CN111574603A - Transcription factor related to fatty acid synthesis, DNA molecule thereof, method for increasing oil content of oil crops and application - Google Patents

Abstract

The invention belongs to the technical field of plant metabolism regulation and control, and particularly relates to a transcription factor related to fatty acid synthesis, a DNA (deoxyribonucleic acid) molecule thereof, a method for improving oil content of oil crops and application thereof. According to the invention, the analysis and comparison of oil content, oil composition, gene expression and the like of nearly 16 different oil tea varieties find that the expressions of two APETALA2 transcription factors named as CoWRI1a and CoWRI1b are closely and positively correlated with the oil content. The two genes are cloned from No.4 seeds of the tea-oil tree variety Changlin. The protein sequences of the CoWRI1a and CoWRI1b genes and the AtWRI1 protein sequence similarity were 50% and 56%, respectively. After the CoWRI1a and CoWRI1b are over-expressed in Arabidopsis or tobacco leaves, the increase of the grease content of the Arabidopsis seeds or the tobacco leaves is remarkably promoted, and the protein content of the Arabidopsis seeds is also remarkably increased.

Description

Transcription factor related to fatty acid synthesis, DNA molecule thereof, method for increasing oil content of oil crops and application

Technical Field

The invention belongs to the technical field of plant metabolism regulation and control, and particularly relates to a transcription factor related to fatty acid synthesis, a DNA (deoxyribonucleic acid) molecule thereof, a method for improving oil content of oil crops and application thereof.

Background

Camellia oleifera (Camellia oleifera) is a perennial evergreen, broad-leaved, perennial oil plant, which is commonly referred to as four major woody oil plants, with oil palm, olive and coconut. The camellia oleifera is a pure natural high-grade oil crop which is peculiar to China. By the end of 2017, the planting area of the camellia oleifera is enlarged to 6550 ten thousand mu. Fruit of camellia oleifera: the camellia seeds are mainly used for extracting edible oil (also called tea oil), and the main components of the camellia seeds are polyunsaturated fatty acids (accounting for about 94 percent) and less saturated fatty acids. The oil content of the oil tea seeds is about 30-50% of dry matter, and is similar to oil crops such as rapeseeds (40-50%), peanuts (35-40%), sunflower seeds (30%), woody oil crops oil palm (30-50%), and the like. The oleic/linoleic acid ratio in tea seed oil is similar to that of olive oil and is therefore called "eastern olive oil". In addition, camellia oleifera seeds are rich in vitamin E, polyphenols (mainly flavonoids), phytosterols, carotenoids and saponins, phytonutrients that are considered beneficial for health. Thus, tea oil as an edible oil has health benefits such as lowering serum triglycerides and various applications in medicine and cosmetics. Tea oil has also been widely used in the manufacture of soaps, margarines, lubricants, rust preventive oils, etc. due to its unique physicochemical properties.

Grease is an important food nutrient component and is a basic nutrient substance which is necessary to be taken by people every day and is used for supporting the life metabolism of human bodies. In the seeds or fruits of plants, vegetable oils and fats are mainly present in the form of Triacylglycerols (TAG), and account for about 95% or more of vegetable oils. The fatty acids in triacylglycerols are composed of saturated fatty acids such as palmitic acid (C16:0), stearic acid (C18:0), etc., and unsaturated fatty acids such as oleic acid (C18:1), linoleic acid (C18:2), linolenic acid (C18:3), etc.

The current research shows that TAG is the most important energy storage substance of oil crops. Transcription factors AtLEC1(leaf colledon 1), AtLEC2, AtABI3(abscisic acid sensitive 3) and FUS3(fusca3) in Arabidopsis thaliana are considered to be the core of seed development regulation. The transcription factors ABI3, FUS3 and LEC2 control the content of seed oil or FA by directly or indirectly regulating FA biosynthesis and TAG accumulation in vegetative tissues. AtWRI1 belongs to the APETALA2 family of transcription factors and is shown to be an important regulator of lipid synthesis in mature Arabidopsis seeds. Research on an arabidopsis AtWRI1 mutant shows that the deletion of WRI1 gene can not convert carbohydrate into precursor substances for fatty acid synthesis, and harvested seeds show shriveling, increase in sugar and starch content and reduction in oil content by 80%. In the biosynthesis pathway of oil, AtWRI1 is the target of AtLEC1, and AtWRI1 controls the synthesis of seed oil by directly regulating metabolic genes involved in glycolysis pathway, amino acid and FA biosynthesis. In maize and Arabidopsis, AtWRI homologous genes modulate genes involved in FA biosynthesis, such as the ACCase subunit, ACP1 and KAS1, by direct binding to the AW-box of the promoter region. Overexpression of the homologous gene of WRI1 in different plants increased the seed oil content in transgenic seeds. FIG. 1: transcription factors regulate the pathway of lipid synthesis, and FIG. 1 shows that in Arabidopsis seeds, AtWRI1 plays a very important regulatory role in lipid synthesis, and is responsible for diverting metabolites produced by glycolysis to fatty acid synthesis, thereby promoting the synthesis of Triacylglycerol (TAG) of seeds.

Disclosure of Invention

Aiming at the problems in the prior art, the invention provides a transcription factor related to fatty acid synthesis, a DNA molecule thereof, a method for improving the oil content of oil crops and an application thereof, and aims to solve part of the problems in the prior art or at least alleviate part of the problems in the prior art.

The invention is realized by the fact that the amino acid sequence of the transcription factor related to fatty acid synthesis is shown in SEQ ID NO.1 or SEQ ID NO. 2. The transcription factor is derived from oil tea.

Furthermore, the amino acid sequence of the transcription factor is the amino acid sequence which is shown by SEQ ID NO.1 or SEQ ID NO.2 and has the same protein function after the substitution and/or deletion and/or addition of a plurality of amino acid residues; or derived from the amino acid sequence shown in SEQ ID NO.2, has more than 98 percent of homology and has the same protein function.

A DNA molecule for coding a transcription factor related to fatty acid synthesis, wherein the nucleotide sequence of the transcription factor for coding the sequence shown in SEQ ID NO.1 is shown in SEQ ID NO. 3; the nucleotide sequence of the transcription factor of the sequence shown in SEQ ID NO.2 is shown in SEQ ID NO. 4.

Further, the nucleotide sequence of the transcription factor which codes for the sequence shown in SEQ ID NO.1 is a DNA sequence which is hybridized with the DNA sequence limited by SEQ ID NO.3 and codes the protein with the same function; or a DNA molecule which has more than 70 percent of homology with the DNA sequence limited by SEQ ID NO.3 and codes the same functional protein;

the nucleotide sequence of the transcription factor of the sequence shown in SEQ ID NO.2 is a DNA sequence which is hybridized with the DNA sequence limited by SEQ ID NO.4 and encodes the protein with the same function; or a DNA molecule which has more than 70 percent of homology with the DNA sequence limited by SEQ ID NO.4 and codes the same functional protein.

The gene sequence and the protein function of the gene can be applied to a novel transgenic technology for improving the oil content of seeds of oil-tea trees or other oil crops.

A method for increasing the oil content or protein content of an oil crop, which comprises overexpressing the transcription factor associated with fatty acid synthesis as defined in claim 1 or 2 in an oil crop.

The fatty acids include: at least one of palmitic acid, stearic acid, oleic acid, linoleic acid and linolenic acid.

Further, the transcription factors of the two amino acid sequences of claim 1 are expressed simultaneously or separately in oil crops.

Further, the transcription factor is expressed simultaneously with CoDGAT 1.

The use of a transcription factor associated with fatty acid synthesis, or a DNA molecule encoding a transcription factor associated with fatty acid synthesis, as described above, for increasing the oil content of an oil crop.

Further, the oil crop oil content comprises the oil content in leaves and/or seeds.

The use of a transcription factor involved in fatty acid synthesis, or a DNA molecule encoding a transcription factor involved in fatty acid synthesis, as described above, in oil plant breeding.

By applying the molecular assisted breeding method and the technical means, the camellia oleifera seedling variety with high oil content can be bred more quickly and conveniently than the traditional breeding method.

The method is applied to other fields, improves or controls the oil content of seeds or leaves of energy plants and the whole plants, and increases the energy content ratio of the plants.

In summary, the advantages and positive effects of the invention are:

according to the invention, through analysis and comparison of oil content, oil composition, gene expression and the like of nearly 16 different oil tea varieties, two APETALA2 transcription factors are found from seeds of Changling No.4 of the oil tea variety and named as CoWRI1a and CoWRI1b, amino acid sequences are respectively shown in SEQ ID No.1 and SEQ ID No.2, and nucleotide sequences are respectively shown in SEQ ID No.3 and SEQ ID No. 4. Alignment of the protein sequences of the camellia CoWRI1a and CoWRI1b genes with the AtWRI1 protein sequence shared about 50% and 56% identity of the protein sequences.

According to the invention, through researching the fatty acid content difference and the expression difference of CoWRI1a and CoWRI1b genes in different oil tea varieties, the CoWRI1a and CoWRI1b expression levels in varieties with higher oil content are also high, and the correlation is extremely obvious (the Pearson correlation coefficient is more than 0.89).

According to the invention, the genes CoWRI1a and CoWRI1b are over-expressed in Arabidopsis, and the CoWRI1a and CoWRI1a of Camellia oleifera can complement the shrinking phenotype of the mutant seeds of the pseudo-south atwri1, so that the total oil content is increased to 155% and 136% of the mutant seeds; and the content of fatty acid in the seeds of the arabidopsis transgenic plants is increased, and is respectively increased by 45% and 36% compared with the total fatty acid content of wild plant seeds. In addition, the total seed protein content of transgenic plant lines overexpressing CoWRI1a and CoWRI1a was also significantly increased. The protein content of arabidopsis transgenic plant seeds of CoWRI1a and CoWRI1a increased by 30% and 16%, respectively, compared to wild type seeds.

The present invention found that overexpression of their single genes only slightly significant or not significantly promoted lipid synthesis by injecting CoDGAT1 and CoWRI1a, CoWRI1b, or their composite strains, respectively, in tobacco leaves. However, overexpression of CoDGAT1 by injection with either of CoWRI1a and CoWRI1b significantly increased the synthesis and content of lipids.

Drawings

FIG. 1 is a diagram of the pathway of TAG synthesis and oil droplet assembly regulated by the upstream transcription factor of AtWRI1 transcription factor in Arabidopsis thaliana, and the glycolysis and early fatty acid synthesis pathway genes downstream of AtWRI1 regulation, by other transcription factors;

FIG. 2 is a phylogenetic tree of the CoWRI1a and CoWRI1b genes in Changling No. 4;

FIG. 3 shows the difference in fatty acid content among different Camellia oleifera varieties;

FIG. 4 shows the difference in expression of CoWRI1a and CoWRI1b genes in different varieties of Camellia oleifera;

FIG. 5 shows the expression levels of CoWRI1a and CoWRI1b genes in Changling No.4 in different developmental stages and different tissues;

FIG. 6 is the fatty acid content of Arabidopsis atwri1 mutant and the Camellia CoWRI1a, CoWRI1b transgenic complementation line;

FIG. 7 is the fatty acid content of seed triacylglycerols of the Arabidopsis atwri1 mutant and the Camellia CoWRI1a, CoWRI1b transgenic complementation line;

FIG. 8 shows the total fatty acid content of seeds of Arabidopsis wild type and Camellia oleifera CoWRI1a, CoWRI1b transgenic overexpressing Arabidopsis lines;

FIG. 9 is the fatty acid content of seed triacylglycerols of Arabidopsis wild type and Camellia oleifera CoWRI1a, CoWRI1b transgenic overexpressing Arabidopsis lines;

FIG. 10 is protein content assay of Arabidopsis thaliana wild type, atwri1 mutant, and wild type Arabidopsis transgenic line overexpressing Camellia oleifera CoWRI1a, CoWRI1 b;

FIG. 11 is a total ester extract from co-infected tobacco lamina with CoDGAT1 and CoWRI1a as analyzed by thin layer chromatography;

FIG. 12 is the change in fatty acid content of CoDGAT1 and CoWRI1a, CoWRI1b co-infested tobacco.

Detailed Description

In order to make the objects, technical solutions and advantages of the present invention more apparent, the present invention is further described in detail below with reference to examples, and the equipment and reagents used in the examples and test examples are commercially available without specific reference. The specific embodiments described herein are merely illustrative of the invention and are not intended to be limiting.

The proteins or fragments thereof involved in the present invention may be recombinant, natural, synthetic proteins or fragments thereof; the proteins or fragments thereof involved in the present invention may be naturally purified products, or chemically synthesized products, or produced from prokaryotic or eukaryotic hosts (e.g., bacteria, yeast, plants) using recombinant techniques.

The invention discloses a transcription factor related to fatty acid synthesis, a DNA molecule thereof, a method for improving oil content of oil crops and application thereof. At present, research on homologous genes of WRI in the oil tea trees in China is less, and the sequence and the regulation function of oil synthesis are unknown. According to the invention, through analysis and comparison of oil content, oil composition, gene expression and the like of nearly 16 different oil tea varieties, two APETALA2 transcription factors are found from seeds of Changling No.4 of the oil tea variety and named as CoWRI1a and CoWRI1b, amino acid sequences are respectively shown in SEQ ID No.1 and SEQ ID No.2, and nucleotide sequences are respectively shown in SEQ ID No.3 and SEQ ID No. 4. Alignment of the protein sequences of the camellia CoWRI1a and CoWRI1b genes with the AtWRI1 protein sequence shared about 50% and 56% identity of the protein sequences. Phylogenetic trees of the CoWRI1a and CoWRI1b genes in Changling No.4 are shown in FIG. 2, in which Cs: Camellia sinensis, Vv: and (4) grapes.

The expression of CoWRI1a and CoWRI1b of the oil tea is in close positive correlation with the oil content (the correlation coefficient p is more than 0.8). According to the invention, through gene expression analysis of the gene in the development process of the oil-tea camellia seed, and functional research experiments of transformed yeast mutants, transgenic arabidopsis thaliana, transgenic tobacco leaves and the like, the CoWRI1a and CoWRI1b derived from the oil-tea camellia are proved to be two key genes for regulating and controlling the oil content of the oil-tea camellia seed. The details are shown in the following examples.

The invention relates to a camellia seed sample: the method is characterized in that the camellia oleifera abel is a wild camellia oleifera abel variety, namely Dabieshan No.1, Dabieshan No.2, Dabieshan No.3, Dabieshan No.4, Dabieshan No. 5, Dabieshan No. 6, Dabieshan No. 7, Dabieshan No. 8, Changlin No.4, Changlin No. 27, Changlin No. 40, Changlin No. 53, Changlin No. 166 and a wild camellia oleifera abel variety, plants are planted in DeChang nursery stock Limited, Anhui, and the camellia seed picking time is 7 months and 17 days. Arabidopsis plants: knockout mutants of Arabidopsis Col-0 wild type and atwri 1. Tobacco sample: nicotiana benthamiana (Nicotiana benthamiana) was grown in a light culture chamber at a temperature of 22 ℃ to 25 ℃. Carrier: the cloning vector pGEM-T Easy (Promega, Madison, Wisconsin, USA), the intermediate transition pDONR221 and the vector pB2GW7(Thermal Scientific, Calif., USA) overexpressing the gene of interest.

Example 1 fatty acid content and CoWRI1a and CoWRI1b Gene expression differences in different varieties of Camellia seeds

1. Method for measuring fatty acid content

Extraction of fatty acids: 30mg of camellia seed powder was weighed into a glass bottle, and then 400. mu.L of toluene and 1.5mL of methanol (V/V) containing 0.01% BHT, 2.5% H2SO4 were added, followed by 150. mu.L of internal standard (2mg/mL heptadecanoate). The bottle was purged with nitrogen for about 10 seconds to fill the bottle with nitrogen to prevent oxidation. And (3) covering a cover tightly to prevent air leakage, carrying out water bath at 90 ℃ for 1h, cooling to room temperature, adding 1.8mL of ultrapure water and 1mL of n-hexane, carrying out vortex shaking and uniform mixing, and centrifuging at 2000rpm for 8 min. The supernatant was transferred to a brown sample flask and detected using Agilent chromatograph GC (Agilent Technologies (USA)7890A Network) with Flame Ionization Detector (FID). Each sample was repeated 3 times.

GC detection conditions are as follows: the inlet temperature and detector temperature were set at 180 ℃ and 280 ℃ respectively, 1 μ L of non-split sample was injected, the column model was HP-INNOWAX column (30mx0.32mmx0.5 μm), the column temperature was maintained at 180 ℃ for 2min, then the temperature was raised to 220 ℃ at a rate of 10"C/min, high purity nitrogen (99.9% or more) was used as carrier gas, 30.0mL/min of hydrogen and 300.0mL/min were put into FID, and the analysis procedure was monitored by HP ChemStation (wlett-Packard, Palo Alto, Calif., USA).

2. Method for detecting expression quantity of CoWRI1a and CoWRI1b genes

Specific primers were designed with the following sequences:

qCoWRI1aF:CCAGACCCAGAGGAGCAATC，SEQ ID NO.5；

qCoWRI1aR:CATCTGTGCCTGGTGACTCC，SEQ ID NO.6；

qCoWRI1bF:TCCCGGTTAGCAAATACGCA，SEQ ID NO.7；

qCoWRI1bR:GCTTTGTGTCTTCCCCGTCA，SEQ ID NO.8；

extracting total RNA of camellia seeds in different development stages and different tissues, and performing reverse transcription to obtain cDNA. Carrying out qRT-PCR amplification, wherein the reaction system comprises: SYBR Green Master Mix Reagent: 10 μ L, cDNA template: 2 μ L, 10Um primer-F: 0.4. mu.L, 10Um primer-R: 0.4. mu.L, ddH₂O: 7.2 mu L; the qRT-PCR program was 95 ℃ for 3min, 95 ℃ for 30s, 58 ℃ for 30s, 72 ℃ for 30s, 35 cycles to step 2.

The results are shown in FIGS. 3 and 4. From the results of the oil content measurement of the seeds of the camellia oleifera varieties in fig. 3 and fig. 4 and the comparison between the gene expression of the CoWRI1a and the gene expression of the CoWRI1b, the expression levels of CoWRI1a and CoWRI1b in the seeds of the varieties with higher oil content are also high, and the correlation is extremely significant (the pearson correlation coefficient is greater than 0.89).

Example 2 expression levels of CoWRI1a and CoWRI1b genes in Changling No.4 in different developmental stages and different tissues

Taking Changlin No.4 samples of different development stages and different tissues for detection, the detection method is the same as that of example 1.

The results are shown in FIG. 5, with abscissa: 1. 2, 3, 4, 5 and 6 represent seeds of 6 different developmental stages from young to mature of the camellia oleifera seeds. The abscissa: RT is root ST, stem BD, bud YL, young leaf WL, old leaf FR, fruit FL, flower. The results show that both genes are expressed predominantly specifically in the fruit. CoWRI1a is expressed at a higher level than CoWRI1b and is a major gene.

Example 3 Effect of overexpression of CoWRI1a and CoWRI1b in Arabidopsis on fatty acid and protein content

Firstly, cloning of CoWRI1a, CoWRI1b and CoDGAT1 genes and connection of PGEM-T vector. Wherein the amino acid sequence of the CoDGAT1 gene is shown in SEQ ID NO.13, and the nucleotide sequence is shown in SEQ ID NO. 14.

1. Specific primers were designed with the following sequences:

CoWRI1a-F:ATGAAGAGGTCACCTTCTTCTTG，SEQ ID NO.9；

CoWRI1a-R:CTAATTACAAGGAAACAAGGTGGTG，SEQ ID NO.10；

CoWRI1b-F:ATGAAAATGGTGAAGAACGAGG，SEQ ID NO.11；

CoWRI1b-R:TCACATGGAAGGCATGTCGC，SEQ ID NO.12；

CoDGAT1-F:ATGACGATCCTAGACTCGCC，SEQ ID NO.15；

CoDGAT1-R:TCACTGTGTTTTCTCTATTCTATTC，SEQ ID NO.16；

2. extracting the total RNA of the Changlin No.4 camellia seeds according to the instruction of a plant total RNA extraction kit and a first strand cDNA synthesis kit, and performing reverse transcription to obtain cDNA.

3. The reverse transcription cDNA is used as a template, PCR amplification is carried out by using specific primers, TaKaRa Ex Taq 0.25 mu L, 10xEx Taq Buffer 5 mu L, dNTP mix 4 mu L, cDNA 2.5 mu L, F primer 2 mu L and R primer 2 mu L distilled water are added to the volume of 50 mu L. The amplification program comprises pre-denaturation at 94 ℃ for 5min, denaturation at 94 ℃ for 30s, annealing at 57 ℃ for 30s, extension at 72 ℃ for 1min for 30s, 35 cycles, and extension at 72 ℃ for 10min, and the obtained PCR product is stored at 4 ℃.

4. The PCR product was purified using a PCR purification kit, and 2.5. mu.L of 2X Rapid Ligation Buffer, 0.5. mu.L

Easy Vector,0.5 mu L T4DNA Ligase,1.5 mu L PCR product, connecting to pGEM-T Easy overnight at 4 ℃, then thermally shocking and transforming DH5 α, carrying out colony PCR verification, obtaining positive colonies, extracting colony plasmids, obtaining T vectors containing CoWRI1a, CoWRI1b and CoDGAT1 genes, and simultaneously sending the bacterial liquid to a general biological system (Anhui) limited company, thus obtaining DH5 α large plasmid containing CoWRI1a, CoWRI1b and CoDGAT1 sequencesEnterobacteria.

Second, connection of CoWRI1a, CoWRI1b and CoDGAT1 genes with expression vector

1. Amplification with long primers, pre-denaturation at 94 ℃ for 5min, denaturation at 94 ℃ for 30s, annealing at 57 ℃ for 30s, extension at 72 ℃ for 1min30s, 35 cycles, extension at 72 ℃ for 10min, primer sequence:

LCoWRI1a-F:GGGGACAAGTTTGTACAAAAAAGCAGGCTTCATGAAGAGGTCACCTTCTTCTTG

LCoWRI1a-R:GGGGACCACTTTGTACAAGAAAGCTGGGTCTAATTACAAGGAAACAAGGTGGTG

LCoWRI1b-F:GGGGACAAGTTTGTACAAAAAAGCAGGCTTCATGAAAATGGTGAAGAACGAGG

LCoWRI1b-R:

GGGGACCACTTTGTACAAGAAAGCTGGGTTCACATGGAAGGCATGTCGC

LCoDGAT1-F:

GGGGACAAGTTTGTACAAAAAAGCAGGCTTCATGACGATCCTAGACTCGCCL

CoDGAT1-R:

GGGGACCACTTTGTACAAGAAAGCTGGGTTCACTGTGTTTTCTCTATTCTATTC

sequencing the returned CoWRI1a, CoWRI1b and CoDGAT1 plasmids, recovering gel, connecting the fragments to a vector pDONR221 through BP reaction, transferring the fragments to escherichia coli DH5a through heat shock, screening through a resistance plate, selecting single clone, carrying out amplification culture to extract plasmids, and selecting the clone with reasonable plasmid band size and PCR positive for sequencing.

2. And (3) carrying out LR recombination reaction on the correctly sequenced and returned plasmid and a target vector pB2GW7, transferring the recombinant plasmid into escherichia coli DH5 alpha through heat shock, screening through a resistance plate, selecting single clone, carrying out amplification culture to extract the plasmid, and selecting the clone with a reasonable plasmid band size and PCR (polymerase chain reaction) positive. The extracted target plasmid is transferred into agrobacterium GV3101 by electric shock, and the PCR positive clone capable of growing normally on double-antibody plate is selected for amplification culture.

Third, genetic transformation of Arabidopsis

1. Transformation of Arabidopsis thaliana Col-0 wild type and atwri1 mutants by Agrobacterium-mediated floral infection:

knockout mutants of Arabidopsis Col-0 wild type and atwri 1. Grown in a light incubator, 3 months old plants begin genetic transformation at the flowering stage. The GV3101 Agrobacterium containing CoDGAT1 was obtained by transferring pB2GW7-CoWRI1a and pB2GW7-CoWRI1b into GV3101 Agrobacterium, respectively. The GV3101 containing the gene of interest, which was confirmed to be correct, was cultured (about 200mL) in LB liquid medium containing rifampicin (50mg/mL) and spectinomycin (50mg/mL) overnight at 28 ℃. When the OD600 reaches about 1.0, centrifuging at 4000rpm for 10min, and collecting the thallus. Then 5% sucrose was added to dilute to an OD600 of about 0.8, and 20. mu.L of the surfactant LT-7 was added. Shaking to homogenize, foaming the liquid, and immersing the inflorescence of Arabidopsis into the liquid for about 30 s. The infected Arabidopsis plants were left overnight in the dark. And then taking out the plant to normally grow, and infecting the plant once every other week for three times.

2. Screening transgenic positive plants: the harvested T0 generation seeds are planted in nutrient soil, after about one week of growth, 0.05% Basta spraying is used for screening, and the seeds are sprayed once every 3 days until yellow seedlings die and sporadic possible green positive seedlings appear. And (4) selecting seedlings which grow strongly, green and are not yellowed, transplanting the seedlings into new culture soil, and numbering. After the seedlings grow up, taking the arabidopsis leaves to extract DNA, verifying whether the arabidopsis leaves contain the target gene by PCR, if the arabidopsis leaves contain the target gene, keeping the arabidopsis leaves to continue growing, harvesting the seeds, and if the arabidopsis leaves do not contain the target gene, discarding the seeds.

Fourth, experimental results

1. Determination of fatty acid content

The results of the determination of the fatty acid content of the arabidopsis atwri1 mutant and the camellia CoWRI1a and CoWRI1b transgenic complementary lines are shown in FIG. 6.

The results of the determination of the fatty acid content of triacylglycerols of seeds of the arabidopsis atwri1 mutant and the camellia oleifera oWRI1a and CoWRI1b transgenic complementary lines are shown in FIG. 7.

The experimental results show that: when overexpressed in the arabidopsis atwri1 mutant, the CoWRI1a and CoWRI1a of camellia oleifera can complement the phenotype of seed shrinkage of the arabidopsis atwri1 mutant, increasing the total oil content to 155% and 136% of the mutant seed. Analysis by gas mass spectrometry (GC) showed that the fatty acid composition of the seed oil of the complementary arabidopsis transgenic plants was also altered. Compared with the atwri1 mutant, the palmitic acid content and the stearic acid content are unchanged, the oleic acid content is obviously increased, the linolenic acid content is reduced, and the wild type level is restored. Meanwhile, the contents of long-chain fatty acids such as arachidic acid, peanut dienoic acid, behenic acid and erucic acid are reduced, and the content of arachidonic acid is increased in response.

The results of measuring the total fatty acid content of seeds of arabidopsis wild type and camellia oleifera CoWRI1a and CoWRI1b transgenic over-expression arabidopsis lines are shown in figure 8.

The results of measuring the fatty acid content of triacylglycerols of seeds of arabidopsis wild type and camellia oleifera CoWRI1a, CoWRI1b transgenic overexpression arabidopsis lines are shown in fig. 9.

Fig. 8 and 9 show that: overexpression of CoWRI1a and CoWRI1a in wild type Arabidopsis resulted in an increase in fatty acid content in seeds of Arabidopsis transgenic plants, which increased 45% and 36%, respectively, compared to the total fatty acid content of wild type plant seeds. Analysis by gas phase mass spectrometry (GC-MS) showed that the fatty acid composition of the seed oil was altered. The palmitic acid content is obviously reduced, the oleic acid content is obviously increased, the linoleic acid content is reduced, but the linolenic acid content is slightly increased.

2. Protein content of CoWRI1a and CoWRI1b in Arabidopsis transgenic seeds

Drawing a standard curve: preparing 1mg/mL bovine serum albumin solution as mother liquor, preparing 0, 0.005, 0.01, 0.02, 0.03, 0.04, 0.05mg/mL, adding 100 μ L G250 Coomassie brilliant blue solution, standing for 2min, and measuring absorbance at 595 nm. And (3) drawing a standard curve by taking the protein as an abscissa and the absorbance as an ordinate to obtain a linear regression equation.

10mg of the sample was weighed into a 1.5mL test tube, and 400. mu.L of a protein extract (Tris-HCl 0.05M, pH 8.0, 0.02% SDS, 30.0% urea, 1% mercaptoethanol) was added thereto, extracted at 40 ℃ for 12 hours, and then centrifuged at 13000rpm for 10 minutes. 100. mu.L of the supernatant was added to 1mLG250 Coomassie brilliant blue solution, and the mixture was allowed to stand for 2min and then absorbance was measured at 595 nm.

And calculating the protein content according to the absorbance.

The results of protein content determination of Arabidopsis thaliana wild type, atwri1 mutant, and wild type Arabidopsis thaliana transgenic line overexpressing Camellia oleifera CoWRI1a and CoWRI1b are shown in FIG. 10.

The results in FIG. 10 show that: the oil and protein content in the seeds of the arabidopsis atwri1 mutant was significantly reduced. And CoWRI1a and CoWRI1a of over-expressed oil tea can not only complement the phenotype of reduced grease of seeds of the atwri1 mutant of Arabidopsis thaliana, but also increase the grease content. Overexpression of CoWRI1a and CoWRI1a in Arabidopsis wild type also resulted in an increase in total seed oil content in transgenic plant lines. In addition, the total seed protein content of transgenic plant lines overexpressing CoWRI1a and CoWRI1a was also significantly increased. The protein content of arabidopsis transgenic plant seeds of CoWRI1a and CoWRI1a increased by 30% and 16%, respectively, compared to wild type seeds.

Example 4 synergistic expression of CoDGAT1, CoWRIa and CoWRI1b in tobacco

1. And (3) carrying out amplification culture on GV3101 bacterial liquid of CoDGAT1, CoWRIa and CoWRI1b genes, suspending the bacterial liquid by using a suspension liquid until OD600 is equal to 0.125 after centrifugation, and carrying out incubation for 1.5h at 28 ℃, wherein the CoDGAT1 and CoWRIa bacterial liquid or the CoDGAT1 and CoWRI1b bacterial liquid are mixed and infected into the Nicotiana benthamiana according to the ratio of 1: 1. Lipid analysis used a total of 5 pots of tobacco plants with different combinations of genes and a total of 15 leaves. The samples compared were randomly distributed on the same leaf. After infiltration, the tobacco plants were grown for a further 5 days, and the leaves were harvested and 3 leaves of the same plant were kept together at-80 ℃.

2. TLC detection, weighing 30mg tobacco leaf into a glass bottle with Teflon cover, adding 4mL 4M HCl, standing at room temperature for 30min, and water-bathing at 100 deg.C for 10 min. After cooling to room temperature, 4mL of n-hexane: isopropanol (3:2, v/v), shaking and centrifuging at 2000rpm for 8 min. The upper n-hexane layer was transferred to another clean glass tube and blown dry with slow nitrogen. Finally 50. mu.L of n-hexane was added for TLC analysis. The TLC plate was scraped off and filled into a glass vial having a Teflon cap in the same manner as in example 3.

The results of thin layer chromatography analysis of total ester extracts from CoDGAT1 and CoWRI1a co-infected tobacco leaves are shown in FIG. 11. Meanwhile, CoDGAT1 and CoWRI1b are carried out to infect tobacco leaves together, and the map is not shown.

The results of varying the fatty acid content of coggat 1 and CoWRI1a or CoWRI1b co-infected tobacco are shown in fig. 12.

As can be seen from the TAG isolation of fig. 11 and the fatty acid detection results of fig. 12, the results of the injection of CoDGAT1 and CoWRI1a or CoWRI1b, respectively, or their complex strains, into tobacco leaves showed that the overexpression of their individual genes only slightly or not significantly promoted lipid synthesis. (16:0 palmitic acid, 18:0 stearic acid, 18:1 oleic acid, 18:2 linoleic acid, 18:3 linolenic acid) but overexpression of CoDGAT1 with either of CoWRI1a and CoWRI1b injected significantly increased the synthesis and content of lipids. These experiments further demonstrate that CoWRI1a and CoWRI1b overexpression has the function of promoting the synthesis of vegetable oil.

The above description is only for the purpose of illustrating the preferred embodiments of the present invention and is not to be construed as limiting the invention, and any modifications, equivalents and improvements made within the spirit and principle of the present invention are intended to be included within the scope of the present invention.

Sequence listing

<110> agriculture university of Anhui

<120> transcription factor related to fatty acid synthesis, DNA molecule thereof, method for improving oil content of oil crops and application

<160>16

<170>SIPOSequenceListing 1.0

<210>1

<211>429

<212>PRT

<213> amino acid sequence (CoWRI1a)

<400>1

Met Lys Arg Ser Pro Ser Ser Cys Trp Ser Ser Ser Ser Thr Ser Ser

15 10 15

Val Glu Ser Asp Leu His Pro Ala His His Asp Asp Asp Gln Ser Ala

20 25 30

Gln Arg Lys His Lys Ala Lys Arg Pro Arg Ser Arg Pro Gly Gly Ala

35 40 45

Ser Asn Lys Asn Leu Asn Gln Asn Lys Ser Gln Lys Ile Ile Asn Pro

50 55 60

Asn Ser Pro Arg Arg Ser Ser Ile Tyr Arg Gly Val Thr Arg His Arg

65 70 75 80

Trp Thr Gly Arg Phe Glu Ala His Leu Trp Asp Lys Ser Ser Trp Asn

85 90 95

Ser Ile Gln Asn Lys Lys Gly Arg Gln Ile Tyr Leu Gly Ala Tyr Asp

100 105 110

Asn Glu Glu Ala Ala Ala His Thr Tyr Asp Leu Ala Ala Leu Lys Tyr

115 120 125

Trp Gly Ala Asp Thr Ala Leu Asn Phe Pro Ile Asp Thr Tyr Thr Lys

130 135 140

Glu Leu Gly Glu Met Gln Lys Gln Ser Lys Glu Glu Tyr Leu Ala Ser

145 150 155 160

Leu Arg Arg Gln Ser Ser Gly Phe Ser Arg Gly Val Ser Lys Tyr Arg

165 170 175

Gly Val Ala Arg His His His Asn Gly Arg Trp Glu Ala Arg Ile Gly

180 185 190

Arg Val Phe Gly Asn Lys Tyr Leu Tyr Leu Gly Thr Tyr Ser Thr Gln

195 200 205

Glu Glu Ala Ala Ala Ala Tyr Asp Met Ala Ala Ile Glu Tyr Arg Gly

210 215 220

Pro Asn Ala Val Thr Asn Phe Asp Ile Ser Ile Tyr Ala Gly Arg Leu

225 230 235 240

Lys Lys Asn Lys Ala Leu Leu Asp Glu Gln Pro Gln Gln Pro Asn Pro

245 250 255

Glu Ser Ser Ile Glu Glu Trp Gly Asp Gln Gln Gln Leu Gln His Gln

260 265 270

His His His Arg Leu His Arg Glu Asp Glu Lys Glu Lys Ile Leu Met

275 280 285

Val Pro Gln Pro Gln Pro Leu Asn Leu Glu Phe Pro Pro Ala Ile Asp

290 295 300

Ser Ala Asp His Met Val Val Thr Asp Ser Thr Asn Glu His Asp His

305 310 315 320

Pro Trp Ser Leu Cys Leu Asp Thr Gly Phe Asn Met Leu Pro Val Pro

325330 335

Asp Ile Pro Leu Glu Lys Val Gly Glu Leu Pro Asp Leu Val Asn Asp

340 345 350

Thr Gly Phe Asp Asp Asn Ile Glu Phe Ile Phe Asp Gly Pro Ser Asn

355 360 365

Glu Asn Phe Glu Phe Asn Leu Asp Ser Leu Phe Ile Asp Thr Thr Thr

370 375 380

Asn Leu Val Asp Asn Asp Ile Leu Trp Val Met Glu Glu Lys Glu Arg

385 390 395 400

Ala Gly Leu Thr Ser Pro Pro Pro Pro Ser Pro Ser Ser Ser Ser Pro

405 410 415

Ser Ser Ser Thr Thr Asn Thr Thr Leu Phe Pro Cys Asn

420 425

<210>2

<211>395

<212>PRT

<213> amino acid sequence (CoWRI1b)

<400>2

Met Lys Met Val Lys Asn Glu Glu Asn Pro Gly Arg Arg Ser Arg Ser

1 5 10 15

Arg Val Asp Gly Glu Ala Leu Glu Ala Lys Cys Ala Lys Arg Lys Arg

20 25 30

Arg Asp Pro Ile Pro Ala Cys Asp Asn Gln Gln Ile Glu Gln Pro Gln

35 40 45

Gln Gln Val Tyr Gln Ala Ser Ala Pro Thr Thr Val Lys Arg Ser Ser

50 55 60

Lys Phe Arg Gly Val Ser Lys His Arg Trp Thr Gly Arg Phe Glu Ala

65 70 75 80

His Leu Trp Asp Lys Leu Ser Trp Asn Val Thr Gln Lys Lys Lys Gly

85 90 95

Lys Gln Val Tyr Leu Gly Ala Tyr Asp Glu Glu Glu Ser Ala Ala Arg

100 105 110

Ala Tyr Asp Ser Ala Ala Leu Lys Tyr Trp Gly Thr Ser Thr Phe Thr

115 120 125

Asn Phe Pro Val Ser Asp Tyr Asp Lys Glu Ile Glu Ile Met Gln Thr

130 135 140

Val Thr Lys Glu Glu Tyr Leu Ala Ser Leu Arg Arg Lys Ser Ser Val

145 150 155 160

Phe Ser Arg Gly Val Ser Lys Tyr Arg Gly Val Ala Arg His His His

165 170 175

Asn Gly Arg Trp Glu Ala Arg Ile Gly Arg Val Phe Gly Asn Lys Tyr

180 185 190

Leu Tyr Leu Gly Thr Tyr Ser Thr Gln Glu Glu Ala Ala Arg Ala Tyr

195 200 205

Asp Ile Ala Ala Ile Glu Tyr Arg Gly Ile Asn Ala Val Thr Asn Phe

210 215 220

Asp Leu Ser Ser Tyr Ile Arg Trp Leu His Pro Gly Ala Asn Asn Pro

225 230 235 240

Ile Ala Val Gln Glu Gln Gln Met Asn Thr Glu Ser Gln Ser Val Pro

245 250 255

Ser Ser Asn Phe Ser Ser Gly Glu Glu Phe Gln Ser Leu Leu Phe His

260 265 270

Val Asp Asn Phe Ser Val Asp Asp Leu Asn Phe Pro Gln Lys Gln Glu

275 280 285

Val Ile Glu Arg Lys Phe Pro Val Ser Lys Tyr Ala Glu Ser Ser Ser

290 295 300

Pro Thr Ala Leu Gly Leu Leu Leu Arg Ser Ser Val Phe Lys Glu Leu

305 310 315 320

Val Glu Lys Asn Ser Asn Val Phe Glu Asp Glu Ile Asp Gly Glu Asp

325 330 335

Thr Lys His Gln Leu Gln Met Gly Ser Asp Asp Glu Tyr Ala Arg Ile

340 345 350

Leu Tyr Asp Gly Asn Gly Asp Ile Pro Phe Val Leu Ser Ser Asn Arg

355 360 365

Glu Phe Gln Gly Glu Leu His Phe Thr Tyr Asn Asp Gln Gly Glu Leu

370 375 380

Leu Gly Ala Ala Ser Cys Asp Met Pro Ser Met

385 390 395

<210>3

<211>1290

<212>DNA

<213> Gene sequence (CoWRI1a)

<400>3

atgaagaggt caccttcttc ttgttggtct tcatcttcaa cttcaagtgt tgagtctgat 60

cttcatcctg ctcatcatga tgatgatcaa tcagcccaac gcaagcacaa ggccaagcgt 120

cccagatcca ggcccggagg agcaagcaat aaaaatctca accaaaacaa gtcccagaag 180

attattaatc ccaactctcc cagaagaagc tccatttaca gaggagtcac caggcacaga 240

tggacaggga ggtttgaagc tcatctgtgg gataagagtt catggaatag cattcaaaac 300

aagaaaggaa gacaaattta tttgggggcg tatgataatg aggaagcagc tgctcatacc 360

tacgatctcg cggcccttaa gtattggggc gccgatactg cattgaattt tccgattgat 420

acatatacca aggaacttgg ggaaatgcaa aagcagtcca aggaagagta tttagcttcc 480

ctacggcgcc aaagcagcgg attttccagg ggtgtttcta agtaccgtgg tgtggcaagg 540

caccatcaca atgggcgatg ggaggcacga attgggcggg ttttcggaaa caaatattta 600

tatttgggaa cttacagcac tcaagaagaa gcagcagcag catatgacat ggcagccata 660

gagtacagag gtccaaatgc agttaccaac tttgacatca gcatctatgc aggccgcttg 720

aagaagaaca aagctctttt agatgaacaa ccccaacaac caaatcccga atcctccata 780

gaagagtggg gagatcaaca acaacttcaa catcaacacc accaccgcct ccaccgagaa 840

gatgaaaaag agaaaatatt gatggtgccc caaccccaac ctctaaactt agagttccct 900

cctgccattg actcggctga tcacatggtg gtgacagatt ccaccaacga gcatgatcac 960

ccttggagtc tctgtttgga tacaggattc aatatgcttc cagttcctga cattcccctc 1020

gagaaagtag gtgagctacc agacttggtt aatgacacag ggtttgacga taatattgaa 1080

ttcatctttg atggaccatc caatgaaaat tttgagttca acctagatag cctgttcatt 1140

gacaccacaa ccaacttggt tgataatgat attttgtggg ttatggagga aaaagagcgt 1200

gcaggattga cttcacctcc tcctccttcc ccttcatcgt catcgccgtc ctcttcaacc 1260

accaacacca ccttgtttcc ttgtaattag 1290

<210>4

<211>1188

<212>DNA

<213> Gene sequence (CoWRI1b)

<400>4

atgaaaatgg tgaagaacga ggagaatcca ggaaggagaa gcagaagcag ggtagatgga 60

gaggccttgg aagcaaagtg tgccaagaga aagagaagag atccaatacc cgcgtgcgac 120

aatcaacaaa tagagcagcc acagcagcaa gtatatcaag cttccgcccc taccacagtg 180

aagagaagtt caaagtttcg cggtgtcagc aagcatagat ggacagggcg attcgaagct 240

cacttgtggg ataaactttc ttggaatgtt acacagaaga agaaggggaa acaagtttac 300

cttggagctt atgatgaaga agaatcagca gcaagagcat atgattcagc tgcacttaag 360

tattggggga catcaacttt caccaatttc ccggtgtctg attacgacaa agagattgag 420

ataatgcaaa ccgtaacaaa agaggagtac ctagcctctt taagaagaaa gagcagtgtc 480

ttttcaagag gtgtatcgaa gtacagaggg gttgcaaggc accatcacaa tggaagatgg 540

gaagctagaa taggaagagt ctttggaaat aaatacctct accttggcac ttacagcacc 600

caagaagagg ctgctcgtgc ttacgacatt gcagcaattg agtacagagg catcaatgct 660

gtgaccaact ttgatctaag ttcatacatt agatggctcc atccaggagc aaacaatcca 720

attgctgtgc aagaacaaca gatgaacaca gaatctcagt cagtcccatc ctctaacttc 780

agttcaggag aggaattcca atccttgttg ttccatgtcg ataatttcag tgtagatgac 840

ttgaactttc ctcaaaagca agaagtgatt gaaaggaaat tcccggttag caaatacgca 900

gagtcttcgt ctcccactgc gcttggcctc ctccttcgtt cttcagtatt taaagaattg 960

gtggagaaga attctaatgt attcgaggat gaaattgacg gggaagacac aaagcaccaa 1020

ttacagatgg gtagcgatga cgagtatgca aggatattat atgatggaaa tggtgatatc 1080

ccatttgtgc tctcttccaa tcgtgagttc caaggagagc ttcacttcac ctataatgat 1140

caaggtgaac tgcttggagc agcatcatgc gacatgcctt ccatgtga 1188

<210>5

<211>20

<212>DNA

<213> Artificial sequence (qCoWRI1aF)

<400>5

ccagacccag aggagcaatc 20

<210>6

<211>20

<212>DNA

<213> Artificial sequence (qCoWRI1aR)

<400>6

catctgtgcc tggtgactcc 20

<210>7

<211>20

<212>DNA

<213> Artificial sequence (qCoWRI1bF)

<400>7

tcccggttag caaatacgca 20

<210>8

<211>20

<212>DNA

<213> Artificial sequence (qCoWRI1bR)

<400>8

gctttgtgtc ttccccgtca 20

<210>9

<211>23

<212>DNA

<213> Artificial sequence (CoWRI1a-F)

<400>9

atgaagaggt caccttcttc ttg 23

<210>10

<211>25

<212>DNA

<213> Artificial sequence (CoWRI1a-R)

<400>10

ctaattacaa ggaaacaagg tggtg 25

<210>11

<211>22

<212>DNA

<213> Artificial sequence (CoWRI1b-F)

<400>11

atgaaaatgg tgaagaacga gg 22

<210>12

<211>20

<212>DNA

<213> Artificial sequence (CoWRI1b-R)

<400>12

tcacatggaa ggcatgtcgc 20

<210>13

<211>514

<212>PRT

<213> amino acid sequence (CoDGAT1)

<400>13

Met Thr Ile Leu Asp Ser Pro Glu Ser Val Gly Thr Thr Thr Thr Thr

1 5 10 15

Thr Ser Thr Ala Asp Pro Gly Thr Cys Val Arg Arg Arg Pro Ser Ala

20 25 30

Ala Ala Gly Gly Gly Gly Glu Glu Ala Ile Ser Asp Ser Leu Ser Lys

35 40 45

Thr Ser Ser Leu Glu Thr Asp Ser Leu Val Phe Gly Ser Glu Asn Asp

50 55 60

Gln Ser Gln Ile Gly Asp Gly Asp Gly Gly Asp Lys Val Ala Asn Gly

65 70 75 80

Glu Asp Arg Glu Lys Asp Asn Leu Ala Lys Phe Ser Tyr Arg Pro Ser

85 9095

Ala Pro Ala His Arg Arg Ile Arg Glu Ser Pro Leu Ser Ser Asp Ala

100 105 110

Ile Phe Lys Gln Ser His Ala Gly Leu Phe Asn Leu Cys Ile Val Val

115 120 125

Leu Val Ala Val Asn Ser Arg Leu Ile Ile Glu Asn Leu Met Lys Tyr

130 135 140

Gly Trp Leu Ile Arg Ser Gly Phe Trp Phe Ser Ser Lys Ser Leu Arg

145 150 155 160

Asp Trp Pro Leu Leu Met Cys Cys Ile Thr Leu Leu Leu Phe Pro Leu

165 170 175

Ala Ala Phe Val Val Glu Lys Leu Val Arg Gln Lys Tyr Ile Ser Glu

180 185 190

Pro Val Val Val Ser Leu His Ile Leu Ile Thr Thr Ala Thr Val Leu

195 200 205

Ile Pro Val Phe Val Ile Leu Arg Tyr Asp Ser Ala Val Leu Ser Gly

210 215 220

Val Thr Leu Met Leu Phe Ala Cys Val Val Trp Leu Lys Leu Val Ser

225 230 235 240

Tyr Ala His Thr Asn Tyr Asp Met Arg Ala Leu Ser Lys Ser Leu Asp

245 250 255

Lys Gly Glu Ala Ser Ser Val Ser Ser Asn Val Asn Tyr Ser Tyr Asp

260 265 270

Val Ser Phe Lys Ser Leu Val Tyr Phe Met Val Ala Pro Thr Leu Cys

275 280 285

Tyr Gln Thr Ser Tyr Pro Arg Thr Ala Cys Ile Arg Lys Gly Trp Val

290 295 300

Val Arg Gln Val Ile Lys Leu Val Ile Phe Ser Gly Leu Met Leu Phe

305 310 315 320

Ile Ile Glu Gln Tyr Ile Asn Pro Ile Val Thr Asn Ser Gln His Pro

325 330 335

Leu Lys Gly Asn Leu Leu Tyr Ala Val Glu Arg Val Leu Lys Leu Ser

340 345 350

Val Pro Asn Leu Tyr Val Trp Leu Cys Met Phe Tyr Cys Phe Phe His

355 360 365

Leu Trp Leu Asn Ile Leu Ala Glu Leu Leu Cys Phe Gly Asp Arg Glu

370 375 380

Phe Tyr Lys Asp Trp Trp Asn Ala Gln Thr Val Glu Glu Tyr Trp Arg

385 390 395 400

Met Trp Asn Met Pro Val His Lys Trp Met Val Arg His Ile Tyr Phe

405 410 415

Pro Cys Leu Arg Asn Gly Ile Pro Lys Gly Val Ala Val Leu Ile Ala

420 425 430

Phe Leu Val Ser Ala Val Phe His Glu Leu Cys Ile Ala Val Pro Cys

435 440 445

His Ile Phe Lys Phe Trp Ala Phe Ile Gly Ile Met Phe Gln Val Pro

450 455 460

Leu Val Met Ile Thr Ser Tyr Leu Gln Asn Lys Phe Lys Asn Ser Met

465 470 475 480

Val Gly Asn Met Ile Phe Trp Cys Phe Phe Ser Ile Leu Gly Gln Pro

485 490 495

Met Cys Val Leu Leu Tyr Tyr His Asp Leu Met Asn Arg Ile Glu Lys

500 505 510

Thr Gln

<210>14

<211>1545

<212>DNA

<213> nucleotide sequence (CoDGAT1)

<400>14

atgacgatcc tagactcgcc ggagagcgtc ggcaccacga cgaccacgac gtcgaccgcg 60

gatcccggca cctgcgttcg gcggagaccg agcgccgccg cgggaggagg aggagaagag 120

gccatttctg attcgctctc gaagacgagc tcgttggaaa ctgatagttt ggtttttggt 180

tcggaaaacg atcagagtca gatcggggac ggtgacggcg gcgataaggt tgcgaatgga 240

gaggacaggg agaaggacaa tttggcgaaa ttctcgtacc ggccgtctgc tccggctcac 300

cggagaatca gggagagtcc tctcagctct gacgctatat tcaaacagag tcatgctggt 360

ctcttcaacc tctgtatagt agttcttgtt gctgtaaaca gccggcttat cattgaaaat 420

ctgatgaagt atggctggtt gattaggtct ggtttctggt ttagttcgaa atcattgagg 480

gattggccac ttctaatgtg ctgtattact ctcctgcttt tcccacttgc tgcttttgta 540

gtcgagaagt tggtgcgaca aaagtatata tctgaaccag tggttgtcag ccttcacata 600

ttaataacga cagctacagt tttgattcca gtttttgtga tcctcaggta tgattctgct 660

gttctatctg gcgtcacatt aatgctcttt gcgtgcgttg tgtggctgaa gttggtatcc 720

tatgcacata caaattatga catgagagcg ctttctaagt cacttgataa gggggaggcc 780

tcgtctgttt cttcaaatgt taactactct tatgatgtta gcttcaaaag tttggtttac 840

tttatggtgg ctcccacctt atgttaccag acaagttatc cccgcactgc atgcattcga 900

aagggttggg tggtccgtca agtcatcaag ttggttatat tttcaggact tatgctattt 960

atcatagagc agtacatcaa tccaatcgtt acgaattcac aacatcctct aaaaggaaac 1020

cttttatatg ccgtagagag ggtattgaag ctttcagttc caaatttata tgtgtggctc 1080

tgcatgttct actgcttttt tcatctctgg ttaaacatac ttgctgagct tctctgtttt 1140

ggtgatcgtg aattctacaa agattggtgg aatgcacaaa cagtggagga gtattggaga 1200

atgtggaata tgcctgttca taagtggatg gtccgccata tttattttcc ttgcttacgg 1260

aatggaatac ctaagggggt tgcggtattg attgccttcc ttgtatctgc cgttttccat 1320

gagctatgca ttgctgttcc ctgccacata ttcaaatttt gggcttttat tggaattatg 1380

tttcaggttc ccttggtcat gatcacaagt tatctgcaga acaagttcaa gaattctatg 1440

gttggcaata tgatattctg gtgctttttc agcattctgg gtcaaccaat gtgcgttcta 1500

ctctactacc acgacttgat gaatagaata gagaaaacac agtga 1545

<210>15

<211>20

<212>DNA

<213> Artificial sequence (CoDGAT1-F)

<400>15

atgacgatcc tagactcgcc 20

<210>16

<211>25

<212>DNA

<213> Artificial sequence (CoDGAT1-R)

<400>16

tcactgtgtt ttctctattc tattc 25

Claims (10)

1. A transcription factor involved in fatty acid synthesis, characterized in that: the amino acid sequence of the transcription factor is shown as SEQ ID NO.1 or SEQ ID NO. 2.

2. The transcription factor related to fatty acid synthesis according to claim 1, wherein: the amino acid sequence of the transcription factor is the amino acid sequence which is shown by SEQ ID NO.1 or SEQ ID NO.2 and has the same protein function after the substitution and/or deletion and/or addition of a plurality of amino acid residues; or derived from the amino acid sequence shown in SEQ ID NO.2, has more than 98 percent of homology and has the same protein function.

3. A DNA molecule encoding a transcription factor involved in fatty acid synthesis, wherein: the nucleotide sequence of the transcription factor for coding the sequence shown in SEQ ID NO.1 is shown in SEQ ID NO. 3; the nucleotide sequence of the transcription factor of the sequence shown in SEQ ID NO.2 is shown in SEQ ID NO. 4.

4. A DNA molecule according to claim 3 which encodes a transcription factor involved in fatty acid synthesis, wherein: the nucleotide sequence of the transcription factor of the sequence shown in SEQ ID NO.1 is a DNA sequence which is hybridized with the DNA sequence limited by SEQ ID NO.3 and encodes the protein with the same function; or a DNA molecule which has more than 70 percent of homology with the DNA sequence limited by SEQ ID NO.3 and codes the same functional protein;

the nucleotide sequence of the transcription factor of the sequence shown in SEQ ID NO.2 is a DNA sequence which is hybridized with the DNA sequence limited by SEQ ID NO.4 and encodes the protein with the same function; or a DNA molecule which has more than 70 percent of homology with the DNA sequence limited by SEQ ID NO.4 and codes the same functional protein.

5. A method for improving the oil content or protein content of oil crops is characterized in that: comprising overexpressing in an oil crop plant a transcription factor related to fatty acid synthesis as defined in claim 1 or 2.

6. The method for increasing the oil content or protein content of the oil crops as claimed in claim 5, wherein: the transcription factors of the two amino acid sequences of claim 1 are expressed simultaneously or separately in oil crops.

7. The method for increasing the oil content or protein content of the oil crops as claimed in claim 6, wherein: the transcription factor is expressed simultaneously with CoDGAT 1.

8. Use of the transcription factor related to fatty acid synthesis as claimed in claim 1 or 2, or the DNA molecule encoding the transcription factor related to fatty acid synthesis as claimed in claim 3 or 4 for increasing the oil content of oil crops.

9. Use according to claim 8, characterized in that: the oil content of the oil crops comprises the oil content in leaves and/or seeds.

10. Use of the transcription factor related to fatty acid synthesis according to claim 1 or 2, or the DNA molecule encoding the transcription factor related to fatty acid synthesis according to claim 3 or 4 in oil crop breeding.

Images