CN108795898A - A kind of application of the gene of promotion vegetable seeds flax acid accumulation - Google Patents

Abstract

The invention discloses a kind of applications of the gene of promotion vegetable seeds flax acid accumulation, the genetic fragment has nucleotide sequence or its complementary series as shown in any one of SEQ ID No.1~SEQ ID No.4, or since increase, missing or replace caused by one or more nucleotide is not less than 95% and the identical derivatized nucleotide sequence of function with nucleotide sequence homology shown in any one of SEQ ID No.1~SEQ ID No.4.Present invention firstly discovers that cabbage type rape lysophosphatidate acyltransferase gene BnLPAAT2 its promote the function and purposes of vegetable seeds flax acid accumulation; by introducing the genetic fragment with specific nucleotide sequence and the protein with specific amino acid sequence, vegetable seeds flax acid accumulation can be effectively facilitated.The BnLPAAT2 genes cloned in the present invention not only significantly improve linolenic acid content in overexpressing strain seed, and there has also been the raisings of certain amplitude for seed oil content.

Description

A kind of application of the gene of promotion vegetable seeds flax acid accumulation

Technical field

The invention belongs to plant genetic engineering fields, more particularly, to a kind of promotion vegetable seeds flax acid accumulation The application of gene.The present invention is specifically to use molecular biology method, and energy is isolated from the developmental seed of cabbage type rape Preference catalysis leukotrienes is esterified gene BnLPAAT2 (the Brassica napus Lysophosphatidic to form phosphatidic acid Acid Acyltransferase 2), it encodes an acyltransferase.By in arabidopsis overexpression analyze, it was demonstrated that BnLPAAT2 is catalyzed leukotrienes has Preference during the esterification of triglycerides sn-2, finally improves flax in seed Acid content and oil content.

Background technology

In higher plant, grease mainly exists in the form of triglycerides, and triglycerides is mainly by glycerol backbone and three A aliphatic acid is connected and composed by ester bond.In common oil crops, aliphatic acid in triglycerides then mainly by palmitic acid, Stearic acid, oleic acid, linoleic acid and a small amount of leukotrienes composition.Wherein, linoleic acid plus linolenic acid is the fat that human body itself cannot synthesize Fat acid has to that from external source intake organism metabolism needs could be met, therefore is referred to as essential fatty acid.World health group It knits and just appealed that special supplement essential fatty acid especially omega-fatty acid was taken in 1993 with FAO (Food and Agriculture Organization of the United Nation).Therefore, Essential fatty acid must be added in the numerous and confused legislation demands edible oil in various countries, to ensure national basic nutrition intake safety.However, mesh Linolenic acid content is relatively low in preceding main oil crops grease, cannot be satisfied intake needs of the human body to unsaturated fatty acid.Cause This, improves the much-talked-about topic that oil crops fatty acid quality is current.

The final Synthetic Oil of esterification of aliphatic acid is to be carried out in endoplasmic reticulum by Kennedy approach：It is in this process Acyl coenzyme A is sloughed acyl group in sn-1 carbon potential catalysis as skeleton using glycerol-3-phosphate in glycerol 3-phosphate acyltransferase and is obtained To lysophosphatidic acid (Lysophosphatic acid, LPA) (Jain, R K, Coffey, M and Lai, K, et al., 2000), then by lysophosphatidate acyltransferase (Lysophosphatidyl acyltransferase, LPAAT) in sn- 2 it is bit esterified catalysis form phosphatidic acid (Phosphatidic acid, PA), after again by phosphatidic acid phosphorylase, Diacrylglycerol acyl Transfer catalysis deacylation base synthesizes triacylglyceride.Lysophosphatidate acyltransferase (Lysophosphatidyl Acyltransferase, LPAAT) be control lysophosphatidic acid generate phosphatidic acid key enzyme (Liang, M and Jiang, J, 2013).Currently, the lysophospholipid acyltransferase of multiple species is cloned out, including saccharomyces cerevisiae, bay, quasi- south A variety of biologies such as mustard, rape, flax, cocoa, peanut, pond flower plant.In terms of improving oil synthesis and improving oil-containing quantity research, It was found that LPAAT can improve oil synthesis.Overexpression ScLPAAT improves oil content up to 6.84% to 8.55% in rape (Liu,F,Xia,Y and Wu,L,et al.,2015).By the LPAAT genes BAT1.5 cloned from cabbage type rape, BAT1.12, BAT1.13 are transferred to arabidopsis expression, obtained filial generation seed Average oil concentration improve 11% (Maisonneuve, S,Bessoule,J J and Lessire,R,et al.,2010).The LPAAT genes cloned in yeast are transferred to quasi- south Mustard and cabbage type rape, obtained transgenic progeny seed oil content improve 21%-26% (Zou, J, Katavic, V and Giblin,E M,et al.,1997)。

Why LPAAT genes have attracted the sight of numerous scholars to be primarily due to LPAAT gene pairs not common fatty acids Abundant substrate Preference is shown, promotion work can be played to producing non-common fatty acids (Unusual Fatty Acid) With.Therefore, in biomass based production various in nature, the LPAAT bases with industry, field of food application value are excavated Cause is of great significance and bright prospects.Report confirmation, LPAAT pairs 16 of arabidopsis plastid type:0 Preference is more than to 18:0 Preference (Bourgis, F, Kader, J C and Barret, P, et al., 1999).Clone the endosperm of cocoa immature seed In be cloned into LPAAT, find the gene pairs medium chain fatty acid have substrate Preference (Laurent, P and Huang, A H, 1992；Davies,H M,Hawkins,D J and Nelsen,J S,1995；Knutzon,D S,Lardizabal,K D and Nelsen,J S,et al.,1995；Cao,Y Z,Oo,K C and Huang,A H,1990).It is developmental in flax It is cloned into seed with the active genes of LPAAT, further functional verification finds the gene encoding production pair 18:2 have Preference (Sorensen, B M, Furukawa-Stoffer, T L and Marshall, K S, et al., 2005).? It is cloned into the gene of coding LPAAT in Limnanthes douglasii, which is transferred to Escherichia coli JC201 saltant type bacterium Strain finds that LPAAT has erucic acid Preference (Brown, A P, Brough, C L and Kroon, J T M, et al., 1995). MeadowfoamLPAAT genes are transferred to cabbage type rape, content of erucic acid is significantly improved in transgenic progeny seed (Lassner,M W,Levering,C K and Davies,H M,et al.,1995).The LPAAT cloned in saccharomyces cerevisiae There is substrate Preference (Jain, S, Stanford, N and Bhagwat, N, et al., 2007) to unsaturated fatty acid.? It is found that particle build LPAAT has erucic acid Preference in turnip type rape, this is also to be sent out for the first time in Cruciferae for the first time Existing long-chain unsaturated fatty acid Preference (Taylor, D C, Barton, D L and Giblin, E M, et al., 1995).? LPAAT genes are cloned into the developmental seed of peanut, the verification of substrate Preference finds that the gene also has substrate Preference (Shekar,S,Tumaney,A W and Rao,T J V S,et al.,2002).The LPAAT in cocoa source and WRI1 is turned The record factor co-expresses in tobacco, the results showed that, the LPAAT in cocoa source has strong medium chain fatty acid Preference, in cigarette Detected in blade of grass piece excess medium chain fatty acid accumulation (Knutzon, D S, Lardizabal, K D, Nelsen, J S, Bleibaum,J L,Davies,H M and Metz,J G,1995；Reynolds,K B,Taylor,M C and Zhou,X, et al.,2015).Yeast SLC1 is carried out to Preference detection in vitro and finds that SLC1 is to oleic acid and 14:0 has Preference (Shui,G,Guan,X L and Gopalakrishnan,P,et al.,2010).In algae, different plant species can be sent out Existing LPAAT shows the substrate Preference of larger difference, such as 16:0,18:0,18:1 equal (Okazaki, K, 2006).In summary Research contents, although above-mentioned LPAAT genes can show substrate Preference in vitro experiment, overexpression LPAAT is not It is improved ratio and content of the desired fatty acid in grease.Think, overexpression LPAAT genes do not cause special fat The synthesis of fat acid is accelerated, and the effect of LPAAT is only to play the role of preference accumulation in aliphatic acid Esterification Stage.Asia in grease In terms of numb acid content depends on linolenic synthesis (such as fatty acid dehydrogenase) and accumulation (such as acyltransferase) two.Therefore, it seeks Looking for there is the acyltransferase of Preference accumulation to be of great significance leukotrienes.A few studies report overexpression LPAAT is improved Percentage composition but total oil content amount of the desired fatty acid in triglycerides declines, and the total amount of final goal aliphatic acid is not bright It is aobvious to improve.

Invention content

For the disadvantages described above or Improvement requirement of the prior art, the purpose of the present invention is to provide a kind of promotion vegetable seeds The application of the gene of flax acid accumulation, present invention firstly discovers that cabbage type rape lysophosphatidate acyltransferase gene (vegetable seeds flax can be improved to the function and purposes of its promotion vegetable seeds flax acid accumulation of BnLPAAT2 by being found that for the first time The acyl transferase gene of acid accumulation), by genetic fragment of the introducing with specific nucleotide sequence and with specific amino acids The protein of sequence can effectively facilitate vegetable seeds flax acid accumulation.The BnLPAAT2 genes cloned in the present invention not only exist Linolenic acid content is significantly improved in overexpression strain seed, and there has also been the raisings of certain amplitude for seed oil content；Further Research confirms that overexpression BnLPAAT genes improve on the positions seed triglycerides sn-2 linolenic acid content up to 10%.This is current It was found that only one can improve flax acid accumulation but also improve the acyl transferase gene of oil content, to genetic engineering improve Oil crops quality is significant.

To achieve the above object, according to one aspect of the present invention, it provides a kind of genetic fragment and is promoting vegetable seeds Application in flax acid accumulation, which is characterized in that the genetic fragment has as SEQ ID No.1~SEQ ID No.4 are any one Nucleotide sequence shown in item or its complementary series, or due to increase, missing or replace caused by one or more nucleotide With nucleotide sequence homology shown in any one of SEQ ID No.1~SEQ ID No.4 is not less than 95% and function is identical Derivatized nucleotide sequence.

It is another aspect of this invention to provide that the present invention provides a kind of protein in promoting vegetable seeds flax acid accumulation Application, which is characterized in that the protein has the amino acid as shown in any one of SEQ ID No.5~SEQ ID No.8 Sequence, or due to increase, missing or replace caused by one or more amino acid with SEQ ID No.5~SEQ ID No.8 Amino acid sequence shown in any one has same active derived protein.

Another aspect according to the invention, the present invention provides a kind of recombinant vector in breeding improvement to promote vegetable seeds Application in flax acid accumulation, which is characterized in that the recombinant vector includes genetic fragment, and the genetic fragment has such as SEQ ID Nucleotide sequence or its complementary series shown in any one of No.1~SEQ ID No.4, or due to increase, missing or replacement Caused by one or more nucleotide with nucleotide sequences homologous shown in any one of SEQ ID No.1~SEQ ID No.4 Property be not less than 95% and the identical derivatized nucleotide sequence of function.

It is another aspect of this invention to provide that the present invention provides a kind of recombinant bacterial strain in breeding improvement to promote vegetable seeds Application in flax acid accumulation, which is characterized in that the recombinant bacterial strain includes genetic fragment, and the genetic fragment has such as SEQ ID Nucleotide sequence or its complementary series shown in any one of No.1~SEQ ID No.4, or due to increase, missing or replacement Caused by one or more nucleotide with nucleotide sequences homologous shown in any one of SEQ ID No.1~SEQ ID No.4 Property be not less than 95% and the identical derivatized nucleotide sequence of function.

As present invention further optimization, the plant includes monocotyledon or dicotyledon, preferably quasi- south It is any one in mustard, rape, peanut, soybean, oil tea, manioca, palm, corn, rice, wheat, sesame, sunflower, olive Kind.

Contemplated above technical scheme through the invention, compared with prior art, the present invention are molten using cabbage type rape Four of serium inorganic phosphorus resin acid acyl transferase gene BnLPAAT2 copy nucleotide sequences (such as such as SEQ ID No.1~SEQ ID Nucleotide sequence shown in No.4) and four of cabbage type rape lysophosphatidate acyltransferase gene BnLPAAT2 copies Amino acid sequence (such as amino acid sequence as shown in SEQ ID No.5~SEQ ID No.8), cabbage type rape lysophosphatide Sour acyl transferase gene (such as the BnLPAAT2 genes with above-mentioned nucleotide sequence, amino acid sequence) is with sn-2 Asias Numb acid Preference, is provided simultaneously with the dual function for improving seed flax acid content and seed oil content.BnLPAAT2 genes are dividing Sub- breeding, genetically modified plants oil component improvement field have wide practical use, and are used especially for changing vegetable seeds fat Acid content and component ratio provide the method for changing vegetable seeds content of fatty acid and component ratio.

The present invention passes through homologous gene conserved regions design primer gram using the developmental seed cDNA of cabbage type rape as template Grand four homologous copies genes for having obtained cabbage type rape lysophosphatidate acyltransferase BnLPAAT2 genes are according to place Chromosome location be respectively designated as BnLPAAT2-A7, BnLPAAT2-C7, BnLPAAT2-C7, BnLPAAT2-A9, they Gene reading frame length is respectively 1173bp, 1176bp, 1173bp and 1173bp, is separately encoded 390,391,390 and 390 ammonia Base acid residue.Nucleotide sequence similarity is high between four copy genes, and homology is between 95%-99%.With other species LPAAT2 sequences are compared, by taking BnLPAAT2-A7 amino acid sequences as an example, amino acid sequence and arabidopsis, shepherd's purse indigo plant, manioca, The corresponding LPAAT2 sequence similarities of soybean, oil tea, peanut are up to 92%, 91%, 81%, 78%, 76%, 75%.BnLPAAT2- A7, BnLPAAT2-C7, BnLPAAT2-C8, BnLPAAT2-A9 nucleotides sequence are listed in Genbank numbers KX279816.1,NM_001316026.1,KX279817.1,KX279818.1.BnLPAAT2 genes are being transferred to mould by the present invention Overexpression authentication function finds that in transgenic line seed fat acid constituents, linolenic acid content is notable in formula plant Arabidopsis thaliana It improves and oil content also has small size raising.It is found in the triglycerides of BnLPAAT2 transgenic line seeds, glycerol backbone sn- 2 upper linolenic acid content raisings reach 10%, hence it was demonstrated that BnLPAAT2 has leukotrienes preference in aliphatic acid cumulative process Property.

Particularly, compared with prior art, beneficial effects of the present invention are as follows：

(1) present invention is separated to lysophosphatidate acyltransferase gene from the developmental seed of cabbage type rape Four copies of BnLPAAT confirm that BnLPAAT2 can be inclined in the positions sn-2 of triglycerides by transformation mode plant Arabidopsis thaliana Good property accumulates leukotrienes, and the oil content of genetically modified plants can also be improved while improving vegetable seeds linolenic acid content.

Improving linolenic gene mainly has FAD3, the fatty acid dehydrogenases such as FAD8 (being flax acid enzyme), these enzymes It is known in the industry at present, and the present invention is then using with specific nucleotide sequence (especially such as SEQ ID No.1~SEQ ID Nucleotide sequence shown in any one of No.4) acyl transferase gene, obtain acyltransferase (corresponding flax acid accumulation base Cause) be the promotion flax acid accumulation found for the first time in acyltransferase enzyme, that is, the enzyme in accumulation approach, energy in accumulation approach It is unexistent in the prior art to improve leukotrienes and the report of oil content simultaneously.

(2) BnLPAAT2 genes are transferred to the weight such as rice, corn and soybean, rape, oil tea, sesame, sunflower and olive It wants in crops, it is possible to change and regulate and control the fatty acid synthesis pathway of these plants, reach the improvement mesh to yield and quality , the oil plant germplasm containing the fatty acid composition for being more advantageous to health is obtained, there is weight to the genetic breeding of oilseed plant Big meaning.

The BnLPAAT2 genes cloned in the present invention not only significantly improve linolenic acid content in overexpressing strain seed, and And there has also been the raisings of certain amplitude for seed oil content；Further research confirms, it is sweet that overexpression BnLPAAT genes improve seed Linolenic acid content is up to 10% on oily three positions ester sn-2.This, which is presently found only one, can improve flax acid accumulation but also carry The gene of floorboard with high oil content, it is significant to genetic engineering improvement oil crops quality.Application process in the present invention can carry High linolenic accumulates and total oil content amount；Using the present invention can improve plant (including monocotyledon, dicotyledon, especially It is arabidopsis, rape, peanut, soybean, oil tea, manioca, palm, corn, rice, wheat, sesame, sunflower, olive) seed Content of fatty acid and composition, at the same can also breeding improvement (such as have the genetically modified plants etc. of BnLPAAT2 genes by conversion Mode), obtain have compared with high linolenic content genetically modified plants.

Description of the drawings

Fig. 1 is using the developmental seed cDNA of cabbage type rape as template amplification BnLPAAT2 gene agarose gel electrophoresis Figure.M：Marker III, 1：BnLPAAT2 genes (BnLPAAT2-A7, BnLPAAT2-C7, BnLPAAT2-C8, BnLPAAT2- A9 gene compounds).

Fig. 2 is pBinGlyRed3-BnLPAAT2s series vegetable seed specific expression carrier structure schematic diagrames, in LB to RB Between, be disposed with Glycinin-promoter (glycinin Seeds oil-body-specific promoter), Bn-LPAAT2s, Gly-term (glycinin terminator), CVMV promotor, DsRed3, NOS term.

Fig. 3 is BnLPAAT2 series overexpression strain seed oil content figure, wherein

A be BnLPAAT2-A7 overexpress strain oil-containing spirogram, correspond to respectively from left to right BnLPAAT2-A7-10-12, BnLPAAT2-A7-30-9、BnLPAAT2-A7-1-4、BnLPAAT2-A7-34-35、BnLPAAT2-A7-39-5、Red0-53、 Red3-30-9, Red3-53-7, WT-1, WT-2, WT-3, mean of BnLPAAT2-A7 OE, mean of control, Middle BnLPAAT2-A7-10-12, BnLPAAT2-A7-30-9, BnLPAAT2-A7-1-4, BnLPAAT2-A7-34-35, BnLPAAT2-A7-39-5 corresponds to transgenic line；

B be BnLPAAT2-C7 overexpress strain oil-containing spirogram, from left to right respectively BnLPAAT2-C7-3-21, BnLPAAT2-C7-13-21、BnLPAAT2-C7-14-1、BnLPAAT2-C7-3-26、BnLPAAT2-C7-8-18、Red0-53、 Red3-30-9, Red3-53-7, WT-1, WT-2, WT-3, mean of BnLPAAT2-C7 OE, mean of control, Middle BnLPAAT2-C7-3-21, BnLPAAT2-C7-13-21, BnLPAAT2-C7-14-1, BnLPAAT2-C7-3-26, BnLPAAT2-C7-8-18 corresponds to BnLPAAT2-C7 transgenic lines；

C be BnLPAAT2-C8 overexpress strain oil-containing spirogram, from left to right respectively BnLPAAT2-C8-10-1, BnLPAAT2-C8-1-12、BnLPAAT2-C8-2-23、BnLPAAT2-C8-6-18、BnLPAAT2-C8-9-6、Red0-12-7、 Red0-53, Red3-30-9, WT-1, WT-2, WT-3, mean of BnLPAAT2-C8 OE, mean of control, wherein BnLPAAT2-C8-10-1, BnLPAAT2-C8-1-12, BnLPAAT2-C8-2-23, BnLPAAT2-C8-6-18, BnLPAAT2- C8-9-6 is BnLPAAT2-C8 transgenic lines；

D be BnLPAAT2-A9 overexpress strain oil-containing spirogram, from left to right respectively BnLPAAT2-A9-95-6, BnLPAAT2-A9-27-13、BnLPAAT2-A9-44-17、BnLPAAT2-A9-48-2、BnLPAAT2-A9-99-26、Red0- 53, Red3-30-9, Red3-53-7, WT-1, WT-2, WT-3, mean of BnLPAAT2-A9 OE, mean of control, Wherein BnLPAAT2-A9-95-6, BnLPAAT2-A9-27-13, BnLPAAT2-A9-44-17, BnLPAAT2-A9-48-2, BnLPAAT2-A9-99-26 is transgenic line；

Mean of control are control cell mean；By taking BnLPAAT2-A9 as an example, mean of BnLPAAT2-A9 OE is BnLPAAT2-A9 transgenic line average values；DW is dry seed weight；﹡ represents significant difference (P<0.05, n=5).

Fig. 4 is BnLPAAT2-A7 transgenic line Fatty Acids in Seeds change of component figures, for palmitic acid (C16:0), stearic Acid (C18:0), oleic acid (C18:1), linoleic acid (C18:2), leukotrienes (C18:3), 20 carbonic acid (C20:0), 20 carbon, one alkene Acid (C20:1), eicosadienoic acid (C20:2), erucic acid (C22:1) any one in, from left to right respectively BnLPAAT2- A7-10-12、BnLPAAT2-A7-30-9、BnLPAAT2-A7-1-4、BnLPAAT2-A7-34-35、BnLPAAT2-A7-39-5、 mean of BnLPAAT2-A7 OE,mean of control；Wherein, mean of control are control cell mean； Mean of BnLPAAT2-A7 OE are BnLPAAT2-A7 transgenic line average values；The poles ﹡ ﹡ significant difference (P<0.01, n= 5)。

Fig. 5 is BnLPAAT2-C7 transgenic line Fatty Acids in Seeds change of component figures, for palmitic acid (C16:0), stearic Acid (C18:0), oleic acid (C18:1), linoleic acid (C18:2), leukotrienes (C18:3), 20 carbonic acid (C20:0), 20 carbon, one alkene Acid (C20:1), eicosadienoic acid (C20:2), erucic acid (C22:1) any one in, from left to right respectively BnLPAAT2- C7-3-21、BnLPAAT2-C7-13-21、BnLPAAT2-C7-14-1、BnLPAAT2-C7-3-26、BnLPAAT2-C7-8-18、 mean of BnLPAAT2-C7 OE,mean of control；Wherein, mean of control are control cell mean； Mean of BnLPAAT2-C7 OE are BnLPAAT2-C7 transgenic line average values；The poles ﹡ ﹡ significant difference (P<0.01, n= 5)。

Fig. 6 is BnLPAAT2-C8 transgenic line Fatty Acids in Seeds change of component figures, for palmitic acid (C16:0), stearic Acid (C18:0), oleic acid (C18:1), linoleic acid (C18:2), leukotrienes (C18:3), 20 carbonic acid (C20:0), 20 carbon, one alkene Acid (C20:1), eicosadienoic acid (C20:2), erucic acid (C22:1) any one in, from left to right respectively BnLPAAT2- C8-10-1、BnLPAAT2-C8-1-12、BnLPAAT2-C8-2-23、BnLPAAT2-C8-6-18、BnLPAAT2-C8-9-6、 mean of BnLPAAT2-C8 OE,mean of control；Wherein, mean of control are control cell mean； Mean of BnLPAAT2-C8 OE are BnLPAAT2-C8 transgenic line average values；The poles ﹡ ﹡ significant difference (P<0.01, n= 5)。

Fig. 7 is BnLPAAT2-A9 transgenic line Fatty Acids in Seeds change of component figures, for palmitic acid (C16:0), stearic Acid (C18:0), oleic acid (C18:1), linoleic acid (C18:2), leukotrienes (C18:3), 20 carbonic acid (C20:0), 20 carbon, one alkene Acid (C20:1), eicosadienoic acid (C20:2), erucic acid (C22:1) any one in, from left to right respectively BnLPAAT2- A9-95-6、BnLPAAT2-A9-27-13、BnLPAAT2-A9-44-17、BnLPAAT2-A9-48-2、BnLPAAT2-A9-99- 26,mean of BnLPAAT2-A9 OE,mean of control；Wherein, mean of control are control cell mean； Mean of BnLPAAT2-A9 OE are BnLPAAT2-A9 transgenic line average values；The poles ﹡ ﹡ significant difference (P<0.01, n= 5)。

Fig. 8 is that BnLPAAT2 respectively copies sn-2 fatty acid component variation diagrams of transgenic line seed triglycerides, for Palmitic acid (C16:0), stearic acid (C18:0), oleic acid (C18:1), linoleic acid (C18:2), leukotrienes (C18:3), 20 carbonic acid (C20:0), 20 carbon monoenoic acid (C20:1), eicosadienoic acid (C20:2), erucic acid (C22:1) any one in, from left It is respectively WT, BnLPAAT2-C8 OE, BnLPAAT2-C7 OE, BnLPAAT2-A7 OE, BnLPAAT2-A9 OE to the right；Its In, WT, BnLPAAT2-C8 OE, BnLPAAT2-C7 OE, BnLPAAT2-A7 OE, BnLPAAT2-A9 OE respectively represents wild Type, BnLPAAT2-C8 overexpress strain mean value, and BnLPAAT2-C7 overexpresses strain mean value, and BnLPAAT2-A7 overexpresses strain Mean value, BnLPAAT2-A9 overexpress strain mean value；The poles ﹡ ﹡ significant difference (P<0.01, n=5).

Specific implementation mode

In order to make the purpose , technical scheme and advantage of the present invention be clearer, with reference to the accompanying drawings and embodiments, right The present invention is further elaborated.It should be appreciated that the specific embodiments described herein are merely illustrative of the present invention, and It is not used in the restriction present invention.As long as in addition, technical characteristic involved in the various embodiments of the present invention described below It does not constitute a conflict with each other and can be combined with each other.

Embodiment 1：

The clone of cabbage type rape BnLPAAT2 genes

(1) the developmental seed RNA extractions of cabbage type rape

It is no RNA enzyme pollution to operate the pipette tips being related to, centrifuge tube and solution below, and gloves are worn in operation.

(1) preparation of extracting solution：500 μ l RL lysates are taken, 5 μ l beta -mercaptoethanols and mixing is then added.

(2) homogenized：Developmental seed is taken to remove fruit pod in liquid nitrogen, 500 μ l are added in rapid grind into powder RL lysates, be vortexed acutely concussion mixing.12000rpm centrifuges 5min, draws supernatant.

(3) all solution are transferred on Filter column CS, 12000rpm centrifuges 2min, the careful supernatant drawn in collecting pipe Into the centrifuge tube of new RNase-Free, suction nozzle avoids contact with the pellet cell debris in collecting pipe as possible.

(4) absolute ethyl alcohol that 0.5 times of supernatant volume is added into centrifuge tube mixes well, and is then transferred to adsorption column CR3 In, 12000rpm centrifuges 1min, outwells the waste liquid in collecting pipe, adsorption column CR3 is put back in collecting pipe.

(5) 350 μ l protein liquid removals RW1,12000rpm centrifugation 1min are added into adsorption column CR3, outwell in collecting pipe Waste liquid puts back to adsorption column CR3 in collecting pipe.

(6) the DNase I digestive juices of 80 μ l are added to the centers adsorption column CR3,15min are placed at room temperature for, to digest DNA.

(7) 350 μ l protein liquid removals RW1,12000rpm centrifugation 1min are added into adsorption column CR3, outwell in collecting pipe Waste liquid puts back to adsorption column CR3 in collecting pipe.

(8) 500 μ l rinsing liquid RW are added into adsorption column CR3, are stored at room temperature 2min, 12000rpm centrifuges 1min, outwells Waste liquid in collecting pipe puts back to adsorption column CR3 in collecting pipe.It is primary to repeat step 8.

(9) 12000rpm centrifuges 2min, outwells waste liquid.Adsorption column CR3 is placed in and is placed at room temperature for several minutes, thoroughly to dry Remaining rinsing liquid in sorbing material.

(10) adsorption column CR3 is put into a new RNase-Free centrifuge tube, the intermediate position to adsorbed film is hanging 50 μ l RNase-Free water are added dropwise, are placed at room temperature for 2min, 12000rpm centrifuges 2min, obtains RNA solution.Measure RNA concentration and The ratio of OD values 260 to 280, if ratio is between 1.8-2.0, then it is assumed that RNA mass is available be placed in it is standby in -70 DEG C of refrigerators With, but should not place more than one week.

(2) synthesis of the reverse transcription cDNA chains of total serum IgE

Company ReverTra Ace- α-reverse transcription reagent box is spun using Japan.

(1) thermal denaturation of RNA：10 μ l, Oligo (dT) (10pmol/ μ l) 2 μ of RNA (1 μ g/ μ l) are sequentially added on ice chest 12 μ l of l, DEPC water, gently mixing, centrifuges in palm centrifuge to remove the residual night on tube wall, 65 DEG C of reactions in metal bath 5min simultaneously sets ice immediately.This step is optional, for destroying RNA three-levels or secondary structure, chain is made to open.

(2) reaction solution is prepared：5 × Reaction Buffer, 8 μ l, RNase Inhibitor are sequentially added on ice 4 μ l, ReverTra Ace- α -2 μ l reaction solutions of (10U/ μ l) 2 μ l, dNTPs Mixture (10mM) totally 40 μ l systems, are gently mixed Program 42 DEG C of reactions 1h, 85 DEG C of thermal denaturation 10min are set to terminate reaction in metal bath after even.After reaction, it negates and answers Product preserves for use in -20 DEG C of refrigerators.

(3) PCR amplification and sequencing of full length gene and code area

Design of primers reference sequences are essentially from rapeseed gene group database and nearly edge parent Chinese cabbage and wild cabbage.According to gene The sequence information design specific primer predicted in group database is expanded.

Complete gene order has 4 to be located at tetra- chromosomes of A7, A9, C7, C8 to LPAAT2 genes in the database On.Wherein, BnLPAAT2-A7, BnLPAAT2-C7, BnLPAAT2-C8, BnLPAAT2-A9 nucleotides sequence are listed in Genbank volumes Number be respectively KX279816.1, NM_001316026.1, KX279817.1, KX279818.1.Due to four both ends sequence ORF sequences It arranges identical, therefore designs same primer and be named as LPAAT2-F/R (LPAAT2-F：ATGGCGATGGCAGCAGCAGTGA, LPAAT2-R：TTACTTCTGCTTCTCCTCCACTTCTGTTTGG)；10 × PCR Buffer, 2 μ l are sequentially added on ice, 25mM MgSO₄22 μ l, LPAAT sense primer (25 μM) of μ l, dNTP (2.5mM), 0.3 μ l, LPAAT downstream primer (25 μM) 0.3 μ l, cDNA (200ng/ μ l) 1 μ l, KOD plus (1U/ μ l) 1 μ l, ddH₂O11.8 μ l, 20 μ l of total volume.

Response procedures are as follows：

94 DEG C of pre-degeneration 3min, 94 DEG C of denaturation 30s, 60 DEG C of annealing 30s, 68 DEG C of extension 40s-1min, 68 DEG C re-extend 10min, totally 30 recycle.

After the completion of amplification, by amplified production into row agarose gel electrophoresis, electrophoresis checks purpose in the UV lamp after the completion Band (Fig. 1).Purpose band is cut with blade and is transferred in centrifuge tube, DNA pieces are recycled using agarose gel QIAquick Gel Extraction Kit Section simultaneously connects carrier T.Solution I 5 μ l, PCR product 4 μ l, pMD18-T vector (50ng/ μ l) 1 μ l are added on ice, always Pipe is put into metal bath in PCR pipe and mixing by 10 μ l of volume, 16 DEG C of connections overnight.Connection product is added to large intestine bar Mixing in bacterium competence, ice bath 30min, then be put into heat shock 90s in 42 DEG C of water-baths and be put into ice bath 3min on ice immediately after, add Enter 700 μ l LB culture mediums, is put into 200rpm in 37 DEG C of shaking tables and cultivates 30min.Culture is drawn into 200 μ l to ammonia benzyl blueness It is on the solid LB media (100 μ g/ml) of mycin and uniform with coating rod coating.Flat-plate inverted is placed in 37 DEG C of incubators and is stood Overnight incubation.Obtained positive bacterial plaque send company to be sequenced.The segment that sequencing obtains four kinds of sequence differences is respectively designated as： BnLPAAT2-A7 (corresponding SEQ ID No.1 and SEQ ID No.5), BnLPAAT2-C7 (corresponding SEQ ID No.2 and SEQ ID No.6), BnLPAAT2-C8 (corresponding SEQ ID No.3 and SEQ ID No.7), BnLPAAT2-A9 (corresponding SEQ ID No.4 and SEQ ID No.8)。

Embodiment 2：

Overexpression vector is built

(1) structure and Agrobacterium-mediated Transformation of plant expression vector

It is that template is expanded with TOYOBO companies high fidelity enzyme KOD plus by the gene order that clone obtains, obtains Genetic fragment recycles for use through agarose gel；Take the plasmid of 40 μ l plant expression vectors pBinGlyRed3 that 4 μ l EcoR I are added In 37 ° of lower digestions 30 minutes after enzyme and 5 μ l digestion buffer mixings, carrier is recycled through agarose gel for use.2 μ l bases are taken respectively Cause and plasmid recycle segment, and 1 μ l infusion kit mix mixings are added, and 50 ° connect 20 minutes.Connection product converts large intestine Bacillus simultaneously obtains positive bacterial plaque, and rear extraction plasmid is for use.Recombinant plasmid drives LPAAT2 genes with glycinin promoter Specific expressed in seed (Fig. 2).By recombinant plasmid transformed Agrobacterium GV3101 and screen positive Agrobacterium.

(2) Agrobacterium infects arabidopsis thaliana transformation

Gentamicin (50 μ g/ml), kanamycins (50 μ g/ml), rifampin (25-50 μ is being added in obtained positive strain G/ml in LB culture mediums), 28 DEG C, 200rpm is incubated overnight.Thalline were collected by centrifugation by 5000rpm in centrifuge, 3min, uses It is 0.8 or so that Agrobacterium is diluted to OD values by conversion penetrating fluid.The arabidopsis of initial bloom stage is chosen for dipping in colored conversion, before conversion First the silique of arabidopsis to be cut.The inflorescence of arabidopsis is submerged into 0.5-1min in conversion fluid.Arabidopsis seedling is positioned over Dark, under conditions of moistening overnight.Then arabidopsis is put back into culturing room again, repeats to convert after 3-5d, wait for arabidopsis maturation After collect seed.Due to carrying DsRed3 fluorescins (Fig. 2) on plant expression vector, kind is excited under 520nm green lights Son release fluorescence, is transgenosis T1 generations through optical filter red-coloured seeds.

(3) preliminary screening of transgenosis T1 generations single copy strain

T1 carries out copy number screening for seed, as T2 generations is collected after plant maturation, to its seed.Under 520nm green lights Transgenosis T2 seeds are excited, are light source photo through photograph via bright field and exciting light is acquired after Red lightscreening plate respectively.The step for It is completed under fluorescence Stereo microscope.By collected photo in statistical software ten thousand depth CG species tests software or Image J etc. Number seeds statistics is carried out under technical software, finally obtains the ratio of red-coloured seeds and non-red-coloured seeds.Calculating ratio is chosen to connect Nearly 3:The red-coloured seeds of 1 strain are sowed, collected after seed maturity seed be T3 for seed.

(4) fatty acid analysis and expression analysis of strain are overexpressed

(1) extraction and esterification of grease

1. weighing 5-10mg arabidopsis T3 for seed, it is put into the teat glass of 10ml.

2. sequentially adding 2.5% H of 1.5ml₂SO₄Methanol solution (containing 0.01%BHT), 200 μ l C17:0 toluene solution (a concentration of 2mg/ml), 0.4ml toluene solutions have to tighten lid, to prevent vaporization at high temperature full of attention after nitrogen.

3. 99 DEG C of water-bath 1h, taking-up sequentially adds distilled water 1.8ml, n-hexane 1ml after cold.

4. stand 12h after mixing, with 1ml syringe Aspirate supernatants, then by 0.45 μm of aperture be filtered into It is to be measured in sample bottle.

(2) gas chromatographic analysis of fatty acid methyl ester

The gas chromatograph model used：Agilent 7890A, column model：Agilent J&W GC Columns. 1 μ l of sample size, post case heating schedule：180 DEG C of initial temperature is heated to 225 DEG C with 10 DEG C/min rates, maintains 7 minutes.Chromatography Column constant current flow velocity is 1ml/min, carrier gas N₂。

The software that the calculating of peak area is provided using Agilent chem workstation calculates oil content using internal standard method, calculates Formula is：m(C17:0 mass)/s (C17:0 peak area)=m (oily quality)/s (remove C17:0 other outer aliphatic acid peak areas).

BnLPAAT2 Gene As 7, the copy of C7, C8, A9 tetra- amount to 20 transgenic line oil content the result shows that, BnLPAAT2-A7, BnLPAAT2-A9 oil content and linolenic acid content significantly improve；BnLPAAT2-C7, BnLPAAT2-C8 oil-containing Amount is consistent with wild type, and linolenic acid content significantly improves (Fig. 3).

Concrete outcome is as follows：

1) tetra- transgenic line oil content of A7 averagely improve 2.4%, and highest increase rate is up to 5.4%；Linolenic acid content 5.5% is averagely improved, highest is improved up to 8.5% (Fig. 4).

2) tetra- transgenic line oil content increase rates of C7 are up to 3.3%, but Average oil concentration connects without significantly improving Nearly wild type；Linolenic acid content averagely improves 6.2%, and highest increase rate is up to 7.1% (Fig. 5).

3) tetra- transgenic line oil content of C8 averagely improve 1.3%, and highest amplitude is up to 3.8%, but statistical analysis does not reach To significant difference；Linolenic acid content averagely improves 2.6, and highest increase rate is up to 4.1% (Fig. 6).

4) tetra- transgenic line oil content of A9 averagely improve 2.7%, and highest amplitude is up to 6.3%；Leukotrienes average content Improve 0.66%, highest increase rate is up to 6.3% (Fig. 7).

(5) LPAAT2 overexpresses the sn-2 fatty acid component analyses of strain seed triglycerides

20mg porcine pancreatic lipases are added in reaction product, 2mL Tris-HCl buffer solutions (pH=8,2mol/L) after shaking up, add 0.5mL sodium cholate solutions (1g/L), 0.2mL CaCl2 solution (220g/L) after vortex mixing, shake anti-in 40 DEG C of water-baths After answering 5min, 1mL anhydrous ethers are added, after concussion uniformly, 2min is centrifuged in 5000r/min for 1mL HCl solutions (6mol/L), Take upper layer, nitrogen drying is to get to grease hydrolysis blend sample.The two of 2mL is added into obtained hydrolysed mix sample Chloromethanes and the mixing that is vortexed.NH2-SPE pillars are activated with the n-hexane of 6mL, blend sample is added to NH2-SPE pillars In, then n-hexane/ethyl acetate=85/15 (v/v) is used to elute NH2-SPE pillars, removes TAG, DAG and FFA in sample, so It uses methylene chloride/methanol=2/1 (v/v) to elute pillar afterwards, isolates MAG, the sample nitrogen that elution is obtained dries up.1mL Then the KOH/ methanol solutions of 0.4mol/L, vortex 10min are added the sodium-chloride water solution of 2mL 0.9% (w/v), slightly shake 5-10s is swung, 5min is centrifuged in 5000rpm, supernatant is finally taken to carry out GC analyses.GC analytical instrument is：Agilent 7890A types Gas chromatograph, fid detector；Chromatographic column：HP-FFAP(30m×0.25mm×0.5μm)；1 μ L of sample size；Split ratio 30:1； Temperature programming：210 DEG C of initial temperature keeps 8min, and 20 DEG C/min is warming up to 240 DEG C, and keeps 7min, obtains GC chromatograms, data point Analysis.As a result, it has been found that in transgenic line triglycerides sn-2, wild type is compared, linolenic acid content highest improves 10%. Wherein, BnLPAAT2-A7 and BnLPAAT2-C8sn-2 linolenic acid content highest improves 10% compared to wild type； BnLPAAT2-C7 with BnLPAAT2-A9 linolenic acid contents compare wild type and 4% and 5% (Fig. 8) have been respectively increased.The above results It confirms that BnLPAAT2 has sn-2 leukotrienes Preferences, and finally improves linolenic acid content in grease.

As it will be easily appreciated by one skilled in the art that the foregoing is merely illustrative of the preferred embodiments of the present invention, not to The limitation present invention, all within the spirits and principles of the present invention made by all any modification, equivalent and improvement etc., should all include Within protection scope of the present invention.

Sequence table

<110>The Central China University of Science and Technology

<120>A kind of application of the gene of promotion vegetable seeds flax acid accumulation

<160> 8

<170> SIPOSequenceListing 1.0

<210> 1

<211> 1173

<212> DNA

<213>Cabbage type rape (Brassica napus)

<400> 1

atggcgatgg cagcagcagt gattgtgcct ttggggattc tcttcttcat ttctggcctc 60

gttgtcaatc tccttcaggc agtttgctat gtcctcgttc gacctctgtc taagaacaca 120

tacagaaaga tcaaccgggt ggttgcagaa accttgtggt tggagcttgt ctggatcgtt 180

gactggtggg ctggagtcaa gatccaagtc tttgctgatg atgagacctt taatcgaatg 240

ggcaaagaac atgctcttgt cgtttgtaat caccgaagtg atattgattg gctcgtggga 300

tggattctcg ctcagaggtc aggttgccta ggaagcgcat tagctgtgat gaagaagtct 360

tccaaatttc tcccagtcat aggctggtca atgtggttct ccgagtatct gtttcttgaa 420

agaaattggg caaaggatga aagcacttta aagtcaggtc ttcaacgctt gaacgacttc 480

ccacggcctt tctggctagc tctttttgtg gagggaaccc gcttcacaga ggcaaaactt 540

aaagcagcac aagagtacgc agcctcctct gagttgcctg tccctcgaaa tgtgttgatt 600

cctcgcacca aaggatttgt gtcagctgtt agtaacatgc gttcatttgt gccagccata 660

tatgatatga ccgtggctat tccaaaaact tctccacccc caacgatgct aagactattc 720

aaaggacaac cttctgtggt gcatgttcac atcaagtgtc actcgatgaa agacttgcct 780

gaatcagaag acgaaattgc acagtggtgc agagatcagt ttgtgactaa ggatgcactg 840

ttagacaaac acatagctgc agacactttc gccggtcaga aagaacagaa cattggccgt 900

cccataaagt ctcttgcagt ggttctgtca tgggcatgtc tactaactct tggagcaatg 960

aagttcttac actggtcaaa tctcttttcc tcgtggaaag gcatcgcatt atcagcgctt 1020

ggtctaggca tcatcactct ctgtatgcag atcttgatcc gctcctctca gtcggagcgt 1080

tcaacacctg ccaaagtcgc tccagccaag ccaaaggaca atcaccagtc aggaccatcc 1140

tcccaaacag aagtggagga gaagcagaag taa 1173

<210> 2

<211> 1176

<212> DNA

<213>Cabbage type rape (Brassica napus)

<400> 2

atggcgatgg cagcagcagc agtgattgtg cctttgggga ttctcttctt catttctggc 60

ctcgttgtca atctccttca ggcagtttgc tatgtcctca ttcgacctct gtctaagaac 120

acatacagaa agatcaaccg tgtggttgca gaaaccttgt ggttggagct tgtctggatc 180

gttgactggt gggctggagt caagatccaa gtgtttgctg atgatgagac ctttaatcga 240

atgggcaaag agcatgctct tgtcgtttgt aatcaccgaa gtgatattga ttggctcgtg 300

ggatggattc tggctcagag gtcaggttgc ctaggaagcg cattagctgt gatgaagaag 360

tcttccaaat ttcttccagt cataggctgg tcaatgtggt tctcggagta tctctttctc 420

gaaagaaatt gggcaaagga tgaaagcact ttaaagtcag gtcttcaacg cttgaacgac 480

ttcccacggc ctttctggtt agcccttttt gtggagggaa cccgtttcac agaggcaaaa 540

cttaaagcag cacaagagta cgcagcctcc tctcagttgc ctgtccctcg aaatgtgttg 600

attcctcgca ccaaaggttt tgtgtcagct gttagtaaca tgcgttcatt tgtgccagcc 660

atatatgata tgaccgtggc tattccaaaa acttctccac ccccaacgat gctaagacta 720

ttcaaaggac aaccttctgt ggtgcatgtt cacatcaagt gtcactcgat gaaagacttg 780

cctgaatcag atgacgcaat tgcacagtgg tgcagagatc agtttgtggc taaggatgca 840

ctgttagaca aacacatagc tgcagacact ttccccggtc agaaagaaca caacattggc 900

cgtcccataa agtctcttgc agtggttgta tcatgggcat gcctactaac tcttggagca 960

atgaagttct tacactggtc aaatctcttt tcctcgttga aaggcatcgc attatcagcg 1020

cttggtctag gcatcatcac tctctgcatg cagatcttga tccgctcctc tcagtcggag 1080

cgttcaacac ctgccaaagt ggccccagcc aagccaaagg acaaacacca gtcaggatca 1140

tcctcccaaa cagaagtgga ggagaagcag aagtaa 1176

<210> 3

<211> 1173

<212> DNA

<213>Cabbage type rape (Brassica napus)

<400> 3

atggcgatgg cagcagctgt gattgtgcct ctgggcattc tcttcttcat atctggtctc 60

gttgttaatc tccttcaggc gatttgttat gttcctattc gacctctgtc taagaacacg 120

tacagaaaaa tcaaccgggt ggttgctgaa accttgtggc ttgagcttgt ctggattgtt 180

gactggtggg ctggtgtaaa gatccaagtg tttgctgata atgagacctt caatcgaatg 240

ggcaaagaac atgctcttgt cgtttgtaat caccgaagtg atattgattg gcttgtggga 300

tggattctgg ctcagagatc aggttgcctg ggaagcgcat tggctgtaat gaagaagtct 360

tctaaatttc ttccagtcat aggctggtca atgtggttct cggagtatct gtttctggaa 420

agaaattggg caaaggatga aagcactcta aagtcaggtc ttcaacgctt gaacgacttc 480

cctagacctt tctggttagc actttttgtg gagggaaccc gctttacaga ggctaaactt 540

aaagcagcac aagagtacgc tgcctcctct gagctgcctg tccctcgaaa tgtgttgatt 600

cctcgcacca aaggttttgt gtcagctgtt agtaatatgc gttcatttgt cccagccatt 660

tatgatatga ccgtggctat tccaaaaaca tctccacccc caacgatgct cagactattc 720

aaaggacaac cttctgtggt gcatgttcac atcaagtgtc actcgacgaa agacttgcct 780

gaatcagatg acgcaattgc acagtggtgc agagatcagt ttgtggctaa ggatgcacta 840

ttagacaaac acatagctgc agacactttc cctggtcagc aagaacagaa cattggccgt 900

cccataaagt ctcttgcagt ggttctatca tggtcatgcc tactgattct tggagcaatg 960

aagttcttac actggtcaaa tctcttctcc tcatggaaag gcatcgcgtt ttcggcgctg 1020

ggtctaggca tcatcactct ctgtatgcag atcctgatcc gttcctctca gtcagagcgt 1080

tctaccccag ccaaagtcgt tccagccaag ccaaaagaca atcataacga ctcaggatca 1140

tcctcccaaa cagaagtaga gaagcagaag taa 1173

<210> 4

<211> 1173

<212> DNA

<213>Cabbage type rape (Brassica napus)

<400> 4

atggcgatgg cagcagctgt gattgtgcct ctgggaattc tcttcttcat atctggtctc 60

gttgtcaatc tccttcaggc gatttgttat gttcttattc gacctctgtc taagaacacg 120

tacagaaaaa tcaaccgggt ggttgctgaa accttgtggc ttgagcttgt ctggattgtt 180

gactggtggg ctggtgtaaa gatccaagtg tttgctgata atgagacctt caatcgaatg 240

ggcaaagaac atgctcttgt cgtttgtaat caccgaagtg atattgattg gcttgtggga 300

tggattctgg ctcagagatc aggttgcctg ggaagcgcat tggctgtaat gaagaagtct 360

tctaaatttc ttccagtcat aggctggtca atgtggttct cggagtatct gtttctggaa 420

agaaattggg caaaggatga aagcactcta aagtcaggtc ttcaacgctt gaacgacttc 480

cctagacctt tctggttagc actttttgtg gagggaaccc gctttacaga ggctaaactt 540

aaagcagcac aagagtacgc tgcctcctct gagctgcctg tccctcgaaa tgtgttgatt 600

cctcgcacca aaggttttgt gtcagctgtt agtaatatgc gttcatttgt cccagccatt 660

tatgatatga ccgtggctat tccaaaaaca tctccacccc caacgatgct cagactattc 720

aaaggacaac cttctgtggt gcatgttcac atcaagtgtc actcgatgaa agacttgcct 780

gaatcagatg acgcaattgc acagtggtgc agagatcagt ttgtggctaa ggatgcacta 840

ttagacaaac acatagctgc agacactttc cctggtcagc aagaacagaa cattggccgt 900

cccataaagt ctcttgcagt ggttctatca tggtcatgcc tactgattct tggagcaatg 960

aagttcttac actggtcaaa tctcttctcc tcatggaaag gcatcgcgtt ttcggcgctg 1020

ggtctaggca tcatcactct ctgtatgcag atcctgatcc gttcctctca gtcagagcgt 1080

tctaccccag ccaaagtcgt tccagccaag ccaaaagaca atcataacga ctcaggatca 1140

tcctcccaaa cagaagtgga gaagcagaag taa 1173

<210> 5

<211> 390

<212> PRT

<213>Cabbage type rape (Brassica napus)

<400> 5

Met Ala Met Ala Ala Ala Val Ile Val Pro Leu Gly Ile Leu Phe Phe

1 5 10 15

Ile Ser Gly Leu Val Val Asn Leu Leu Gln Ala Val Cys Tyr Val Leu

20 25 30

Val Arg Pro Leu Ser Lys Asn Thr Tyr Arg Lys Ile Asn Arg Val Val

35 40 45

Ala Glu Thr Leu Trp Leu Glu Leu Val Trp Ile Val Asp Trp Trp Ala

50 55 60

Gly Val Lys Ile Gln Val Phe Ala Asp Asp Glu Thr Phe Asn Arg Met

65 70 75 80

Gly Lys Glu His Ala Leu Val Val Cys Asn His Arg Ser Asp Ile Asp

85 90 95

Trp Leu Val Gly Trp Ile Leu Ala Gln Arg Ser Gly Cys Leu Gly Ser

100 105 110

Ala Leu Ala Val Met Lys Lys Ser Ser Lys Phe Leu Pro Val Ile Gly

115 120 125

Trp Ser Met Trp Phe Ser Glu Tyr Leu Phe Leu Glu Arg Asn Trp Ala

130 135 140

Lys Asp Glu Ser Thr Leu Lys Ser Gly Leu Gln Arg Leu Asn Asp Phe

145 150 155 160

Pro Arg Pro Phe Trp Leu Ala Leu Phe Val Glu Gly Thr Arg Phe Thr

165 170 175

Glu Ala Lys Leu Lys Ala Ala Gln Glu Tyr Ala Ala Ser Ser Glu Leu

180 185 190

Pro Val Pro Arg Asn Val Leu Ile Pro Arg Thr Lys Gly Phe Val Ser

195 200 205

Ala Val Ser Asn Met Arg Ser Phe Val Pro Ala Ile Tyr Asp Met Thr

210 215 220

Val Ala Ile Pro Lys Thr Ser Pro Pro Pro Thr Met Leu Arg Leu Phe

225 230 235 240

Lys Gly Gln Pro Ser Val Val His Val His Ile Lys Cys His Ser Met

245 250 255

Lys Asp Leu Pro Glu Ser Glu Asp Glu Ile Ala Gln Trp Cys Arg Asp

260 265 270

Gln Phe Val Thr Lys Asp Ala Leu Leu Asp Lys His Ile Ala Ala Asp

275 280 285

Thr Phe Ala Gly Gln Lys Glu Gln Asn Ile Gly Arg Pro Ile Lys Ser

290 295 300

Leu Ala Val Val Leu Ser Trp Ala Cys Leu Leu Thr Leu Gly Ala Met

305 310 315 320

Lys Phe Leu His Trp Ser Asn Leu Phe Ser Ser Trp Lys Gly Ile Ala

325 330 335

Leu Ser Ala Leu Gly Leu Gly Ile Ile Thr Leu Cys Met Gln Ile Leu

340 345 350

Ile Arg Ser Ser Gln Ser Glu Arg Ser Thr Pro Ala Lys Val Ala Pro

355 360 365

Ala Lys Pro Lys Asp Asn His Gln Ser Gly Pro Ser Ser Gln Thr Glu

370 375 380

Val Glu Glu Lys Gln Lys

385 390

<210> 6

<211> 391

<212> PRT

<213>Cabbage type rape (Brassica napus)

<400> 6

Met Ala Met Ala Ala Ala Ala Val Ile Val Pro Leu Gly Ile Leu Phe

1 5 10 15

Phe Ile Ser Gly Leu Val Val Asn Leu Leu Gln Ala Val Cys Tyr Val

20 25 30

Leu Ile Arg Pro Leu Ser Lys Asn Thr Tyr Arg Lys Ile Asn Arg Val

35 40 45

Val Ala Glu Thr Leu Trp Leu Glu Leu Val Trp Ile Val Asp Trp Trp

50 55 60

Ala Gly Val Lys Ile Gln Val Phe Ala Asp Asp Glu Thr Phe Asn Arg

65 70 75 80

Met Gly Lys Glu His Ala Leu Val Val Cys Asn His Arg Ser Asp Ile

85 90 95

Asp Trp Leu Val Gly Trp Ile Leu Ala Gln Arg Ser Gly Cys Leu Gly

100 105 110

Ser Ala Leu Ala Val Met Lys Lys Ser Ser Lys Phe Leu Pro Val Ile

115 120 125

Gly Trp Ser Met Trp Phe Ser Glu Tyr Leu Phe Leu Glu Arg Asn Trp

130 135 140

Ala Lys Asp Glu Ser Thr Leu Lys Ser Gly Leu Gln Arg Leu Asn Asp

145 150 155 160

Phe Pro Arg Pro Phe Trp Leu Ala Leu Phe Val Glu Gly Thr Arg Phe

165 170 175

Thr Glu Ala Lys Leu Lys Ala Ala Gln Glu Tyr Ala Ala Ser Ser Gln

180 185 190

Leu Pro Val Pro Arg Asn Val Leu Ile Pro Arg Thr Lys Gly Phe Val

195 200 205

Ser Ala Val Ser Asn Met Arg Ser Phe Val Pro Ala Ile Tyr Asp Met

210 215 220

Thr Val Ala Ile Pro Lys Thr Ser Pro Pro Pro Thr Met Leu Arg Leu

225 230 235 240

Phe Lys Gly Gln Pro Ser Val Val His Val His Ile Lys Cys His Ser

245 250 255

Met Lys Asp Leu Pro Glu Ser Asp Asp Ala Ile Ala Gln Trp Cys Arg

260 265 270

Asp Gln Phe Val Ala Lys Asp Ala Leu Leu Asp Lys His Ile Ala Ala

275 280 285

Asp Thr Phe Pro Gly Gln Lys Glu His Asn Ile Gly Arg Pro Ile Lys

290 295 300

Ser Leu Ala Val Val Val Ser Trp Ala Cys Leu Leu Thr Leu Gly Ala

305 310 315 320

Met Lys Phe Leu His Trp Ser Asn Leu Phe Ser Ser Leu Lys Gly Ile

325 330 335

Ala Leu Ser Ala Leu Gly Leu Gly Ile Ile Thr Leu Cys Met Gln Ile

340 345 350

Leu Ile Arg Ser Ser Gln Ser Glu Arg Ser Thr Pro Ala Lys Val Ala

355 360 365

Pro Ala Lys Pro Lys Asp Lys His Gln Ser Gly Ser Ser Ser Gln Thr

370 375 380

Glu Val Glu Glu Lys Gln Lys

385 390

<210> 7

<211> 390

<212> PRT

<213>Cabbage type rape (Brassica napus)

<400> 7

Met Ala Met Ala Ala Ala Val Ile Val Pro Leu Gly Ile Leu Phe Phe

1 5 10 15

Ile Ser Gly Leu Val Val Asn Leu Leu Gln Ala Ile Cys Tyr Val Pro

20 25 30

Ile Arg Pro Leu Ser Lys Asn Thr Tyr Arg Lys Ile Asn Arg Val Val

35 40 45

Ala Glu Thr Leu Trp Leu Glu Leu Val Trp Ile Val Asp Trp Trp Ala

50 55 60

Gly Val Lys Ile Gln Val Phe Ala Asp Asn Glu Thr Phe Asn Arg Met

65 70 75 80

Gly Lys Glu His Ala Leu Val Val Cys Asn His Arg Ser Asp Ile Asp

85 90 95

Trp Leu Val Gly Trp Ile Leu Ala Gln Arg Ser Gly Cys Leu Gly Ser

100 105 110

Ala Leu Ala Val Met Lys Lys Ser Ser Lys Phe Leu Pro Val Ile Gly

115 120 125

Trp Ser Met Trp Phe Ser Glu Tyr Leu Phe Leu Glu Arg Asn Trp Ala

130 135 140

Lys Asp Glu Ser Thr Leu Lys Ser Gly Leu Gln Arg Leu Asn Asp Phe

145 150 155 160

Pro Arg Pro Phe Trp Leu Ala Leu Phe Val Glu Gly Thr Arg Phe Thr

165 170 175

Glu Ala Lys Leu Lys Ala Ala Gln Glu Tyr Ala Ala Ser Ser Glu Leu

180 185 190

Pro Val Pro Arg Asn Val Leu Ile Pro Arg Thr Lys Gly Phe Val Ser

195 200 205

Ala Val Ser Asn Met Arg Ser Phe Val Pro Ala Ile Tyr Asp Met Thr

210 215 220

Val Ala Ile Pro Lys Thr Ser Pro Pro Pro Thr Met Leu Arg Leu Phe

225 230 235 240

Lys Gly Gln Pro Ser Val Val His Val His Ile Lys Cys His Ser Thr

245 250 255

Lys Asp Leu Pro Glu Ser Asp Asp Ala Ile Ala Gln Trp Cys Arg Asp

260 265 270

Gln Phe Val Ala Lys Asp Ala Leu Leu Asp Lys His Ile Ala Ala Asp

275 280 285

Thr Phe Pro Gly Gln Gln Glu Gln Asn Ile Gly Arg Pro Ile Lys Ser

290 295 300

Leu Ala Val Val Leu Ser Trp Ser Cys Leu Leu Ile Leu Gly Ala Met

305 310 315 320

Lys Phe Leu His Trp Ser Asn Leu Phe Ser Ser Trp Lys Gly Ile Ala

325 330 335

Phe Ser Ala Leu Gly Leu Gly Ile Ile Thr Leu Cys Met Gln Ile Leu

340 345 350

Ile Arg Ser Ser Gln Ser Glu Arg Ser Thr Pro Ala Lys Val Val Pro

355 360 365

Ala Lys Pro Lys Asp Asn His Asn Asp Ser Gly Ser Ser Ser Gln Thr

370 375 380

Glu Val Glu Lys Gln Lys

385 390

<210> 8

<211> 390

<212> PRT

<213>Cabbage type rape (Brassica napus)

<400> 8

Met Ala Met Ala Ala Ala Val Ile Val Pro Leu Gly Ile Leu Phe Phe

1 5 10 15

Ile Ser Gly Leu Val Val Asn Leu Leu Gln Ala Ile Cys Tyr Val Leu

20 25 30

Ile Arg Pro Leu Ser Lys Asn Thr Tyr Arg Lys Ile Asn Arg Val Val

35 40 45

Ala Glu Thr Leu Trp Leu Glu Leu Val Trp Ile Val Asp Trp Trp Ala

50 55 60

Gly Val Lys Ile Gln Val Phe Ala Asp Asn Glu Thr Phe Asn Arg Met

65 70 75 80

Gly Lys Glu His Ala Leu Val Val Cys Asn His Arg Ser Asp Ile Asp

85 90 95

Trp Leu Val Gly Trp Ile Leu Ala Gln Arg Ser Gly Cys Leu Gly Ser

100 105 110

Ala Leu Ala Val Met Lys Lys Ser Ser Lys Phe Leu Pro Val Ile Gly

115 120 125

Trp Ser Met Trp Phe Ser Glu Tyr Leu Phe Leu Glu Arg Asn Trp Ala

130 135 140

Lys Asp Glu Ser Thr Leu Lys Ser Gly Leu Gln Arg Leu Asn Asp Phe

145 150 155 160

Pro Arg Pro Phe Trp Leu Ala Leu Phe Val Glu Gly Thr Arg Phe Thr

165 170 175

Glu Ala Lys Leu Lys Ala Ala Gln Glu Tyr Ala Ala Ser Ser Glu Leu

180 185 190

Pro Val Pro Arg Asn Val Leu Ile Pro Arg Thr Lys Gly Phe Val Ser

195 200 205

Ala Val Ser Asn Met Arg Ser Phe Val Pro Ala Ile Tyr Asp Met Thr

210 215 220

Val Ala Ile Pro Lys Thr Ser Pro Pro Pro Thr Met Leu Arg Leu Phe

225 230 235 240

Lys Gly Gln Pro Ser Val Val His Val His Ile Lys Cys His Ser Met

245 250 255

Lys Asp Leu Pro Glu Ser Asp Asp Ala Ile Ala Gln Trp Cys Arg Asp

260 265 270

Gln Phe Val Ala Lys Asp Ala Leu Leu Asp Lys His Ile Ala Ala Asp

275 280 285

Thr Phe Pro Gly Gln Gln Glu Gln Asn Ile Gly Arg Pro Ile Lys Ser

290 295 300

Leu Ala Val Val Leu Ser Trp Ser Cys Leu Leu Ile Leu Gly Ala Met

305 310 315 320

Lys Phe Leu His Trp Ser Asn Leu Phe Ser Ser Trp Lys Gly Ile Ala

325 330 335

Phe Ser Ala Leu Gly Leu Gly Ile Ile Thr Leu Cys Met Gln Ile Leu

340 345 350

Ile Arg Ser Ser Gln Ser Glu Arg Ser Thr Pro Ala Lys Val Val Pro

355 360 365

Ala Lys Pro Lys Asp Asn His Asn Asp Ser Gly Ser Ser Ser Gln Thr

370 375 380

Glu Val Glu Lys Gln Lys

385 390

Claims (5)

1. a kind of application of genetic fragment in promoting vegetable seeds in flax acid accumulation, which is characterized in that the genetic fragment has Just like nucleotide sequence or its complementary series shown in any one of SEQ ID No.1~SEQ ID No.4, or due to increasing Add, lack or replace caused by one or more nucleotide with core shown in any one of SEQ ID No.1~SEQ ID No.4 Nucleotide sequence homology is not less than 95% and the identical derivatized nucleotide sequence of function.

2. a kind of application of protein in promoting vegetable seeds flax acid accumulation, which is characterized in that the protein has such as SEQ Amino acid sequence shown in any one of ID No.5~SEQ ID No.8, or due to increase, missing or replacement one or more There is same isoreactivity with amino acid sequence shown in any one of SEQ ID No.5~SEQ ID No.8 caused by a amino acid Derived protein.

3. a kind of recombinant vector is in breeding improvement to promote the application in vegetable seeds flax acid accumulation, which is characterized in that this is heavy Group carrier includes genetic fragment, and the genetic fragment has the core as shown in any one of SEQ ID No.1~SEQ ID No.4 Nucleotide sequence or its complementary series, or due to increase, missing or replace caused by one or more nucleotide with SEQ ID Nucleotide sequence homology shown in any one of No.1~SEQ ID No.4 is not less than 95% and the identical derivative core of function Nucleotide sequence.

4. a kind of recombinant bacterial strain is in breeding improvement to promote the application in vegetable seeds flax acid accumulation, which is characterized in that this is heavy Group bacterial strain includes genetic fragment, and the genetic fragment has the core as shown in any one of SEQ ID No.1~SEQ ID No.4 Nucleotide sequence or its complementary series, or due to increase, missing or replace caused by one or more nucleotide with SEQ ID Nucleotide sequence homology shown in any one of No.1~SEQ ID No.4 is not less than 95% and the identical derivative core of function Nucleotide sequence.

5. being applied as described in claim 1-4 any one, which is characterized in that the plant includes monocotyledon or Shuangzi Leaf plant, preferably arabidopsis, rape, peanut, soybean, oil tea, manioca, palm, corn, rice, wheat, sesame, Xiang Any one in certain herbaceous plants with big flowers, olive.