CN108795898B - Application of gene for promoting accumulation of linolenic acid in plant seeds - Google Patents

Abstract

The invention discloses an application of a gene for promoting linolenic acid accumulation of plant seeds, wherein the gene fragment has a nucleotide sequence shown as any one of SEQ ID No. 1-SEQ ID No.4 or a complementary sequence thereof, or a derivative nucleotide sequence which has homology of not less than 95% with the nucleotide sequence shown as any one of SEQ ID No. 1-SEQ ID No.4 and has the same function due to addition, deletion or substitution of one or more nucleotides. The invention discovers the function and the application of the cabbage type rape lysophosphatidic acid acyltransferase gene BnLPAAT2 for promoting the accumulation of the linolenic acid in the plant seeds for the first time, and can effectively promote the accumulation of the linolenic acid in the plant seeds by introducing a gene fragment with a specific nucleotide sequence and a protein with a specific amino acid sequence. The BnLPAAT2 gene cloned in the invention not only obviously improves the linolenic acid content in the seeds of overexpression strain, but also improves the oil content of the seeds to a certain extent.

Description

Application of gene for promoting accumulation of linolenic acid in plant seeds

Technical Field

The invention belongs to the field of plant genetic engineering, and particularly relates to application of a gene for promoting linolenic acid accumulation of plant seeds. The invention specifically adopts a molecular biological method to separate a gene BnLPAAT2(Brassica napus lysophosphaticDicAcyltransferase 2) which can preferentially catalyze linolenic acid esterification to form phosphatidic acid from the developing seeds of Brassica napus, and the gene encodes an Acyltransferase. Overexpression analysis in arabidopsis proves that BnLPAAT2 has preference in the esterification process of linolenic acid at sn-2 position of triglyceride, and finally, the linolenic acid content and the oil content in seeds are improved.

Background

In higher plants, fats and oils exist mainly in the form of triglycerides, which are mainly composed of a glycerol skeleton and three fatty acids linked by ester bonds. In common oil crops, the fatty acids in triglycerides are composed primarily of palmitic acid, stearic acid, oleic acid, linoleic acid and small amounts of linolenic acid. Among them, linoleic acid and linolenic acid are fatty acids that cannot be synthesized by the human body itself, and are required to be ingested from an external source to meet the metabolic needs of the body, and are called as essential fatty acids for the human body. The world health organization and the food and agriculture organization of the united nations called for a special supplementation of the intake of essential fatty acids, especially omega-3 fatty acids, in 1993. Therefore, the legislation of various countries requires that essential fatty acid must be added into edible oil to ensure the safety of national basic nutrition intake. However, the content of the linolenic acid in the main oil crop oil is low at present, and the requirement of human body for the intake of unsaturated fatty acid cannot be met. Therefore, improving the fatty acid quality of oil crops is a hot topic at present.

Esterification of fatty acids the final synthetic fat is carried out in the endoplasmic reticulum via the Kennedy pathway: in the process, acyl group coenzyme A is catalytically deacylated at a carbon position of a sn-1 position by glycerol-3-phosphate serving as a skeleton in 3-phosphoglycerol acyltransferase to obtain lysophosphatidic acid (LPA) (Jain, R K, Coffey, M and Lai, K, et al.,2000), then lysophosphatidic acid acyltransferase (LPAAT) is used for esterification catalysis to form Phosphatidic Acid (PA) at a sn-2 position, and finally triacylglycerol is synthesized by deacylation catalysis of Phosphatidic acid phosphorylase and diacylglycerol acyltransferase. Lysophosphatidic acid acyltransferase (LPAAT) is a key enzyme that controls the production of phosphatidic acid from lysophosphatidic acid (Liang, M and Jiang, J, 2013). Currently, lysophosphatidyltransferases have been cloned from a variety of species, including Saccharomyces cerevisiae, Laurus nobilis, Arabidopsis thaliana, Brassica campestris, Linum usitatissimum, Theobroma cacao, Arachis hypogaea, Chimonanthus plants, and many other organisms. In the research aspect of improving the oil content by improving the oil synthesis, the finding that the LPAAT can improve the oil synthesis is provided. Overexpression of ScLPAAT increased oil content in oilseed rape by 6.84% to 8.55% (Liu, F, Xia, Y and Wu, L, et al, 2015). The LPAAT genes BAT1.5, BAT1.12 and BAT1.13 cloned from Brassica napus are transferred into Arabidopsis thaliana for expression, and the average oil content of the obtained progeny seeds is increased by 11% (Maisonneuve, S, Bessoule, J J and Lessire, R, et al., 2010). The oil content of the transgenic progeny seeds obtained by transferring the LPAAT gene cloned from the yeast into arabidopsis thaliana and brassica napus is improved by 21-26% (Zou, J, Katavic, V and Giblin, E M, et al, 1997).

The LPAAT gene attracts a lot of students mainly because the LPAAT gene has abundant substrate preference for Unusual Fatty acids and can promote the production of Unusual Fatty acids (u nuual Fatty acids). Therefore, the discovery of the LPAAT gene having application values in the fields of industry and food among various biological gene resources in nature has important significance and broad prospects. Reports demonstrate that Arabidopsis plastid-type LPAAT has a greater preference for 16:0 than for 18:0 (Bourgis, F, Kader, J C and Barret, P, et al, 1999). Cloning of cocoa immature seed endosperm into LPAAT, the gene was found to have substrate preference for medium-chain fatty acids (Laurent, P and Huang, A H, 1992; Davies, H M, Hawkins, D J and Nelsen, J S, 1995; Knutzon, D S, Lardizabal, K Dand Nelsen, J S, et al., 1995; Cao, Y Z, Oo, K C and Huang, A H, 1990). The gene with LPAAT activity was cloned in seeds in flax development and further functional verification revealed that the gene encoded a product with a preference for 18:2 (Sorensen, B M, Furukawa-Stoffer, T L and Marshall, ks, et al, 2005). The gene encoding LPAAT was cloned in Limnanthes douglasii and transferred into a mutant strain of escherichia coli JC201, where LPAAT was found to be erucic acid-preferential (Brown, A P, Brough, C L and Kroon, J T M, et al, 1995). When the MeadowfoamLPAAT gene was transferred into brassica napus, the erucic acid content in the transgenic progeny seeds was significantly increased (Lassner, M W, Levering, C K and Davies, H M, et al, 1995). LPAAT cloned in saccharomyces cerevisiae has substrate preference for unsaturated fatty acids (Jain, S, Stanford, N and Bhagwat, N, et al, 2007). Particulate LPAAT was found to have erucic acid preference in brassicaceae, the first time long chain unsaturated fatty acid preference was found in brassicaceae (Taylor, D C, Barton, D L and Giblin, em, et al, 1995). The LPAAT gene was cloned in seeds during peanut development and was found to have substrate preference as well (Shekar, S, Tumaney, a W and Rao, T J V S, et al, 2002). Co-expression of cocoa-derived LPAAT with WRI1 transcription factors in tobacco indicated that cocoa-derived LPAAT had a strong medium-chain fatty acid preference and that accumulation of excess medium-chain fatty acids was detected in tobacco leaves (Knutzon, D S, Lardizabal, K D, Nelsen, J S, Bleibaum, J L, Davies, H M and Metz, J G, 1995; Reynolds, K B, Taylor, M C and Zhou, X, et al, 2015). The yeast SLC1 was tested for preference in vitro and SLC1 was found to have preference for oleic acid and 14:0 (Shui, G, Guan, X L and Gopalakrishnan, P, et al, 2010). In algal plants, different species can find that LPAAT exhibits widely different substrate preferences, such as 16:0, 18:1, etc. (Okazaki, K, 2006). Combining the research contents, although the LPAAT gene can show substrate preference in vitro experiments, the over-expression of LPAAT does not improve the proportion and content of target fatty acid in grease. Analysis shows that the overexpression of the LPAAT gene does not cause the synthesis of specific fatty acid to be accelerated, and the effect of LPAAT only plays a role in preference accumulation in the fatty acid esterification stage. The linolenic acid content of lipids depends on both the synthesis (e.g., fatty acid dehydrogenase) and accumulation (e.g., acyltransferase) of linolenic acid. Therefore, it is important to find an acyltransferase that has a preferential accumulation of linolenic acid. A few studies report that overexpression of LPAAT increases the percentage of target fatty acids in triglycerides but decreases the total oil content, and finally the total amount of target fatty acids is not significantly increased.

Disclosure of Invention

In view of the above defects or improvement needs of the prior art, the present invention provides an application of a gene for promoting accumulation of linolenic acid in plant seeds, and the present invention finds for the first time a cabbage type rape lysophosphatidic acid acyltransferase gene BnLPAAT2, its function and use for promoting accumulation of linolenic acid in plant seeds (i.e., finds for the first time an acyltransferase gene capable of increasing accumulation of linolenic acid in plant seeds), and can effectively promote accumulation of linolenic acid in plant seeds by introducing a gene fragment having a specific nucleotide sequence and a protein having a specific amino acid sequence. The BnLPAAT2 gene cloned in the invention not only obviously improves the linolenic acid content in the seeds of overexpression strain, but also improves the oil content of the seeds to a certain extent; further research proves that the overexpression of the BnLPAAT gene improves the linolenic acid content on the sn-2 position of the triglyceride of the seed by 10 percent. The acyltransferase gene is the only acyltransferase gene discovered at present, which can increase the accumulation of linolenic acid and the oil content, and has important significance for improving the quality of oil crops through genetic engineering.

To achieve the above object, according to one aspect of the present invention, there is provided a use of a gene fragment for promoting linolenic acid accumulation in a plant seed, wherein the gene fragment has a nucleotide sequence as shown in any one of SEQ ID nos. 1 to 4 or a complementary sequence thereof, or a derivative nucleotide sequence having a homology of not less than 95% to a nucleotide sequence as shown in any one of SEQ ID nos. 1 to 4 and having the same function due to addition, deletion or substitution of one or more nucleotides.

According to another aspect of the present invention, there is provided a use of a protein having an amino acid sequence as shown in any one of SEQ ID No.5 to SEQ ID No.8 or a derivative protein having an equivalent activity to the amino acid sequence shown in any one of SEQ ID No.5 to SEQ ID No.8 due to addition, deletion or substitution of one or more amino acids, for promoting linolenic acid accumulation in plant seeds.

According to a further aspect of the present invention, there is provided a use of a recombinant vector for breeding improvement to promote linolenic acid accumulation in plant seeds, wherein the recombinant vector comprises a gene fragment having a nucleotide sequence as shown in any one of SEQ ID No.1 to SEQ ID No.4 or a complementary sequence thereof, or a derivative nucleotide sequence having a homology of not less than 95% to the nucleotide sequence as shown in any one of SEQ ID No.1 to SEQ ID No.4 due to addition, deletion or substitution of one or more nucleotides, and having the same function.

According to a further aspect of the present invention, there is provided a use of a recombinant strain in breeding improvement for promoting linolenic acid accumulation in plant seeds, wherein the recombinant strain comprises a gene fragment having a nucleotide sequence as shown in any one of SEQ ID No.1 to SEQ ID No.4 or a complementary sequence thereof, or a derivative nucleotide sequence having a homology of not less than 95% to the nucleotide sequence as shown in any one of SEQ ID No.1 to SEQ ID No.4 due to addition, deletion or substitution of one or more nucleotides, and having the same function.

In a further preferred embodiment of the present invention, the plant includes a monocotyledon or dicotyledon, preferably any one of arabidopsis thaliana, oilseed rape, peanut, soybean, camellia oleifera, jatropha curcas, palm, corn, rice, wheat, sesame, sunflower, and olive.

Through the technical scheme, compared with the prior art, the invention utilizes four copies of nucleotide sequences (such as the nucleotide sequences shown in SEQ ID No. 1-SEQ ID No. 4) of the cabbage type rape lysophosphatidic acid acyltransferase gene BnLPAAT2 and four copies of amino acid sequences (such as the amino acid sequences shown in SEQ ID No. 5-SEQ ID No.8) of the cabbage type rape lysophosphatidic acid acyltransferase gene BnLPAAT2, and the cabbage type rape lysophosphatidic acid acyltransferase gene (such as the BnLPAAT2 gene with the nucleotide sequences and the amino acid sequences) has the preference of sn-2 linolenic acid and has double functions of improving the linolenic acid content and the oil content of seeds. The BnLPAAT2 gene has wide application prospects in the fields of molecular breeding and transgenic plant oil component improvement, can be particularly used for changing the content and the component proportion of plant seed fatty acid, and provides a method for changing the content and the component proportion of the plant seed fatty acid.

The invention takes cDNA of a seed in the development of cabbage type rape as a template, designs a primer clone through a homologous gene conserved region to obtain four homologous copy genes of the cabbage type rape lysophosphatidic acid acyltransferase BnLPAAT2 gene which are respectively named as BnLPAAT2-A7, BnLPAAT2-C7, BnLPAAT2-C7 and BnLPAAT2-A9 according to the positions of chromosomes, wherein the lengths of the reading frames of the genes are 1173bp, 1176bp, 1173bp and 1173bp respectively, and 390, 391, 390 and 390 amino acid residues are respectively coded. The four copies of the gene have high nucleotide sequence similarity, and the homology is between 95 and 99 percent. Compared with the sequence of other species LPAAT2, the amino acid sequence of BnLPAAT2-A7 is taken as an example, and the similarity of the amino acid sequence with the corresponding LPAAT2 sequence of Arabidopsis, camelina sativa, jatropha curcas, soybean, camellia oleifera and peanut reaches 92%, 91%, 81%, 78%, 76% and 75%. Nucleotide sequences of BnLPAAT2-A7, BnLPAAT2-C7, BnLPAAT2-C8 and BnLPAAT2-A9 are numbered as KX279816.1, NM-001316026.1, KX279817.1 and KX279818.1 respectively on Genbank. According to the invention, the overexpression verification function of the BnLPAAT2 gene in the transfer mode plant Arabidopsis is found, and the linolenic acid content in the fatty acid component of the transgenic line seed is obviously improved and the oil content is also slightly improved. The linolenic acid content at the sn-2 position of the glycerol backbone was found to be increased by 10% in the triglycerides of seeds of the BnLPAAT2 transgenic line, thus confirming that BnLPAAT2 has linolenic acid preference during fatty acid accumulation.

Specifically, compared with the prior art, the invention has the following beneficial effects:

(1) four copies of lysophosphatidic acid acyltransferase gene BnLPAAT are separated from the seeds in the development of the cabbage type rape, and the transformation model plant Arabidopsis proves that the BnLPAAT2 can preferentially accumulate linolenic acid at the sn-2 position of triglyceride, so that the linolenic acid content of plant seeds is increased, and the oil content of transgenic plants can be increased.

The genes for increasing linolenic acid mainly comprise fatty acid dehydrogenases (such as FAD3, FAD8 and the like) (linolenic acid synthetase), which are well known in the art at present, but the invention utilizes an acyltransferase gene with a specific nucleotide sequence (especially a nucleotide sequence shown as any one of SEQ ID No. 1-SEQ ID No. 4) to obtain an acyltransferase (corresponding to a linolenic acid accumulation gene), which is the enzyme for promoting linolenic acid accumulation and is found for the first time in the acyltransferase, namely, the enzyme in the accumulation path, and reports that the accumulation path can simultaneously increase the contents of linolenic acid and oil are absent in the prior art.

(2) The BnLPAAT2 gene is transferred into important crops such as rice, corn, soybean, rape, camellia oleifera, sesame, sunflower, olive and the like, so that the fatty acid synthesis approaches of the plants can be changed and regulated, the aim of improving the yield and the quality is fulfilled, the oil germplasm containing fatty acid components more beneficial to human health is obtained, and the gene has great significance for genetic breeding of oil plants.

The BnLPAAT2 gene cloned in the invention not only obviously improves the linolenic acid content in the seeds of overexpression strain, but also improves the oil content of the seeds to a certain extent; further research proves that the overexpression of the BnLPAAT gene improves the linolenic acid content on the sn-2 position of the triglyceride of the seed by 10 percent. The gene is the only gene discovered at present, which can improve the accumulation of linolenic acid and the oil content, and has important significance for improving the quality of oil crops through genetic engineering. The application method can improve the accumulation of linolenic acid and the total oil content; the invention can improve the fatty acid content and composition of seeds of plants (including monocotyledons and dicotyledons, in particular arabidopsis, rape, peanut, soybean, camellia oleifera, jatropha curcas, palm, corn, rice, wheat, sesame, sunflower and olive), and can also improve breeding (for example, by means of transforming transgenic plants with BnLPAAT2 gene and the like) to obtain transgenic plants with higher linolenic acid content.

Drawings

FIG. 1 is agarose gel electrophoresis picture of BnLPAAT2 gene amplified by using cDNA of seeds in cabbage type rape development as template. M: marker III, 1: BnLPAAT2 gene (BnLPAAT2-A7, BnLPAAT2-C7, BnLPAAT2-C8, BnLPAAT2-A9 gene mixture).

FIG. 2 is a schematic diagram showing the structure of a pBinGlyRed3-BnLPAAT2s series plant seed specific expression vector, wherein a Glycinin-promoter (Glycinin seed specific expression promoter), Bn-LPAAT2s, Gly-term (Glycinin terminator), CVMV promoter, DsRed3 and NOS term are sequentially arranged between LB and RB.

FIG. 3 is a graph of the oil content of seeds of a BnLPAAT2 series overexpression line, wherein,

a is an oil content diagram of a BnLPAAT2-A7 overexpression strain, and corresponds to BnLPAAT2-A7-10-12, BnLPAAT2-A7-30-9, BnLPAAT2-A7-1-4, BnLPAAT2-A7-34-35, BnLPAAT2-A7-39-5, Red0-53, Red3-30-9, Red3-53-7, WT-1, WT-2, WT-3, mean of BnLPAAT2-A7 OE, mean of control l from left to right, wherein the BnLPAAT2-A7-10-12, BnLPAAT 7-A7-30-9, BnLPAAT 7-A7-1-4, BnAAT 7-A7-34, BnLPAAT 7-34-A7-34A 7-34;

b is an oil content diagram of BnLPAAT2-C7 overexpression strains, BnLPAAT2-C7-3-21, BnLPAAT2-C7-13-21, BnLPAAT2-C7-14-1, BnLPAAT2-C7-3-26, BnLPAAT2-C7-8-18, Red0-53, Red 0-30-9, Red 0-53-7, WT-1, WT-2, WT-3, mean of BnLPAAT 0-C0 OE, mean of control, wherein the strains BnLPAAT 0-C0-3-21, BnLPAAT 0-C0-13-21, BnLPAAT 0-C0-14-1, BnAAT 3-C0-26, BnLPAAT 0-C0-8-C0-3-C0-14-C0-14-C72-3, BnLPAAT 0-C0-72-C0-14-C-14 strain, and BnLPAAT 0-72;

c is an oil content diagram of BnLPAAT2-C8 overexpression strains, BnLPAAT2-C8-10-1, BnLPAAT2-C8-1-12, BnLPAAT2-C8-2-23, BnLPAAT2-C8-6-18, BnLPAAT2-C8-9-6, Red0-12-7, Red0-53, Red 0-30-9, WT-1, WT-2, WT-3, mean of BnLPAAT 0-C0 OE, mean of control, wherein the strains BnLPAAT 0-C0-10-1, BnLPAAT 0-C0-12, BnLPAAT 0-C0-2-23, BnAAT 72-C0-6-BnLPAAT 0-C0-6-3, BnLPAAT 0-3, BnLPAAT 0-3, B-C0-3, B-3;

d is an oil content diagram of a BnLPAAT2-A9 overexpression strain, and is a BnLPAAT2-A9-95-6, BnLPAAT2-A9-27-13, BnLPAAT2-A9-44-17, BnLPAAT2-A9-48-2, BnLPAAT2-A9-99-26, Red0-53, Red3-30-9, Red3-53-7, WT-1, WT-2, WT-3, mean of BnLPAAT2-A9, mean of control, wherein the BnLPAAT2-A9-95-6, BnLPAAT 9-A9-27-13, BnLPAAT 9-A9-17, BnLPAAT 9-A9-72-9-A9-9, BnLPAAT 9-A9-34, BnLPAAT 9-A9-34-A9-34, BnLPAAT 9-A9-48-11, BnLPAAT 9-48A 5926 and BnLPAAT 598-;

mean of control is mean of control group; taking BnLPAAT2-A9 as an example, mean of BnLPAAT2-A9OE is the average value of BnLPAAT2-A9 transgenic strains; DW is the dry weight of the seed; ﹡ represents a significant difference (P <0.05, n ═ 5).

FIG. 4 is a graph showing changes in fatty acid composition of seeds of BnLPAAT2-A7 transgenic line, for any one of palmitic acid (C16:0), stearic acid (C18:0), oleic acid (C18:1), linoleic acid (C18:2), linolenic acid (C18:3), eicosanoic acid (C20:0), eicosenoic acid (C20:1), eicosadienoic acid (C20:2), and erucic acid (C22:1), BnLPAAT2-A7-10-12, BnLPAAT2-A7-30-9, BnLPAAT2-A7-1-4, BnLPAAT2-A7-34-35, BnLPAAT2-A7-39-5, mean of BnLPAAT2-A7, and mean of control; wherein mean of control is the mean value of the control group; mean of BnLPAAT2-A7 OE is the average value of BnLPAAT2-A7 transgenic strains; ﹡ ﹡ are very different (P <0.01, n ═ 5).

FIG. 5 is a graph showing changes in fatty acid composition of seeds of BnLPAAT2-C7 transgenic lines, for any one of palmitic acid (C16:0), stearic acid (C18:0), oleic acid (C18:1), linoleic acid (C18:2), linolenic acid (C18:3), eicosanoic acid (C20:0), eicosenoic acid (C20:1), eicosadienoic acid (C20:2), and erucic acid (C22:1), BnLPAAT2-C7-3-21, BnLPAAT2-C7-13-21, BnLPAAT2-C7-14-1, BnLPAAT2-C7-3-26, BnLPAAT 2-C7-18, mean of BnLPAAT2-C7, and mean of control; wherein mean of control is the mean value of the control group; mean of BnLPAAT2-C7 OE is the average value of BnLPAAT2-C7 transgenic strains; ﹡ ﹡ are very different (P <0.01, n ═ 5).

FIG. 6 is a graph showing changes in fatty acid composition of seeds of BnLPAAT2-C8 transgenic lines, for any one of palmitic acid (C16:0), stearic acid (C18:0), oleic acid (C18:1), linoleic acid (C18:2), linolenic acid (C18:3), eicosanoic acid (C20:0), eicosenoic acid (C20:1), eicosadienoic acid (C20:2), and erucic acid (C22:1), BnLPAAT2-C8-10-1, BnLPAAT2-C8-1-12, BnLPAAT2-C8-2-23, BnLPAAT2-C8-6-18, BnLPAAT2-C8-6, mean of BnLPAAT2-C8, and mean of control; wherein mean of control is the mean value of the control group; mean of BnLPAAT2-C8 OE is the average value of BnLPAAT2-C8 transgenic strains; ﹡ ﹡ are very different (P <0.01, n ═ 5).

FIG. 7 is a graph showing changes in fatty acid composition of seeds of BnLPAAT2-A9 transgenic line, for any one of palmitic acid (C16:0), stearic acid (C18:0), oleic acid (C18:1), linoleic acid (C18:2), linolenic acid (C18:3), eicosanoic acid (C20:0), eicosenoic acid (C20:1), eicosadienoic acid (C20:2), and erucic acid (C22:1), BnLPAAT2-A9-95-6, BnLPAAT2-A9-27-13, BnLPAAT2-A9-44-17, BnLPAAT2-A9-48-2, BnLPAAT2-A9-99-26, mean of BnLPAAT2-A9, and mean of control; wherein mean of control is the mean value of the control group; mean of BnLPAAT2-A9OE is the average value of BnLPAAT2-A9 transgenic strains; ﹡ ﹡ are very different (P <0.01, n ═ 5).

FIG. 8 is a graph showing the change of fatty acid composition at sn-2 position in the triglyceride of seeds of BnLPAAT2 copies, wherein WT, BnLPAAT2-C8 OE, BnLPAAT2-C7 OE, BnLPAAT2-A7 OE, BnLPAAT2-A9OE are respectively provided from left to right for any one of palmitic acid (C16:0), stearic acid (C18:0), oleic acid (C18:1), linoleic acid (C18:2), linolenic acid (C18:3), eicosanoic acid (C20:0), eicosenoic acid (C20:1), eicosadienoic acid (C20:2) and erucic acid (C22: 1); wherein WT, BnLPAAT2-C8 OE, BnLPAAT2-C7 OE, BnLPAAT2-A7 OE and BnLPAAT2-A9OE respectively represent wild type, the mean value of a BnLPAAT2-C8 overexpression strain, the mean value of a BnLPAAT2-C7 overexpression strain, the mean value of a BnLPAAT2-A7 overexpression strain and the mean value of a BnLPAAT2-A9 overexpression strain; ﹡ ﹡ are very different (P <0.01, n ═ 5).

Detailed Description

In order to make the objects, technical solutions and advantages of the present invention more apparent, the present invention is described in further detail below with reference to the accompanying drawings and embodiments. It should be understood that the specific embodiments described herein are merely illustrative of the invention and are not intended to limit the invention. In addition, the technical features involved in the embodiments of the present invention described below may be combined with each other as long as they do not conflict with each other.

Example 1:

cloning of Brassica napus BnLPAAT2 Gene

RNA extraction of seeds in development of cabbage type rape

The gun head, the centrifuge tube and the solution involved in the following operations are all free from RNA enzyme pollution, and the operation is all carried out by wearing gloves.

(1) Preparing an extracting solution: mu.l of RL lysate is taken, then 5. mu.l of beta-mercaptoethanol is added and mixed evenly.

(2) And (3) homogenizing treatment: removing fruit pods from developing seeds in liquid nitrogen, quickly grinding into powder, adding 500 mu lRL lysate, and vortexing and shaking vigorously to mix uniformly. Centrifuge at 12000rpm for 5min and aspirate the supernatant.

(3) All solutions were transferred to the filtration column CS and centrifuged at 12000rpm for 2min, the supernatant from the collection tube was carefully pipetted into a fresh RNase-Free centrifuge tube, and the tip was kept from touching the cell debris pellet in the collection tube as much as possible.

(4) Adding 0.5 times of anhydrous ethanol into the centrifuge tube, mixing, transferring into adsorption column CR3, centrifuging at 12000rpm for 1min, removing waste liquid, and placing adsorption column CR3 back into the collection tube.

(5) 350 μ l deproteinized solution RW1 was added to adsorption column CR3, centrifuged at 12000rpm for 1min, the waste liquid in the collection tube was discarded, and adsorption column CR3 was returned to the collection tube.

(6) 80. mu.l of DNase I digestion solution was added to the center of the adsorption column CR3, and the mixture was left at room temperature for 15min to digest the DNA.

(7) 350 μ l deproteinized solution RW1 was added to adsorption column CR3, centrifuged at 12000rpm for 1min, the waste liquid in the collection tube was discarded, and adsorption column CR3 was returned to the collection tube.

(8) Adding 500 μ l of rinsing solution RW into adsorption column CR3, standing at room temperature for 2min, centrifuging at 12000rpm for 1min, removing waste liquid from the collection tube, and returning adsorption column CR3 to the collection tube. Repeat step 8 once.

(9) Centrifuging at 12000rpm for 2min, and discarding waste liquid. The adsorption column CR3 was left at room temperature for several minutes to thoroughly dry the residual rinse solution from the adsorption material.

(10) Placing the adsorption column CR3 into a new RNase-Free centrifuge tube, adding 50 μ l RNase-Free water dropwise into the middle part of the adsorption membrane, standing at room temperature for 2min, and centrifuging at 12000rpm for 2min to obtain RNA solution. The ratio of the concentration of RNA and the OD value of 260 to 280 is determined, and if the ratio is between 1.8 and 2.0, the quality of RNA is considered to be available and placed in a refrigerator at the temperature of 70 ℃ below zero for standby, but the RNA is not suitable to be placed for more than one week.

(II) Synthesis of reverse transcription cDNA Strand of Total RNA

A ReverTra Ace-alpha reverse transcription kit from Toyobo Co.

(1) Thermal denaturation of RNA: mu.l of RNA (1. mu.g/. mu.l), 2. mu.l of oligo (dT) (10 pmol/. mu.l) and 12. mu.l of DEPC water were added to the ice box in this order, gently mixed, centrifuged in a palm centrifuge to remove the residual solution on the tube wall, reacted in a metal bath at 65 ℃ for 5min and immediately placed on ice. This step is optional and serves to disrupt the tertiary or secondary structure of the RNA, allowing the strand to open.

(2) Preparing a reaction solution: a40. mu.l system of 5 × Reaction Buffer 8. mu.l, RNase Inhibitor (10U/. mu.l), dNTPs mix (10mM) 4. mu.l, and ReverTra Ace-alpha-2. mu.l Reaction solution was added in this order on ice, and after gently mixing, the Reaction was stopped by setting the program in a metal bath at 42 ℃ for 1h and heat denaturation at 85 ℃ for 10 min. After the reaction is finished, the reaction product is stored in a refrigerator at the temperature of minus 20 ℃ for standby.

(III) PCR amplification and sequencing of full-length and coding region of gene

The primer design reference sequence is mainly from rape genome database and kindred parent cabbage and cabbage. Specific primers are designed according to the sequence information predicted in the genome database for amplification.

The complete gene sequence of the LPAAT2 gene in the database has 4 genes respectively located on four chromosomes A7, A9, C7 and C8. Wherein, the nucleotide sequences of BnLPAAT2-A7, BnLPAAT2-C7, BnLPAAT2-C8 and BnLPAAT2-A9 are numbered as KX279816.1, NM-001316026.1, KX279817.1 and KX279818.1 respectively in Genbank. Because the two end sequences of the four ORF sequences are the same, the same primer is designed and named as LPAAT2-F/R (LPAAT 2-F: ATGGCGATGGCAGCAGCAGTGA, LPAAT 2-R: TTACTTCTGCTTCTCCTCCACTTCTGTTTGG); add 10 XPCR Buffer 2. mu.l, 25mM MgSO in sequence on ice ₄2. mu.l dNTP (2.5mM), 0.3. mu.l LPAAT upstream primer (25. mu.M), 0.3. mu.l LPAAT downstream primer (25. mu.M), 1. mu.l cDNA (200 ng/. mu.l), 1. mu.l KOD plus (1U/. mu.l), ddH₂O11.8. mu.l in a total volume of 20. mu.l.

The reaction procedure was as follows:

pre-denaturation at 94 ℃ for 3min, denaturation at 94 ℃ for 30s, annealing at 60 ℃ for 30s, extension at 68 ℃ for 40s-1min, and re-extension at 68 ℃ for 10min for 30 cycles.

After amplification, the amplified product was subjected to agarose gel electrophoresis, and the band of interest was examined under an ultraviolet lamp after completion of the electrophoresis (FIG. 1). The band of interest was cut with a razor blade and transferred to a centrifuge tube, and the DNA fragment was recovered using an agarose gel recovery kit and ligated to the T-vector. Mu.l of Solution I, 4. mu.l of PCR product, 1. mu.l of pMD18-T vector (50 ng/. mu.l) were added to ice in a total volume of 10. mu.l in PCR tubes and mixed well, the tubes were placed in a metal bath and ligated overnight at 16 ℃. Adding the ligation product into the escherichia coli competence, uniformly mixing, carrying out ice bath for 30min, then placing the mixture into a 42 ℃ water bath kettle for heat shock for 90s, immediately placing the mixture on ice for 3min, adding 700 mu l of LB culture medium, and placing the mixture into a 37 ℃ shaking table for culturing for 30min at 200 rpm. The culture was pipetted 200. mu.l onto solid LB medium (100. mu.g/ml) with ampicillin and spread homogeneously with a spreading bar. The plate was placed upside down in a 37 ℃ incubator and incubated overnight. The positive plaques obtained were sent to the company for sequencing. The fragments sequenced to obtain four sequence differences are respectively named as: BnLPAAT2-A7 (corresponding to SEQ ID No.1 and SEQ ID No.5), BnLPAAT2-C7 (corresponding to SEQ ID No.2 and SEQ ID No.6), BnLPAAT2-C8 (corresponding to SEQ ID No.3 and SEQ ID No.7), and BnLPAAT2-A9 (corresponding to SEQ ID No.4 and SEQ ID No. 8).

Example 2:

overexpression vector construction

(I) construction of plant expression vector and Agrobacterium transformation

Amplifying the cloned gene sequence serving as a template by using a high-fidelity enzyme KOD plus of TOYOBO company, and recovering the obtained gene fragment through agarose gel for later use; and (3) adding 4 mul of EcoR I enzyme and 5 mul of enzyme digestion buffer into 40 mul of plasmid of the plant expression vector pBinGlyRed3, uniformly mixing, then carrying out enzyme digestion at 37 ℃ for 30 minutes, and recovering the vector through agarose gel for later use. Mu.l of the gene and plasmid recovered fragments were taken, respectively, and 1. mu.l of infusion kit mix was added thereto and mixed well, followed by ligation at 50 ℃ for 20 minutes. And transforming the connecting product into escherichia coli to obtain positive bacterial plaque, and extracting plasmids for later use. The recombinant plasmid carries a glycinin promoter to drive the specific expression of the LPAAT2 gene in seeds (FIG. 2). The recombinant plasmid was transformed into Agrobacterium GV3101 and positive Agrobacterium was selected.

(II) Agrobacterium infection transformation of Arabidopsis thaliana

The resulting positive strains were cultured overnight at 28 ℃ and 200rpm in LB medium supplemented with gentamicin (50. mu.g/ml), kanamycin (50. mu.g/ml) and rifampicin (25-50. mu.g/ml). Centrifuging at 5000rpm for 3min in a centrifuge, collecting thallus, and diluting Agrobacterium to OD of about 0.8 with transformation penetrating fluid. The arabidopsis thaliana at the initial flowering stage is selected for dip flower transformation, and before transformation, the siliques of the arabidopsis thaliana are cut off. The inflorescence of Arabidopsis thaliana was immersed in the transformation solution for 0.5-1 min. Arabidopsis seedlings were placed in the dark, humidified condition overnight. And then, the arabidopsis thaliana is placed back into the culture chamber again, the transformation is repeated after 3-5 days, and seeds are harvested after the arabidopsis thaliana is mature. Because the plant expression vector is provided with DsRed3 fluorescent protein (figure 2), the seeds are excited to release fluorescence under 520nm green light, and the red seeds which pass through the filter are transgenic T1 generations.

(III) preliminary screening of transgenic T1-generation Single-copy lines

And (4) collecting seeds after the T1 generation plants are mature, namely T2 generation, and screening the copy number of the seeds. The transgenic T2 seeds are excited under 520nm green light, and bright field pictures and exciting light pictures are respectively collected as light source pictures after the seeds penetrate through a red light filter. This step is performed under a fluorescent microscope. And (3) counting the number of the seeds of the collected photos under technical software such as ten-thousand-depth CG seed test software or Image J and the like of statistical software to finally obtain the proportion of the red seeds and the non-red seeds. And (3) selecting red seeds of the strain with the calculated ratio close to 3:1 for sowing, and collecting T3-generation seeds after the seeds are mature.

(IV) fatty acid analysis and expression analysis of overexpression lines

(1) Extraction and methyl esterification of oil

1. 5-10mg of Arabidopsis thaliana T3 generation seeds were weighed and placed in a 10ml glass test tube.

2. 1.5ml of 2.5% H are added in succession₂SO₄Methanol solution (containing 0.01% BHT), 200 μ l C17:0 toluene solution (concentration of 2mg/ml), 0.4ml toluene solution, and tightening the cap after filling with nitrogen to prevent high temperature volatilization.

Water bath at 3.99 ℃ for 1h, taking out, cooling, and then adding 1.8ml of double distilled water and 1ml of n-hexane in sequence.

4. After mixing, standing for 12h, sucking the supernatant by a 1ml syringe, and then filtering the supernatant into a sample bottle through a pore diameter of 0.45 mu m to be detected.

(2) Gas chromatography analysis of fatty acid methyl esters

The gas chromatograph model used: agilent 7890A, column model: agilent J&W GC Columns. Sample size 1 μ l, column box heating program: the initial temperature was 180 ℃ and the temperature was increased to 225 ℃ at a rate of 10 ℃/min for 7 minutes. The constant flow rate of the chromatographic column is 1ml/min, and the carrier gas is N₂。

The peak area is calculated by adopting software provided by an Agilent chemical workstation and adopting an internal standard method to calculate the oil content, and the calculation formula is as follows: m (C17:0 mass)/s (C17:0 peak area) is m (mass of oil)/s (peak area of fatty acid other than C17: 0).

The results of oil content of 20 transgenic lines counted by four copies of BnLPAAT2 gene A7, C7, C8 and A9 show that the oil content and linolenic acid content of BnLPAAT2-A7, BnLPAAT2-A9 are obviously improved; the oil contents of BnLPAAT2-C7 and BnLPAAT2-C8 are consistent with that of the wild type, and the linolenic acid content is obviously improved (figure 3).

The specific results are as follows:

1) the oil content of four transgenic lines A7 is averagely increased by 2.4 percent, and the maximum increase amplitude reaches 5.4 percent; the linolenic acid content is increased by 5.5 percent on average and is increased by 8.5 percent at most (figure 4).

2) The oil content of the C7 four transgenic lines can be improved by up to 3.3 percent, but the average oil content is not obviously improved and is close to the wild type; the linolenic acid content is averagely improved by 6.2 percent, and the maximum improvement amplitude reaches 7.1 percent (figure 5).

3) The oil content of four C8 transgenic lines is averagely improved by 1.3 percent, the highest amplitude reaches 3.8 percent, but the statistical analysis does not reach the significance difference; the linolenic acid content is averagely increased by 2.6, and the maximum increase amplitude reaches 4.1% (figure 6).

4) The oil content of four transgenic lines A9 is averagely increased by 2.7 percent, and the maximum amplitude reaches 6.3 percent; the average linolenic acid content is increased by 0.66 percent, and the maximum increase amplitude reaches 6.3 percent (figure 7).

(V) analysis of fatty acid components at sn-2 position of triglyceride of seeds of LPAAT2 overexpression strain

Adding 20mg of porcine pancreatic lipase and 2mL of Tris-HCl buffer solution (pH 8 and 2mol/L), shaking uniformly, adding 0.5mL of sodium cholate solution (1g/L) and 0.2mL of CaCl2 solution (220g/L), mixing uniformly by vortex, carrying out shake reaction in a 40 ℃ water bath kettle for 5min, adding 1mL of anhydrous ether and 1mL of HCl solution (6mol/L), shaking uniformly, centrifuging at 5000r/min for 2min, taking the upper layer, and drying by nitrogen to obtain a grease hydrolysis mixture sample. To a sample of the resulting hydrolysis mixture was added 2mL of methylene chloride and vortexed. Activating the NH2-SPE cartridge with 6mL of n-hexane, adding a sample of the mixture to the NH2-SPE cartridge, then rinsing the NH2-SPE cartridge with n-hexane/ethyl acetate (v/v) 85/15 to remove TAG, DAG and FFA in the sample, then rinsing the cartridge with dichloromethane/methanol (v/v) 2/1 to separate MAG, and blowing the rinsed sample with nitrogen. 1mL of 0.4mol/L KOH/methanol solution, vortexed for 10min, then 2mL of 0.9% (w/v) aqueous sodium chloride solution was added, gently shaken for 5-10s, centrifuged at 5000rpm for 5min, and finally the supernatant was subjected to GC analysis. The GC analysis instrument was: agilent 7890 model a gas chromatograph, FID detector; a chromatographic column: HP-FFAP (30 m.times.0.25 mm.times.0.5 μm); the sample volume is 1 mu L; the split ratio is 30: 1; temperature programming: the initial temperature is 210 ℃, the temperature is kept for 8min, the temperature is increased to 240 ℃ at the rate of 20 ℃/min, the temperature is kept for 7min, a GC chromatogram is obtained, and data analysis is carried out. As a result, the linolenic acid content in the sn-2 position of triglyceride of the transgenic line is improved by 10 percent at most compared with the wild type. Wherein, the content of linolenic acid at BnLPAAT2-A7 and BnLPAAT2-C8sn-2 site is the highest, which is increased by 10 percent compared with the wild type; the linolenic acid contents of BnLPAAT2-C7 and BnLPAAT2-A9 are respectively increased by 4 percent and 5 percent compared with the wild type (figure 8). The above results confirm that BnLPAAT2 has linolenic acid preference at sn-2 position and ultimately increases linolenic acid content in grease.

It will be understood by those skilled in the art that the foregoing is only a preferred embodiment of the present invention, and is not intended to limit the invention, and that any modification, equivalent replacement, or improvement made within the spirit and principle of the present invention should be included in the scope of the present invention.

Sequence listing

<110> university of science and technology in Huazhong

Application of gene for promoting linolenic acid accumulation of plant seeds

<160>8

<170>SIPOSequenceListing 1.0

<210>1

<211>1173

<212>DNA

<213> Brassica napus (Brassica napus)

<400>1

atggcgatgg cagcagcagt gattgtgcct ttggggattc tcttcttcat ttctggcctc 60

gttgtcaatc tccttcaggc agtttgctat gtcctcgttc gacctctgtc taagaacaca 120

tacagaaaga tcaaccgggt ggttgcagaa accttgtggt tggagcttgt ctggatcgtt 180

gactggtggg ctggagtcaa gatccaagtc tttgctgatg atgagacctt taatcgaatg 240

ggcaaagaac atgctcttgt cgtttgtaat caccgaagtg atattgattg gctcgtggga 300

tggattctcg ctcagaggtc aggttgccta ggaagcgcat tagctgtgat gaagaagtct 360

tccaaatttc tcccagtcat aggctggtca atgtggttct ccgagtatct gtttcttgaa 420

agaaattggg caaaggatga aagcacttta aagtcaggtc ttcaacgctt gaacgacttc 480

ccacggcctt tctggctagc tctttttgtg gagggaaccc gcttcacaga ggcaaaactt 540

aaagcagcac aagagtacgc agcctcctct gagttgcctg tccctcgaaa tgtgttgatt 600

cctcgcacca aaggatttgt gtcagctgtt agtaacatgc gttcatttgt gccagccata 660

tatgatatga ccgtggctat tccaaaaact tctccacccc caacgatgct aagactattc 720

aaaggacaac cttctgtggt gcatgttcac atcaagtgtc actcgatgaa agacttgcct 780

gaatcagaag acgaaattgc acagtggtgc agagatcagt ttgtgactaa ggatgcactg 840

ttagacaaac acatagctgc agacactttc gccggtcaga aagaacagaa cattggccgt 900

cccataaagt ctcttgcagt ggttctgtca tgggcatgtc tactaactct tggagcaatg 960

aagttcttac actggtcaaa tctcttttcc tcgtggaaag gcatcgcatt atcagcgctt 1020

ggtctaggca tcatcactct ctgtatgcag atcttgatcc gctcctctca gtcggagcgt 1080

tcaacacctg ccaaagtcgc tccagccaag ccaaaggaca atcaccagtc aggaccatcc 1140

tcccaaacag aagtggagga gaagcagaag taa 1173

<210>2

<211>1176

<212>DNA

<213> Brassica napus (Brassica napus)

<400>2

atggcgatgg cagcagcagc agtgattgtg cctttgggga ttctcttctt catttctggc 60

ctcgttgtca atctccttca ggcagtttgc tatgtcctca ttcgacctct gtctaagaac 120

acatacagaa agatcaaccg tgtggttgca gaaaccttgt ggttggagct tgtctggatc 180

gttgactggt gggctggagt caagatccaa gtgtttgctg atgatgagac ctttaatcga 240

atgggcaaag agcatgctct tgtcgtttgt aatcaccgaa gtgatattga ttggctcgtg 300

ggatggattc tggctcagag gtcaggttgc ctaggaagcg cattagctgt gatgaagaag 360

tcttccaaat ttcttccagt cataggctgg tcaatgtggt tctcggagta tctctttctc 420

gaaagaaatt gggcaaagga tgaaagcact ttaaagtcag gtcttcaacg cttgaacgac 480

ttcccacggc ctttctggtt agcccttttt gtggagggaa cccgtttcac agaggcaaaa 540

cttaaagcag cacaagagta cgcagcctcc tctcagttgc ctgtccctcg aaatgtgttg 600

attcctcgca ccaaaggttt tgtgtcagct gttagtaaca tgcgttcatt tgtgccagcc 660

atatatgata tgaccgtggc tattccaaaa acttctccac ccccaacgat gctaagacta 720

ttcaaaggac aaccttctgt ggtgcatgtt cacatcaagt gtcactcgat gaaagacttg 780

cctgaatcag atgacgcaat tgcacagtgg tgcagagatc agtttgtggc taaggatgca 840

ctgttagaca aacacatagc tgcagacact ttccccggtc agaaagaaca caacattggc 900

cgtcccataa agtctcttgc agtggttgta tcatgggcat gcctactaac tcttggagca 960

atgaagttct tacactggtc aaatctcttt tcctcgttga aaggcatcgc attatcagcg 1020

cttggtctag gcatcatcac tctctgcatg cagatcttga tccgctcctc tcagtcggag 1080

cgttcaacac ctgccaaagt ggccccagcc aagccaaagg acaaacacca gtcaggatca 1140

tcctcccaaa cagaagtgga ggagaagcag aagtaa 1176

<210>3

<211>1173

<212>DNA

<213> Brassica napus (Brassica napus)

<400>3

atggcgatgg cagcagctgt gattgtgcct ctgggcattc tcttcttcat atctggtctc 60

gttgttaatc tccttcaggc gatttgttat gttcctattc gacctctgtc taagaacacg 120

tacagaaaaa tcaaccgggt ggttgctgaa accttgtggc ttgagcttgt ctggattgtt 180

gactggtggg ctggtgtaaa gatccaagtg tttgctgata atgagacctt caatcgaatg 240

ggcaaagaac atgctcttgt cgtttgtaat caccgaagtg atattgattg gcttgtggga 300

tggattctgg ctcagagatc aggttgcctg ggaagcgcat tggctgtaat gaagaagtct 360

tctaaatttc ttccagtcat aggctggtca atgtggttct cggagtatct gtttctggaa 420

agaaattggg caaaggatga aagcactcta aagtcaggtc ttcaacgctt gaacgacttc 480

cctagacctt tctggttagc actttttgtg gagggaaccc gctttacaga ggctaaactt 540

aaagcagcac aagagtacgc tgcctcctct gagctgcctg tccctcgaaa tgtgttgatt 600

cctcgcacca aaggttttgt gtcagctgtt agtaatatgc gttcatttgt cccagccatt 660

tatgatatga ccgtggctat tccaaaaaca tctccacccc caacgatgct cagactattc 720

aaaggacaac cttctgtggt gcatgttcac atcaagtgtc actcgacgaa agacttgcct 780

gaatcagatg acgcaattgc acagtggtgc agagatcagt ttgtggctaa ggatgcacta 840

ttagacaaac acatagctgc agacactttc cctggtcagc aagaacagaa cattggccgt 900

cccataaagt ctcttgcagt ggttctatca tggtcatgcc tactgattct tggagcaatg 960

aagttcttac actggtcaaa tctcttctcc tcatggaaag gcatcgcgtt ttcggcgctg 1020

ggtctaggca tcatcactct ctgtatgcag atcctgatcc gttcctctca gtcagagcgt 1080

tctaccccag ccaaagtcgt tccagccaag ccaaaagaca atcataacga ctcaggatca 1140

tcctcccaaa cagaagtaga gaagcagaag taa 1173

<210>4

<211>1173

<212>DNA

<213> Brassica napus (Brassica napus)

<400>4

atggcgatgg cagcagctgt gattgtgcct ctgggaattc tcttcttcat atctggtctc 60

gttgtcaatc tccttcaggc gatttgttat gttcttattc gacctctgtc taagaacacg 120

tacagaaaaa tcaaccgggt ggttgctgaa accttgtggc ttgagcttgt ctggattgtt 180

gactggtggg ctggtgtaaa gatccaagtg tttgctgata atgagacctt caatcgaatg 240

ggcaaagaac atgctcttgt cgtttgtaat caccgaagtg atattgattg gcttgtggga 300

tggattctgg ctcagagatc aggttgcctg ggaagcgcat tggctgtaat gaagaagtct 360

tctaaatttc ttccagtcat aggctggtca atgtggttct cggagtatct gtttctggaa 420

agaaattggg caaaggatga aagcactcta aagtcaggtc ttcaacgctt gaacgacttc 480

cctagacctt tctggttagc actttttgtg gagggaaccc gctttacaga ggctaaactt 540

aaagcagcac aagagtacgc tgcctcctct gagctgcctg tccctcgaaa tgtgttgatt 600

cctcgcacca aaggttttgt gtcagctgtt agtaatatgc gttcatttgt cccagccatt 660

tatgatatga ccgtggctat tccaaaaaca tctccacccc caacgatgct cagactattc 720

aaaggacaac cttctgtggt gcatgttcac atcaagtgtc actcgatgaa agacttgcct 780

gaatcagatg acgcaattgc acagtggtgc agagatcagt ttgtggctaa ggatgcacta 840

ttagacaaac acatagctgc agacactttc cctggtcagc aagaacagaa cattggccgt 900

cccataaagt ctcttgcagt ggttctatca tggtcatgcc tactgattct tggagcaatg 960

aagttcttac actggtcaaa tctcttctcc tcatggaaag gcatcgcgtt ttcggcgctg 1020

ggtctaggca tcatcactct ctgtatgcag atcctgatcc gttcctctca gtcagagcgt 1080

tctaccccag ccaaagtcgt tccagccaag ccaaaagaca atcataacga ctcaggatca 1140

tcctcccaaa cagaagtgga gaagcagaag taa 1173

<210>5

<211>390

<212>PRT

<213> Brassica napus (Brassica napus)

<400>5

Met Ala Met Ala Ala Ala Val Ile Val Pro Leu Gly Ile Leu Phe Phe

1 5 10 15

Ile Ser Gly Leu Val Val Asn Leu Leu Gln Ala Val Cys Tyr Val Leu

20 25 30

Val Arg Pro Leu Ser Lys Asn Thr Tyr Arg Lys Ile Asn Arg Val Val

35 40 45

Ala Glu Thr Leu Trp Leu Glu Leu Val Trp Ile Val Asp Trp Trp Ala

50 55 60

Gly Val Lys Ile Gln Val Phe Ala Asp Asp Glu Thr Phe Asn Arg Met

6570 75 80

Gly Lys Glu His Ala Leu Val Val Cys Asn His Arg Ser Asp Ile Asp

85 90 95

Trp Leu Val Gly Trp Ile Leu Ala Gln Arg Ser Gly Cys Leu Gly Ser

100 105 110

Ala Leu Ala Val Met Lys Lys Ser Ser Lys Phe Leu Pro Val Ile Gly

115 120 125

Trp Ser Met Trp Phe Ser Glu Tyr Leu Phe Leu Glu Arg Asn Trp Ala

130 135 140

Lys Asp Glu Ser Thr Leu Lys Ser Gly Leu Gln Arg Leu Asn Asp Phe

145 150 155 160

Pro Arg Pro Phe Trp Leu Ala Leu Phe Val Glu Gly Thr Arg Phe Thr

165 170 175

Glu Ala Lys Leu Lys Ala Ala Gln Glu Tyr Ala Ala Ser Ser Glu Leu

180 185 190

Pro Val Pro Arg Asn Val Leu Ile Pro Arg Thr Lys Gly Phe Val Ser

195 200 205

Ala Val Ser Asn Met Arg Ser Phe Val Pro Ala Ile Tyr Asp Met Thr

210 215 220

Val Ala Ile Pro Lys Thr Ser Pro Pro Pro Thr Met Leu Arg Leu Phe

225 230 235 240

Lys Gly Gln Pro Ser Val Val His Val His Ile Lys Cys His Ser Met

245 250 255

Lys Asp Leu Pro Glu Ser Glu Asp Glu Ile Ala Gln Trp Cys Arg Asp

260 265 270

Gln Phe Val Thr Lys Asp Ala Leu Leu Asp Lys His Ile Ala Ala Asp

275 280 285

Thr Phe Ala Gly Gln Lys Glu Gln Asn Ile Gly Arg Pro Ile Lys Ser

290 295 300

Leu Ala Val Val Leu Ser Trp Ala Cys Leu Leu Thr Leu Gly Ala Met

305 310 315 320

Lys Phe Leu His Trp Ser Asn Leu Phe Ser Ser Trp Lys Gly Ile Ala

325 330 335

Leu Ser Ala Leu Gly Leu Gly Ile Ile Thr Leu Cys Met Gln Ile Leu

340 345 350

Ile Arg Ser Ser Gln Ser Glu Arg Ser Thr Pro Ala Lys Val Ala Pro

355 360 365

Ala Lys Pro Lys Asp Asn His Gln Ser Gly Pro Ser Ser Gln Thr Glu

370 375 380

Val Glu Glu Lys Gln Lys

385 390

<210>6

<211>391

<212>PRT

<213> Brassica napus (Brassica napus)

<400>6

Met Ala Met Ala Ala Ala Ala Val Ile Val Pro Leu Gly Ile Leu Phe

1 5 10 15

Phe Ile Ser Gly Leu Val Val Asn Leu Leu Gln Ala Val Cys Tyr Val

20 25 30

Leu Ile Arg Pro Leu Ser Lys Asn Thr Tyr Arg Lys Ile Asn Arg Val

35 40 45

Val Ala Glu Thr Leu Trp Leu Glu Leu Val Trp Ile Val Asp Trp Trp

50 55 60

Ala Gly Val Lys Ile Gln Val Phe Ala Asp Asp Glu Thr Phe Asn Arg

65 70 75 80

Met Gly Lys Glu His Ala Leu Val Val Cys Asn His Arg Ser Asp Ile

85 90 95

Asp Trp Leu Val Gly Trp Ile Leu Ala Gln Arg Ser Gly Cys Leu Gly

100 105 110

Ser Ala Leu Ala Val Met Lys Lys Ser Ser Lys Phe Leu Pro Val Ile

115 120 125

Gly Trp Ser Met Trp Phe Ser Glu Tyr Leu Phe Leu Glu Arg Asn Trp

130 135 140

Ala Lys Asp Glu Ser Thr Leu Lys Ser Gly Leu Gln Arg Leu Asn Asp

145 150 155 160

Phe Pro Arg Pro Phe Trp Leu Ala Leu Phe Val Glu Gly Thr Arg Phe

165 170 175

Thr Glu Ala Lys Leu Lys Ala Ala Gln Glu Tyr Ala Ala Ser Ser Gln

180 185 190

Leu Pro Val Pro Arg Asn Val Leu Ile Pro Arg Thr Lys Gly Phe Val

195 200 205

Ser Ala Val Ser Asn Met Arg Ser Phe Val Pro Ala Ile Tyr Asp Met

210 215 220

Thr Val Ala Ile Pro Lys Thr Ser Pro Pro Pro Thr Met Leu Arg Leu

225 230 235 240

Phe Lys Gly Gln Pro Ser Val Val His Val His Ile Lys Cys His Ser

245 250 255

Met Lys Asp Leu Pro Glu Ser Asp Asp Ala Ile Ala Gln Trp Cys Arg

260 265 270

Asp Gln Phe Val Ala Lys Asp Ala Leu Leu Asp Lys His Ile Ala Ala

275 280 285

Asp Thr Phe Pro Gly Gln Lys Glu His Asn Ile Gly Arg Pro Ile Lys

290 295 300

Ser Leu Ala Val Val Val Ser Trp Ala Cys Leu Leu Thr Leu Gly Ala

305 310 315 320

Met Lys Phe Leu His Trp Ser Asn Leu Phe Ser Ser Leu Lys Gly Ile

325 330 335

Ala Leu Ser Ala Leu Gly Leu Gly Ile Ile Thr Leu Cys Met Gln Ile

340 345 350

Leu Ile Arg Ser Ser Gln Ser Glu Arg Ser Thr Pro Ala Lys Val Ala

355 360 365

Pro Ala Lys Pro Lys Asp Lys His Gln Ser Gly Ser Ser Ser Gln Thr

370 375 380

Glu Val Glu Glu Lys Gln Lys

385 390

<210>7

<211>390

<212>PRT

<213> Brassica napus (Brassica napus)

<400>7

Met Ala Met Ala Ala Ala Val Ile Val Pro Leu Gly Ile Leu Phe Phe

1 5 10 15

Ile Ser Gly Leu Val Val Asn Leu Leu Gln Ala Ile Cys Tyr Val Pro

20 25 30

Ile Arg Pro Leu Ser Lys Asn Thr Tyr Arg Lys Ile Asn Arg Val Val

35 40 45

Ala Glu Thr Leu Trp Leu Glu Leu Val Trp Ile Val Asp Trp Trp Ala

50 55 60

Gly Val Lys Ile Gln Val Phe Ala Asp Asn Glu Thr Phe Asn Arg Met

65 70 75 80

Gly Lys Glu His Ala Leu Val Val Cys Asn His Arg Ser Asp Ile Asp

85 90 95

Trp Leu Val Gly Trp Ile Leu Ala Gln Arg Ser Gly Cys Leu Gly Ser

100 105 110

Ala Leu Ala Val Met Lys Lys Ser Ser Lys Phe Leu Pro Val Ile Gly

115 120 125

Trp Ser Met Trp Phe Ser Glu Tyr Leu Phe Leu Glu Arg Asn Trp Ala

130 135 140

Lys Asp Glu Ser Thr Leu Lys Ser Gly Leu Gln Arg Leu Asn Asp Phe

145 150 155 160

Pro Arg Pro Phe Trp Leu Ala Leu Phe Val Glu Gly Thr Arg Phe Thr

165 170 175

Glu Ala Lys Leu Lys Ala Ala Gln Glu Tyr Ala Ala Ser Ser Glu Leu

180 185 190

Pro Val Pro Arg Asn Val Leu Ile Pro Arg Thr Lys Gly Phe Val Ser

195 200 205

Ala Val Ser Asn Met Arg Ser Phe Val Pro Ala Ile Tyr Asp Met Thr

210 215 220

Val Ala Ile Pro Lys Thr Ser Pro Pro Pro Thr Met Leu Arg Leu Phe

225 230 235 240

Lys Gly Gln Pro Ser Val Val His Val His Ile Lys Cys His Ser Thr

245 250 255

Lys Asp Leu Pro Glu Ser Asp Asp Ala Ile Ala Gln Trp Cys Arg Asp

260 265 270

Gln Phe Val Ala Lys Asp Ala Leu Leu Asp Lys His Ile Ala Ala Asp

275 280 285

Thr Phe Pro Gly Gln Gln Glu Gln Asn Ile Gly Arg Pro Ile Lys Ser

290 295 300

Leu Ala Val Val Leu Ser Trp Ser Cys Leu Leu Ile Leu Gly Ala Met

305 310 315 320

Lys Phe Leu His Trp Ser Asn Leu Phe Ser Ser Trp Lys Gly Ile Ala

325 330 335

Phe Ser Ala Leu Gly Leu Gly Ile IleThr Leu Cys Met Gln Ile Leu

340 345 350

Ile Arg Ser Ser Gln Ser Glu Arg Ser Thr Pro Ala Lys Val Val Pro

355 360 365

Ala Lys Pro Lys Asp Asn His Asn Asp Ser Gly Ser Ser Ser Gln Thr

370 375 380

Glu Val Glu Lys Gln Lys

385 390

<210>8

<211>390

<212>PRT

<213> Brassica napus (Brassica napus)

<400>8

Met Ala Met Ala Ala Ala Val Ile Val Pro Leu Gly Ile Leu Phe Phe

1 5 10 15

Ile Ser Gly Leu Val Val Asn Leu Leu Gln Ala Ile Cys Tyr Val Leu

20 25 30

Ile Arg Pro Leu Ser Lys Asn Thr Tyr Arg Lys Ile Asn Arg Val Val

35 40 45

Ala Glu Thr Leu Trp Leu Glu Leu Val Trp Ile Val Asp Trp Trp Ala

50 55 60

Gly Val Lys Ile Gln Val Phe Ala Asp Asn Glu Thr Phe Asn Arg Met

65 70 75 80

Gly Lys Glu His Ala Leu Val Val Cys Asn His Arg Ser Asp Ile Asp

85 90 95

Trp Leu Val Gly Trp Ile Leu Ala Gln Arg Ser Gly Cys Leu Gly Ser

100 105 110

Ala Leu Ala Val Met Lys Lys Ser Ser Lys Phe Leu Pro Val Ile Gly

115 120 125

Trp Ser Met Trp Phe Ser Glu Tyr Leu Phe Leu Glu Arg Asn Trp Ala

130 135 140

Lys Asp Glu Ser Thr Leu Lys Ser Gly Leu Gln Arg Leu Asn Asp Phe

145 150 155 160

Pro Arg Pro Phe Trp Leu Ala Leu Phe Val Glu Gly Thr Arg Phe Thr

165 170 175

Glu Ala Lys Leu Lys Ala Ala Gln Glu Tyr Ala Ala Ser Ser Glu Leu

180 185 190

Pro Val Pro Arg Asn Val Leu Ile Pro Arg Thr Lys Gly Phe Val Ser

195 200 205

Ala Val Ser Asn Met Arg Ser Phe Val Pro Ala Ile Tyr Asp Met Thr

210 215 220

Val Ala Ile Pro Lys Thr Ser Pro Pro Pro Thr Met Leu Arg Leu Phe

225 230235 240

Lys Gly Gln Pro Ser Val Val His Val His Ile Lys Cys His Ser Met

245 250 255

Lys Asp Leu Pro Glu Ser Asp Asp Ala Ile Ala Gln Trp Cys Arg Asp

260 265 270

Gln Phe Val Ala Lys Asp Ala Leu Leu Asp Lys His Ile Ala Ala Asp

275 280 285

Thr Phe Pro Gly Gln Gln Glu Gln Asn Ile Gly Arg Pro Ile Lys Ser

290 295 300

Leu Ala Val Val Leu Ser Trp Ser Cys Leu Leu Ile Leu Gly Ala Met

305 310 315 320

Lys Phe Leu His Trp Ser Asn Leu Phe Ser Ser Trp Lys Gly Ile Ala

325 330 335

Phe Ser Ala Leu Gly Leu Gly Ile Ile Thr Leu Cys Met Gln Ile Leu

340 345 350

Ile Arg Ser Ser Gln Ser Glu Arg Ser Thr Pro Ala Lys Val Val Pro

355 360 365

Ala Lys Pro Lys Asp Asn His Asn Asp Ser Gly Ser Ser Ser Gln Thr

370 375 380

Glu Val Glu Lys Gln Lys

385 390

Claims (6)

1. The application of the gene fragment in promoting accumulation of linolenic acid in plant seeds is characterized in that the gene fragment has a nucleotide sequence shown as any one of SEQ ID No. 1-SEQ ID No.4 or a complementary sequence thereof, can preferentially accumulate linolenic acid at the sn-2 position of triglyceride and improve the linolenic acid content of the plant seeds.

2. The application of the protein in promoting the accumulation of the linolenic acid in the plant seeds is characterized in that the protein has an amino acid sequence shown as any one of SEQ ID No. 5-SEQ ID No.8, can preferentially accumulate the linolenic acid at the sn-2 position of triglyceride and improves the linolenic acid content in the plant seeds.

3. The application of a recombinant vector in breeding improvement to promote the accumulation of linolenic acid in plant seeds is characterized in that the recombinant vector comprises a gene fragment, wherein the gene fragment has a nucleotide sequence shown as any one of SEQ ID No. 1-SEQ ID No.4 or a complementary sequence thereof, can preferentially accumulate linolenic acid at the sn-2 position of triglyceride and improve the linolenic acid content in the plant seeds.

4. The application of a recombinant strain in breeding improvement to promote the accumulation of linolenic acid in plant seeds is characterized in that the recombinant strain comprises a gene fragment, wherein the gene fragment has a nucleotide sequence shown as any one of SEQ ID No. 1-SEQ ID No.4 or a complementary sequence thereof, can preferentially accumulate linolenic acid at the sn-2 position of triglyceride and improve the linolenic acid content in the plant seeds.

5. The use of any one of claims 1 to 4, wherein the plant comprises a monocotyledonous or dicotyledonous plant.

6. The use according to claim 5, wherein the plant is any one of Arabidopsis thaliana, oilseed rape, peanut, soybean, camellia oleifera, jatropha curcas, palm, corn, rice, wheat, sesame, sunflower, olive.

Images