriers (Fig. 5) of a band inverted repeats expression cassette structure.
5. two approach merge the interference fragment interference carrier and are transformed into intestinal bacteria and Agrobacterium
By heat shock or the electric method that swashs two approach are merged the interference fragment interference carriers and be transformed in the bacillus coli DH 5 alpha, choose mono-clonal, whether successful make up with PCR and digestion with restriction enzyme checking carrier from plate.From verify correct DH5 α bacterium colony, divide two approach from merging the interference fragment interference carrier; And then utilize and to freeze molten method interference carrier is transformed in the agrobacterium tumefaciens.The Agrobacterium that will have two approach fusion interference fragment interference carriers is used for the conversion of next step rape explant.
6. the acquisition of conversion of oil crops and transfer-gen plant
Utilize agrobacterium mediation method, with the explant of rape for being acceptor, by training altogether, the screening of resistance seedling, PCR detect, Southern detects and the expression analysis of target gene, finishing screen is selected real transfer-gen plant.
7. the mensuration of fatty acid component
Gather in the crops selfed seed from transfer-gen plant, carry out the mensuration of fatty acid component then.The unified approach that the mensuration of fatty acid component is measured according to the canola fatty acids component concentration gas-chromatography (GC) of country's promulgation is carried out, specifically referring to national standard " gas chromatographic analysis of animal-plant oil-fatty acid methyl ester ".
Description of drawings
Accompanying drawing 1 oleic acid is converted into two pathways metabolisms of other lipid acid
The non-seed opposite sex that accompanying drawing 2 seed-specific expression promotors are replaced on the interference carrier is expressed promotor
Accompanying drawing 3 has the PCR product of same restrictions restriction endonuclease recognition sequence
The interference fragment in accompanying drawing 4 different genes source is built into the fusion interference fragment
Accompanying drawing 5 merges interference fragments and is inserted into the two ends of same intron respectively with positive and negative both direction, is built into two approach and merges interference fragment expression cassettes and interference carrier thereof
Accompanying drawing 6 seed specific expression NapinA promotors substitute the CaMV35S promotor on the pFGC5941 carrier
Accompanying drawing 7FAD2 and FAE1 gene interference fragment connect into the fusion interference fragment
The expression cassette of accompanying drawing 8FAD2 and FAE1 gene fusion interference fragment interference carrier pFG2FF
Embodiment
Below in conjunction with accompanying drawing and example the present invention is further described, but is not intended to limit the scope of the invention.Suppress the FAE1.1 expression of gene that 2. the FAD2 gene 1. gone up from the desaturation approach and chain extension approach go up simultaneously with the RNA perturbation technique, improving the swede type rape oleic acid content is embodiment:
1. material therefor reagent
Swede type rape (Brassica napus): kind is No. 15, Hunan oil, and explant is a cotyledon petiole.
Bacterial strain and plasmid: bacillus coli DH 5 alpha, Agrobacterium LBA4404, pMD18-T carrier, pFGC5941 interference carrier.
Enzyme and chemical reagent: Plant Genome is extracted test kit, plasmid extraction kit, and dna gel reclaims box, DNA restriction enzyme, T
4Dna ligase, high-fidelity hot resistant DNA polymerase, DNA Marker, kantlex, careless fourth phosphine and other biochemical reagents.
2. technological method
1) amplification of rape NapinA promotor and promotor are replaced
Promotor full length sequence (the NCBI number of landing is J02798) design primer according to the swede type rape seed storage protein NapinA gene of having delivered is right, amplification NapinA promoter fragment.Primer is synthetic by Ying Wei wound Tianjin company.Primer sequence is as follows:
Primer1：5′
AAGCTTTCTTCATCGGTGATTGAT3′
8 italic overstriking letters of 5 ' end are EcoRI restriction endonuclease recognition sequence and its protection base.
Primer2：5′
AGTAAAGAGTGAAGCGGATGAGT3′
14 italic overstriking letters of 5 ' end are NcoI restriction endonuclease recognition sequence and its protection base.
30 μ L PCR reaction systems comprise 10 * PCR damping fluid, 3 μ L, 2.5mmol/L dNTP 3 μ L, and 2 units of Pfu enzyme, each 0.5 μ L of 20nmol/L primer, template DNA 2 μ L add sterilization ultrapure water to 30 μ L.Gene-amplificative instrament is a Biometra T type.PCR thermal cycling program is: 94 ℃ of pre-sex change 3 minutes, and 94 ℃ of sex change 1 minute, 60 ℃ of renaturation 40 seconds, 72 ℃ were extended totally 35 circulations 100 seconds.The amplified production of PCR carries out agarose gel electrophoresis, and agarose concentration is 1.5%, and voltage 60V is about electrophoresis time 1hr.The observation of taking pictures of gel analysis system.The recovery of PCR product is reclaimed the Kit explanation with reference to the new the Changjiang river Gel in Beijing and is carried out.
The PCR product that reclaims simultaneously, excises the CaMV35S promotor with same two kinds of enzymes with EcoRI and two digestion with restriction enzyme of NcoI from plasmid pFGC5941.Again the NapinA promotor is linked the corresponding site at original CaMV35S promotor place on the pFGC5941 plasmid, be built into pFGNAP carrier (Fig. 6).
2) amplification of FAD2 and FAE1 gene interference fragment
According to the swede type rape Δ of having delivered
12The primer of 5 of-fatty acid desaturase (FAD2) gene ' end coding region sequence (the NCBI number of landing is AY577313) design amplification interference fragment is right, and primer is synthetic by Ying Wei wound Tianjin company.Primer sequence is as follows:
Primer3：5′
TCCCTCGCTCTTTCTC3′
20 italic overstriking letters of 5 ' end are followed successively by the restriction endonuclease recognition sequence of AscI/BamHI/EcoRI from left to right.
Primer4：5′
ATGTCTGACTTCTTCTTGG?3′
12 italic overstriking letters of 5 ' end are followed successively by the restriction endonuclease recognition sequence of NcoI/XbaI from left to right.
Primer according to 5 of swede type rape fatty acid prolonging enzyme (FAE1.1) gene of having delivered ' end coding region sequence (the NCBI number of landing is AF490462) design amplification interference fragment is right, and primer is synthetic by Ying Wei wound Tianjin company.Primer sequence is as follows:
Primer5：5′
GGCTTGACTTCTTGAGG?3′
14 italic overstriking letters of 5 ' end are followed successively by the restriction endonuclease recognition sequence of AscI/BamHI from left to right.
Primer6：5′
ACCTATTATCACCAGCGT?3′
18 italic overstriking letters of 5 ' end are followed successively by the restriction endonuclease recognition sequence of NcoI/XbaI/EcoRI from left to right.
30 μ L PCR reaction systems comprise 10 * PCR damping fluid, 3 μ L, 2.5mmol/L dNTP 3 μ L, and 2 units of Pfu enzyme, each 0.5 μ L of 20nmol/L primer, template DNA 2 μ L add sterilization distilled water to 30 μ L.Gene-amplificative instrament is a Biometra T type.PCR thermal cycling program is: 94 ℃ of pre-sex change 3 minutes, and 94 ℃ of sex change 40 seconds, 50 ℃ of renaturation 40 seconds, 72 ℃ were extended totally 35 circulations 100 seconds.The amplified production of PCR carries out agarose gel electrophoresis, and agarose concentration is 1.5%, and voltage 60V is about electrophoresis time 1hr.The observation of taking pictures of gel analysis system.The recovery of PCR product is reclaimed the Kit explanation with reference to the new the Changjiang river Gel in Beijing and is carried out.
3) the PCR product connects and sequencing analysis
FAD2 and FAE1 gene interference fragment PCR product by above-mentioned high-fidelity Pfu polymeric enzymatic amplification obtains behind the first tailing, are connected on the pMD18-T carrier.After changing carrier over to bacillus coli DH 5 alpha again, send company to carry out sequencing.Then sequencing result is carried out the homology compare of analysis on American National Information Network NCBI.
4) FAD2 and FAE1 gene interference fragment is connected
With EcoRI and two restriction enzymes of NcoI FAD2 gene interference fragment is downcut from its T carrier, reclaim behind the electrophoresis; With EcoRI and two restriction enzymes of AscI FAE1 gene interference fragment is downcut from its T carrier, reclaim behind the electrophoresis.Reclaim the interference fragment balanced mix to two again, utilize the pairing of common EcoRI sticky end, use T for 16 ℃
4Ligase enzyme couples together these two fragments.Be that primer carries out the fusion interference fragment (Fig. 7) that the high-fidelity pcr amplification obtains these two gene interference fragments with Primer3 and Primer4 then, after electrophoresis reclaims and merges interference fragment, be inserted into again on the pMD18-T carrier, be built into the pMD18-T-Fadei plasmid.
5) FAD2 and FAE1 two gene fusion interference fragment interference carriers make up and Agrobacterium-mediated Transformation
With BamHI and XbaI double digestion respectively enzyme cut pFGNAP and pMD18-T-Fadei two plasmids.The fusion interference fragment that downcuts is oppositely inserted on the multiple clone site on cinnamophenone (CHSA) intron right side of pFGNAP, be built into an excessive plasmid pFGNAP-1.With AscI and NcoI double digestion respectively enzyme cut pMD18-T-Fadei and pFGNAP-1 plasmid, the fusion interference fragment forward that downcuts is inserted on the multiple clone site in CHSA intron left side of excessive plasmid pFGNAP-1, be built into fusion interference fragment interference carrier pFG2FF (Fig. 8) with the inverted repeats expression cassette of these two genes.The pFG2FF carrier that builds is transferred in the agrobacterium tumefaciens lba4404 by freezing molten method, is used for the conversion of next step rape.
6) genetic transformation of swede type rape
Select full grains, particle shape is normal, do not have split do not have the seed sterilization of going mouldy after, seed evenly is seeded on the 1/5MS substratum, place 25 ℃ of darkrooms to cultivate 4-5 days, launch to cotyledon.From the top of cotyledonary node, downcut the cotyledon of band handle as the conversion explant with aseptic scalpel.After explant is contaminated in carrying the Agrobacterium LBA4404 solution of pFG2FF carrier, cotyledon petiole kept flat to train altogether to cultivate altogether on the substratum to be transferred on the screening culture medium that contains careless fourth phosphine after 2-3 days cultivate.Per two weeks are changed a fresh culture, and the seedling that differentiates is transferred on the 1/2MS substratum, by the time grow flourishing root system, open and seal film one day, seedling are transferred in the vermiculite again and practice 1～2 week of seedling.Change over to afterwards in the basin dress soil and place the outdoor solid maturation that is cultured to.
8) mensuration of the evaluation of transgene rape and oleic acid content
Because the interference fragment of two genes is from rape genome itself, it is right that the detection of transfer-gen plant need utilize the sequence on the pFGNAP carrier to design PCR detection primer.Because the fusion interference fragment that forward inserts is between NapinA promotor and CHSA intron, so be that the basic design one couple of PCR detects primer with NapinA promoter sequence and CHSA intron sequences just.Because oppositely the fusion interference fragment that inserts is between CHSA intron sequences and octopine synthase gene (OCS) 3 ' termination signal sequence, so be that the basic design one couple of PCR detects primer with CHSA intron preface and OCS3 ' termination signal sequence just.It is as follows that PCR detects primer sequence.
Forward inserts and merges interference fragment PCR detection primer:
Primer7：5′GGAATTCCTCTCATCCCCTTTTAAACCAACT?3′
Primer8：5′TCCCCTCTTTCTACCTTCCCACAAT?3′
Oppositely insert and merge interference fragment PCR detection primer:
Primer9：5′CACTCCAAAGAAAGAGAAACTGACA?3′
Primer10：5′CTCAGGTTTTTTACAACGTGCACAA?3′
Mensuration to oleic acid and content of erucic acid in the transfer-gen plant seed of these two gene Fusion interference fragments, carry out according to the unified approach that the canola fatty acids component concentration gas-chromatography (GC) of country's promulgation is measured, specifically referring to national standard " gas chromatographic analysis of animal-plant oil-fatty acid methyl ester ".
3. result
Utilize agrobacterium mediation method that pFG2FF is imported to rape variety Hunan oil No. 15 and the genome of H001 in, by screening, obtain the anti-careless fourth phosphine plant of 56 strains altogether.Utilize two pairs of primers of Primer7/Primer8 and Primer9/Primer10 that the PCR that carries out is detected, wherein 32 strains have pcr amplification product, and the PCR molecular weight of product that amplifies size is identical with the molecular weight of expection, illustrates to obtain transfer-gen plant.
T1 seed that the transfer-gen plant present age (T0) selfing obtains and T1 are for the T2 seed oleic acid of selfing acquisition and the GC measurement result of content of erucic acid, with No. 15 (oleic acid contents 60% ± 2 of Hunan oil, content of erucic acid 5% ± 1) do transfer-gen plant T1 that acceptor obtains and T2 for oleic acid content in the seed all greater than 83%, erucic acid does not measure.With H001 (oleic acid content 13% ± 2, content of erucic acid 57% ± 1.5%) do transfer-gen plant T1 that acceptor obtains and T2 for oleic acid content in the seed all greater than 81%, erucic acid does not measure.The T3 seed that obtains for selfing from the T2 of No. 15, Hunan oil and H001 transfer-gen plant, and T2 and other oleic acid content are between 20%～30%, the seed that 7 the brassica napus reciprocal crosss of content of erucic acid between 20%～58% obtain, the measurement result oleic acid content is all greater than 80%, and content of erucic acid is between 0～1.7%.High oleic acid that interference causes and low erucic acid proterties are complete dominance.
Claims (5)
1. a dual-approach gene expression suppresses to obtain the method for cole with high oleic acid and low erucic acid synchronously, it is characterized in that:
1) replaces the promotor of the seed specific expression promotor being displaced other type; 2) suppressor gene is selected 1. 2. to choose any katalaze enzyme gene respectively as suppressing object on two approach with the chain extension approach from the further metabolism of oleic acid for the desaturation approach of other lipid acid, and determine to be suppressed on the gene of expression and be used for interferential nucleic acid fragment sequence, with this interference fragment of special primer pcr amplification; 3) merge interference fragment by digestion with restriction enzyme and T
42. 1. ligase enzyme gone up heterogeneic interference fragment with the chain extension approach from oleic acid desaturation approach and connected into new fusion interference fragment selected; 4) merge the interference fragment interference carrier and make up and to merge interference fragment and be inserted into the both sides of same intron, be built into two approach fusion interference fragment expression cassettes and interference carrier thereof with opposite direction; 5) conversion is transformed in the acceptor gene group with agriculture bacillus mediated expression cassette with two approach fusion interference fragment interference carriers, by resistance screening and Molecular Detection, determines to have the transfer-gen plant that two approach merge interference fragment interference carrier expression cassettes.
2. suppress to obtain the method for cole with high oleic acid and low erucic acid synchronously according to dual-approach gene expression described in the claim 1, it is characterized in that, 1. 2. choose any katalaze enzyme gene respectively as suppressing object on two approach with the chain extension approach from the further metabolic desaturation approach of oleic acid, and selected being suppressed is used for interferential nucleic acid fragment sequence, this interference fragment of usefulness special primer pcr amplification on the expressing gene.
3. suppress to obtain the method for cole with high oleic acid and low erucic acid according to dual-approach gene expression described in claim 1 or 2 synchronously, it is characterized in that, the interference fragment that different genes on two approach is originated connects into a new fusion interference fragment.
4. suppress to obtain the method for cole with high oleic acid and low erucic acid synchronously according to dual-approach gene expression described in the claim 1-3, it is characterized in that, be inserted into the both sides of same intron with merging interference fragment, be built into two approach and merge interference fragment expression cassettes and interference carrier thereof.
5. fusion interference fragment interference carrier according to claim 4 is used to obtain transgenic plant, and with transfer-gen plant as hybrid strain.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CNA2008101868675A CN101550414A (en) | 2008-12-31 | 2008-12-31 | Method for obtaining cole with high oleic acid and low erucic acid by dual-approach gene expression synchronous suppression |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CNA2008101868675A CN101550414A (en) | 2008-12-31 | 2008-12-31 | Method for obtaining cole with high oleic acid and low erucic acid by dual-approach gene expression synchronous suppression |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN101550414A true CN101550414A (en) | 2009-10-07 |
Family
ID=41154904
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CNA2008101868675A Pending CN101550414A (en) | 2008-12-31 | 2008-12-31 | Method for obtaining cole with high oleic acid and low erucic acid by dual-approach gene expression synchronous suppression |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN101550414A (en) |
Cited By (6)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101824472B (en) * | 2009-12-28 | 2012-02-08 | 华中农业大学 | Cabbage type rape high oleic acid molecular marker, preparation method and application thereof |
| CN105567856A (en) * | 2016-03-02 | 2016-05-11 | 四川农业大学 | Genotype detection method of fad2 gene of cabbage type rape |
| CN105671161A (en) * | 2016-03-02 | 2016-06-15 | 四川农业大学 | Method for determining high oleic acid in brassica napus on basis of BnaLCR78 gene |
| CN107365797A (en) * | 2017-04-10 | 2017-11-21 | 浙江省农业科学院 | A kind of method that co-suppression rape FAD2 and FAE1 gene expression improves rapeseed oil nutritional quality |
| CN109182373A (en) * | 2018-09-18 | 2019-01-11 | 武汉市农业科学院 | A method of high oleic acid rape is obtained using gene editing technology |
| CN111304236A (en) * | 2020-01-14 | 2020-06-19 | 浙江省农业科学院 | Method for obtaining high oleic acid rape based on double-site genome editing |
-
2008
- 2008-12-31 CN CNA2008101868675A patent/CN101550414A/en active Pending
Cited By (8)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101824472B (en) * | 2009-12-28 | 2012-02-08 | 华中农业大学 | Cabbage type rape high oleic acid molecular marker, preparation method and application thereof |
| CN105567856A (en) * | 2016-03-02 | 2016-05-11 | 四川农业大学 | Genotype detection method of fad2 gene of cabbage type rape |
| CN105671161A (en) * | 2016-03-02 | 2016-06-15 | 四川农业大学 | Method for determining high oleic acid in brassica napus on basis of BnaLCR78 gene |
| CN105567856B (en) * | 2016-03-02 | 2018-11-13 | 四川农业大学 | A kind of genotype detection method of the fad2 genes of cabbage type rape |
| CN105671161B (en) * | 2016-03-02 | 2019-06-14 | 四川农业大学 | A method of containing high oleic acid according to BnaLCR78 genetic testing cabbage type rape |
| CN107365797A (en) * | 2017-04-10 | 2017-11-21 | 浙江省农业科学院 | A kind of method that co-suppression rape FAD2 and FAE1 gene expression improves rapeseed oil nutritional quality |
| CN109182373A (en) * | 2018-09-18 | 2019-01-11 | 武汉市农业科学院 | A method of high oleic acid rape is obtained using gene editing technology |
| CN111304236A (en) * | 2020-01-14 | 2020-06-19 | 浙江省农业科学院 | Method for obtaining high oleic acid rape based on double-site genome editing |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Jung et al. | Identification of functional BrFAD2-1 gene encoding microsomal delta-12 fatty acid desaturase from Brassica rapa and development of Brassica napus containing high oleic acid contents | |
| CN102782140B (en) | Target participates in the engineered zinc finger protein of the plant gene of fatty acid biological synthesis | |
| CN105543270A (en) | Double resistance CRISPR/Cas9 carrier and application | |
| CN101550414A (en) | Method for obtaining cole with high oleic acid and low erucic acid by dual-approach gene expression synchronous suppression | |
| WO2009124070A1 (en) | Nuclear based expression of genes for production of biofuels and process co-products in algae | |
| US10077450B2 (en) | Sugarcane bacilliform viral (SCBV) enhancer and its use in plant functional genomics | |
| AU2015234362B2 (en) | Sugarcane bacilliform viral (SCBV) enhancer and its use in plant functional genomics | |
| Semiarti et al. | Application of CRISPR/Cas9 genome editing system for molecular breeding of orchids | |
| CN108795898B (en) | Application of gene for promoting accumulation of linolenic acid in plant seeds | |
| CN103739686A (en) | Protein related to plant yield improvement and quality improvement, and encoding gene and application thereof | |
| CN101942455B (en) | TT16 gene families of brassica napus as well as application thereof | |
| CN101942458B (en) | Gene families of cabbage type rape, parental species Chinese cabbage and cabbage AHA10 thereof and applications thereof | |
| Ahn et al. | Development of an efficient Agrobacterium-mediated transformation system and production of herbicide-resistant transgenic plants in garlic (Allium sativum L.) | |
| CN101818196B (en) | Molecular marker for low linolenic acid of cabbage type rape, preparation method and application thereof | |
| CN114990153B (en) | Application of rice lipid transfer protein in improving rice fatty acid content and reducing rice chalkiness | |
| Zebarjadi et al. | Transformation of rapeseed (Brassica napus L.) plants with sense and antisense constructs of the fatty acid elongase gene | |
| CN107523584B (en) | Transgenic method for improving oil content of plant nutritive tissue, expression vector and application | |
| US20240110196A1 (en) | Use of multigene stacking method in synthesis of nervonic acid in brassica napus | |
| CN115820689B (en) | Method for improving NMN content in vegetables by polygene tandem method and application thereof | |
| II | GÉNÉRATION I | |
| KR101437605B1 (en) | Method for producing a transgenic Brassica napus | |
| CN102586274B (en) | Wild cabbage TT16 gene family and application thereof | |
| CN116836994A (en) | Elephant grass aluminium-tolerant gene CpA0700515 and plant genetic transformation method thereof | |
| CN116555263A (en) | Method for constructing sgRNA combination of new soybean variety and cultivating new soybean variety and application | |
| CN116396865A (en) | Chlamydomonas reinhardtii mutant strain capable of stably and highly expressing exogenous genes and construction method thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C02 | Deemed withdrawal of patent application after publication (patent law 2001) | ||
| WD01 | Invention patent application deemed withdrawn after publication |
Open date: 20091007 |