CN116555263A - Method for constructing sgRNA combination of new soybean variety and cultivating new soybean variety and application - Google Patents

Abstract

The invention relates to the technical field of genetic engineering, and provides a sgRNA combination for constructing a new soybean variety, a method for cultivating the new soybean variety and application thereof. The sgRNA combination comprises sgRNA-GmLOX1, sgRNA-GmLOX2, sgRNA-GmLOX3 and sgRNA-GmFAD2-1A/B. According to the invention, the CRISPR/Cas9 gene editing technology is utilized to knock out the genes of soybean GmLOX1, gmLOX2, gmLOX3, gmFAD2-1A and GmFAD2-1B, so that the soybean editing material with high oleic acid content and low lipoxygenase content is obtained. And developing molecular markers according to the mutation site information to rapidly and accurately identify the mutation material. The editing material can be used as soybean material or variety suitable for mechanized harvesting, and provides valuable gene resources, germplasm resources and resource identification methods for soybean breeding.

Description

Method for constructing sgRNA combination of new soybean variety and cultivating new soybean variety and application

Technical Field

The invention relates to the technical field of genetic engineering, in particular to a sgRNA combination for constructing a new soybean variety, a method for cultivating the new soybean variety and application thereof.

Background

Soybean (Glycine max l.) is an important food crop that provides quality protein and vegetable oil for humans. Soybean oil plays an important role in common vegetable oils, the quality of which is mainly determined by the fatty acid composition, and generally soybean contains 13% palmitic acid, 4% stearic acid, 20% oleic acid, 55% linoleic acid and 8% linolenic acid. The increased content of oleic acid increases the shelf life of soybean oil and reduces the need for hydrogenation reactions which increase the cost of the pressing process and produce unnecessary trans-fats that further affect human health (aschorio A, willett W C.health effects of trans fatty acids [ J ]. Am J Clin Nutr,1997, 66:1006-1010.). In addition, in the production of biodiesel, oils with high oleic acid content and low saturated fatty acid content are required to improve oxidation stability and increase cold flow. The increased oxidative stability of soybean oils with high oleic acid content also opens up a variety of food and industrial applications such as spray oils and machine lubricants (Butzen S, schnebly S.high-temperature oil soy bean. Crop instruments [ J ],2007,17 (7): 3). There is also a special flavor in the ripened soybeans, which limits the development and application of soybean products. The flavor is mainly that Lipoxygenase (LOXs) catalyzes the oxidation of unsaturated fatty acids such as linoleic acid and linolenic acid to produce volatile compounds that are converted from conjugated unsaturated fatty acid hydroperoxides. In the food processing industry, beany flavors in soy products (oils, soymilk, etc.) are usually removed by heating, microwave processing, and organic solvent extraction, etc., but also add to the cost of production and processing (branch AR. Lipoxygenases: electrical, functions, catalysis, and acquisition of substrate [ J ]. J. Biol Chem,1999, 274:23679-23682). The cultivation of the soybean variety with wide adaptability and high oleic acid and without lipoxygenase is a very effective strategy, can radically solve the problem, eliminates the flavor of the soybean and improves the quality of the soybean oil under the condition of not losing the cost.

The structure and expression of the soybean FAD2 gene family at the genomic level have been previously identified. Among FAD2 genes identified in soybean, FAD2-2 desaturases include FAD2-2A (Glyma 19g 32930), FAD2-2B (Glyma 19g 32940) and FAD2-2C (Glyma 03g 30070), and FAD2-2 desaturases are widely expressed in the vegetative tissues of soybean plants. FAD2-2A is an exception, the expression is not detected, and the FAD2-2A coding region is deleted by 100bp and is predicted to be nonfunctional. Two microsomal FAD2-1 desaturases FAD2-1A (Glyma 10g 42470) and FAD2-1B (Glyma 20g 24530) were expressed predominantly in developing seeds (Okuley J, lightner J, feldmann K, yadav N, lark E, browse J.Arabidopsis FAD2 gene encodes The enzyme that is essential for polyunsaturated li pid synthesis [ J ]. The Plant cell,1994, 6:147-158). FAD2-1A and FAD2-1B are therefore believed to play an important role in controlling oleic acid levels during soybean seed development.

Mature soybean seeds mainly contain three lipoxygenase isoenzymes LOX1, LOX2 and LOX3, encoding glyma 13g347600 (GmLOX 1), glyma 13g347500 (GmLOX 2) and glyma 15g026300 (GmLOX 3), respectively. These isozymes are involved in the formation of bean flavor, LOX2 being the predominant isozyme. Natural or artificial mutants of single, double, and triple lipoxygenase isozymes have been identified and a range of soybean varieties lacking lipoxygenase have been developed using these mutant lines. In the selection of lipoxygenase-free soybean varieties, backcrossing or selfing and several rounds of selection are usually required, which is a time-consuming and laborious process (Bai M, yuan J, kuang H, gong P, li S, zhang Z, liu B, sun J, yang M, yang L, wang D, song S, guan Y.generation ofa multiplex mutagenesis population via pooled CRISPR-Cas9 in soyabean [ J ]. Plant Biotechno J,2020,18 (3): 721-731).

CRISPR/Cas9 is used as a latest gene editing technology, and RNA guides Cas9 protein nuclease to cut and modify a targeted genome at a specific site, so that gene knockout, insertion, replacement and chromosome recombination are realized. As an important tool for researching gene functions in reverse genetics, the gene has the characteristics of simple vector construction, high targeting specificity and the like. And the mutants created by using CRISPR/Cas9 gene editing technology can be used for removing vectors through selfing propagation, and the mutants with removed vectors are expected to be used for plant production.

Disclosure of Invention

The invention aims to provide a method for constructing sgRNA combination of a new soybean variety and cultivating the new soybean variety and application thereof, wherein the method can obtain a soybean editing material with high oleic acid content and low lipoxygenase content, and provides precious gene resources, germplasm resources and resource identification methods for soybean breeding.

In order to achieve the above object, the present invention provides the following technical solutions:

the invention provides an sgRNA combination for constructing a new soybean variety, which comprises sgRNA-GmLOX1, sgRNA-GmLOX2, sgRNA-GmLOX3 and sgRNA-GmFAD2-1A/B, wherein the sequence of the sgRNA-GmLOX1 is shown as SEQ ID NO.1, the sequence of the sgRNA-GmLOX2 is shown as SEQ ID NO.2, the sequence of the sgRNA-GmLOX3 is shown as SEQ ID NO.3, and the sequence of the sgRNA-GmFAD2-1A/B is shown as SEQ ID NO. 4.

The invention provides an expression vector combination for CRISPR/Cas9 editing, which comprises a first expression vector and a second expression vector;

the first expression vector is obtained by cloning the sgRNA-GmLOX1, sgRNA-GmLOX2, sgRNA-GmLOX3 of claim 1 onto the initial expression vector pBSE 401; the second expression vector was obtained by cloning sgRNA-GmFAD2-1A/B onto the initial expression vector pBSE 401.

The invention provides a method for constructing a new soybean variety by using a CRISPR/Cas9 technology, which comprises the following steps:

the first expression vector and the second expression vector are transformed into agrobacterium, soybeans are infected by agrobacterium, and new soybean varieties with GmLOX1, gmLOX2, gmLOX3, gmFAD2-1A and GmFAD2-1B genes deleted are obtained through screening.

Preferably, the agrobacterium comprises agrobacterium EHA105.

Preferably, the soybean-infested portion is a soybean cotyledonary node.

Preferably, the method of selection comprises kanamycin resistance selection and PCR amplification and sequencing of positive plants.

The invention provides application of the sgRNA combination, the CRISPR/Cas9 editing expression vector combination and the method for constructing new soybean varieties in cultivation of high-oleic acid soybean germplasm.

The invention provides application of the sgRNA combination, the CRISPR/Cas9 editing expression vector combination and the method for constructing new soybean varieties in cultivation of soybean germplasm without beany flavor.

The invention also provides a primer group for identifying the new soybean variety, which comprises primers for detecting a GmLOX1 locus, a GmLOX2 locus and a GmLOX3 locus;

the upstream and downstream primer sequences of the GmLOX1 locus are shown in SEQ ID NO.5 and SEQ ID NO. 6;

the upstream and downstream primer sequences for detecting the GmLOX2 locus are shown in SEQ ID NO.7 and SEQ ID NO. 8;

the upstream and downstream primer sequences for detecting the GmLOX3 locus are shown as SEQ ID NO.9 and SEQ ID NO. 10.

Compared with the prior art, the invention has the beneficial effects that:

according to the multi-gene editing excellent soybean material based on CRISPR/Cas9, the CRISPR/Cas9 gene editing technology is utilized to knock out the genes of soybean GmLOX1, gmLOX2, gmLOX3, gmFAD2-1A and GmFAD2-1B, so that the soybean editing material with high oleic acid content and low lipoxygenase content is obtained. The editing material can be used as soybean material or variety suitable for mechanized harvesting, and provides valuable gene resources and germplasm resources for soybean breeding.

Drawings

FIG. 1 is a view of the position of an editing site on a gene;

FIG. 2 is a schematic diagram of a CRISPR/Cas9 gene editing vector structure;

FIG. 3 is a diagram of PCR screening and identification of soybean mutant materials;

FIG. 4 shows the DNA sequencing results of the editing material in the target site region;

FIG. 5 shows the results of the assay for the LOX1 enzyme activity of the editing material; wherein A shows the color reaction result of each sample; b shows the absorbance of each sample; CK (water) represents ultrapure water, WT represents medium ji 602 having LOX1 enzyme activity; WT is colorless, while CK (water) and Y1 appear blue, indicating that Y1 does not contain LOX1 enzyme activity;

FIG. 6 shows the results of the assay for the LOX2 enzyme activity of the editing material; wherein A shows the color reaction result of each sample; b shows the absorbance of each sample; CK (water) represents ultrapure water, WT represents medium ji 602 having LOX1 enzyme activity; WT is colorless, while CK (water) and Y1 show yellow color, indicating that Y1 does not contain LOX2 enzyme activity;

FIG. 7 shows the results of the assay for the LOX3 enzyme activity of the editing material; wherein A shows the color reaction result of each sample; b shows the absorbance of each sample; CK (water) represents ultrapure water, WT represents medium ji 602 having LOX1 enzyme activity; WT is colorless, while CK (water) and Y1 appear blue, indicating that Y1 does not contain LOX3 enzyme activity;

FIG. 8 is an identification result of the Lox isozymes of the editing material;

FIG. 9 is an edit material fatty acid detection result;

FIG. 10 shows the results of rapid identification of edited material using molecular markers.

Detailed Description

The invention provides a sgRNA combination for constructing new soybean varieties, which comprises sgRNA-GmLOX1, sgRNA-GmLOX2, sgRNA-GmLOX3 and sgRNA-GmFAD2-1A/B.

In the present invention, the sgRNA-GmLOX1 is designed according to the first exon of the GmLOX1 gene, the sgRNA-GmLOX2 is designed according to the first exon of the GmLOX2 gene, the sgRNA-GmLOX3 is designed according to the first exon of the GmLOX3 gene, and the sgRNA-GmFAD2-1A/B is designed according to the first exon of the GmFAD2-1A gene and the second exon of the GmFAD2-1B gene. The position diagram of the GmLOX1, gmLOX2, gmLOX3 and GmFAD2-1A, gmFAD2-1B editing sites on the genes is shown in FIG. 1. The sequences of the above-mentioned sgRNA-GmLOX1, sgRNA-GmLOX2, sgRNA-GmLOX3 and sgRNA-GmFAD2-1A/B are as follows:

sgRNA-GmLOX1(SEQ ID NO.1)：5’-TTCAGCTCATTAGTGCTACC-3’；

sgRNA-GmLOX2(SEQ ID NO.2)：5’-CAACGTTGTTGGCTCAACA C-3’；

sgRNA-GmLOX3(SEQ ID NO.3)：5’-GGTCAAGGTCTCGACTTAGT-3’；

sgRNA-GmFAD2-1A/B(SEQ ID NO.4)：5’-CATTGCATGGCCAATCT ATT-3’。

the invention provides an expression vector combination for CRISPR/Cas9 editing, which comprises a first expression vector and a second expression vector;

the first expression vector is obtained by cloning the above sgRNA-GmLOX1, sgRNA-GmLOX2 and sgRNA-GmLOX3 onto an initial expression vector pBSE 401; the second expression vector was obtained by cloning the abovementioned sgRNA-GmFAD2-1A/B onto the initial expression vector pBSE 401.

The invention provides a method for constructing a new soybean variety by using a CRISPR/Cas9 technology, which comprises the following steps:

the first expression vector and the second expression vector are transformed into agrobacterium, soybeans are infected by agrobacterium, and new soybean varieties with GmLOX1, gmLOX2, gmLOX3, gmFAD2-1A and GmFAD2-1B genes deleted are obtained through screening.

In the present invention, the agrobacterium includes agrobacterium EHA105.

In the invention, the soybean-infected part is a soybean cotyledon section.

In the present invention, the screening method comprises kanamycin resistance screening and positive plant PCR amplification and sequencing.

In the invention, the primer sequences used for PCR amplification of the positive plants are as follows:

upstream primer GmLOX1-F of sgRNA-GmLOX1 (SEQ ID NO. 11): 5'-TAC CCATGATAGCTTTGGTTG-3';

downstream primer GmLOX1-R of sgRNA-GmLOX1 (SEQ ID NO. 12): 5'-CCC AAAGTTGGTAACGAAGTAT-3';

upstream primer GmLOX2-F of sgRNA-GmLOX2 (SEQ ID NO. 13): 5'-GTT TTCAGTTCCAGGGGTG-3';

downstream primer GmLOX2-R of sgRNA-GmLOX2 (SEQ ID NO. 14): 5'-CAT TAGAGACGGACAAATGAAC-3';

upstream primer GmLOX3-F of sgRNA-GmLOX3 (SEQ ID NO. 15): 5'-GTT GGTGGGTTGCAAAGATGCTTG-3';

downstream primer GmLOX3-R of sgRNA-GmLOX3 (SEQ ID NO. 16): 5'-GGA GGACACGCGTCATGATTA-3';

upstream primer GmFAD2-1A-F of sgRNA-GmFAD2-1A (SEQ ID NO. 17): 5'-CAGCAAAACAACTGAAACTCAAC-3';

downstream primer GmFAD2-1A-R of sgRNA-GmFAD2-1A (SEQ ID NO. 18): 5'-CAGGGTTGCAACACGGTAGA-3';

upstream primer GmFAD2-1B-F of sgRNA-GmFAD2-1B (SEQ ID NO. 19): 5'-TCTAATCTGTCACTTCCCTCCATTC-3';

downstream primer GmFAD2-1B-R of sgRNA-GmFAD2-1B (SEQ ID NO. 20): 5'-ATAGCAGCCAAACCAACCCT-3'.

The invention provides application of the sgRNA combination, the CRISPR/Cas9 editing expression vector combination and the method for constructing new soybean varieties in cultivation of high-oleic acid soybean germplasm.

The invention provides application of the sgRNA combination, the CRISPR/Cas9 editing expression vector combination and the method for constructing new soybean varieties in cultivation of soybean germplasm without beany flavor.

The invention also provides a primer group for identifying the new soybean variety, which comprises primers for detecting a GmLOX1 locus, a GmLOX2 locus and a GmLOX3 locus;

the sequence of the primer upstream and downstream of the GmLOX1 locus is shown as follows:

upstream primer (SEQ ID NO. 5): GTTGATGCCCAAGAATGAGT;

downstream primer (SEQ ID NO. 6): AAAAGTGAAACGATGAAGAA.

The sequence of the upstream and downstream primers for detecting GmLOX2 locus is as follows:

upstream primer (SEQ ID NO. 7): TTACTAAAGGAAATGTTGGGGGAC;

downstream primer (SEQ ID NO. 8): GTGTTATTGATTATGTGGAAGGAAG.

The sequence of the primer upstream and downstream of the GmLOX3 locus is shown as follows:

upstream primer (SEQ ID NO. 9): GACGTGAATAGCGTAACCAG;

downstream primer (SEQ ID NO. 10): GCCCAAGAAGGCAGTAAGAG.

The technical solutions provided by the present invention are described in detail below with reference to examples, but they should not be construed as limiting the scope of the present invention.

EXAMPLE 1 construction of Multi-Gene editing vector

Construction of sgRNA combinations from the soybean GmLOX1, gmLOX2, gmLOX3, gmFAD2-1A and GmFAD2-1B genes: sgRNA-GmLOX1 (SEQ ID NO. 1), sgRNA-GmLOX2 (SEQ ID NO. 2), sgRNA-GmLOX3 (SEQ ID NO. 3) and sgRNA-GmFAD2-1A/B (SEQ ID NO. 4). The pBSE401 vector (purchased from Tianjin Ji Nuowo Biotechnology Co., ltd.) was used as the initial expression vector, and sgRNA-GmLOX1, sgRNA-GmLOX2 and sgRNA-GmLOX3 were constructed on one vector, and sgRNA-GmFAD2-1A/B was constructed on the other vector, and two edited vectors obtained by the construction were shown in FIG. 2.

EXAMPLE 2 Stable transformation of soybeans

Two editing vectors prepared in example 1 were transformed into Agrobacterium EHA105 competent cells by: competent Agrobacterium EHA105 cells (purchased from Beijing Optimuno technologies Co., ltd.) were removed from-80℃and rapidly inserted into ice for 5min, after which the pellet was thawed, the two carriers of example 1 were added and the EP tube bottom was hand-pulled, gently mixed, and left to stand in ice for 30min; placing into liquid nitrogen for 2min, and rapidly placing into a water bath at 37deg.C for 5min. Adding 400 mu L of sterile LB culture medium without antibiotics into the centrifuge tube, uniformly mixing, and recovering for 4 hours at 28 ℃ by a 180rpm shaking table; mu.L of the supernatant was taken, resuspended pellet was gently blown and spread onto LB medium containing the corresponding antibiotic (concentrations were 50 mg/L). The plates were placed in an incubator at 28℃overnight.

And adopting an agrobacterium infection cotyledonary node method to perform soybean stable transformation. The acceptor variety used for soybean stable genetic transformation is Ji 602 in northeast variety, and the resistance is glyphosate. The specific process is as follows: placing the chlorine sterilized Zhongji 602 seeds in a culture dish, taking cotyledonary nodes as explants after germination to carry out agrobacterium infection, and carrying out processes of induction culture, elongation culture, rooting culture and the like on the explants to obtain 103 plants stably transformed in the T0 generation.

EXAMPLE 3 Multi-Gene editing mutant screening

Screening positive plants, identifying sgRNA distribution conditions and detecting targeted gene editing conditions of the soybean plants obtained in the example 2, taking seeds harvested from T0 generation five-site heterozygous editing plants, and planting the seeds in a growing chamber by potting to obtain T1 generation plants. Extracting DNA from leaves of T1 generation plants by using a CTAB method, and carrying out PCR amplification by using primers SEQ ID 11-SEQ ID 20, wherein a PCR reaction system (25 μl): 1 μl of template; KOD One PCR Master Mix 12.5.5 μl; 0.5. Mu.l each of the upstream and downstream primers; 10.5 μl of deionized water. PCR reaction procedure: pre-denaturation at 95℃for 3min; denaturation at 95 ℃ for 30s, annealing at 58 ℃ for 30s, extension at 72 ℃ for 1min, and 34 cycles of denaturation, annealing and extension are performed; finally, the extension is carried out for 3min at 72 ℃. 1.5 μl of the amplified product was pipetted for identifying the amplification result by agarose gel electrophoresis, the electrophoresis result is shown in FIG. 3, wherein lane 1 is a positive control and lane 2 is soybean. And (3) carrying out Sanger sequencing on the rest products to detect five gene editing conditions, so as to obtain a homozygous editing material Y1, wherein the DNA sequencing result of the editing material Y1 in a target site area is shown in fig. 4, wherein A is a GmLOX1 site sequencing result, B is a GmLOX2 site sequencing result, C is a GmLOX3 site sequencing result, D is a GmFAD2-1A site sequencing result, and E is a GmFAD2-1B site sequencing result. And (3) counting 103 soybean gene editing conditions, and displaying the results: at least one target site of 72T 0 positive transgenic plants in 103T 0 positive seedlings is mutated, wherein the editing efficiency of the target site of GmLOX1 is 47%, the editing efficiency of the target site of GmLOX2 is 47%, the editing efficiency of the target site of GmLOX3 is only 7%, the editing efficiency of the target site of GmFAD2-1A is 46%, and the editing efficiency of the target site of GmFAD2-1B is 45%.

EXAMPLE 4 homozygous editing Material Y1 qualification

1. Lipoxygenase assay

Seeds harvested at maturity after the editing material Y1 planting were used to determine LOX enzyme activity. LOX enzyme activity is measured by colorimetric assayThe flow is as follows: 1) The dried seed samples were separately ground to a powder. 2) Seed sample powders 15, 30 and 15mg were weighed respectively, and 0.2mol/L in 1.5mL each ^-1 Sodium borate buffer (pH 9.0), 1.5mL of 0.2mol L ^-1 Sodium phosphate buffer (pH 6.0) and 1.5mL of 0.2mol/L ^-1 Lipoxygenase solutions 1, 2 and 3 (designated LS1, LS2 and LS3 for detection of LOX1, LOX2, LOX3, respectively) were extracted in sodium phosphate buffer (pH 6.6), and were subjected to stationary extraction at 4℃for 1 hour, followed by centrifugation (12000 rpm,5min,4 ℃) to obtain supernatants. 3) Detection of LOX1 enzyme activity: 0.5mL of LS1 was added to 1.0mL of substrate solution 1 (containing 0.125mol/L sodium borate buffer at pH 9.0) ^-1 Methylene blue 12.5. Mu. Mol/L ^-1 1.375mmol/L sodium linoleate substrate ^-1 ). Detection of LOX2 enzyme activity: 0.5mL of LS2 was added to 1.0mL of substrate solution 2 (containing 0.125mol/L sodium phosphate buffer solution at pH 6.0) ^-1 Methylene blue 12.5. Mu. Mol/L ^-1 1.375mmol/L sodium linoleate substrate ^-1 Dithiothreitol 25mmol/L ^-1 Acetone 12.5%). Detection of LOX3 enzyme activity: 0.5mL of LS3 was added to 1.0mL of substrate solution 3 (containing 0.125mol/L sodium phosphate buffer solution at pH 6.6) ^-1 1.375mmol/L sodium linoleate substrate ^-1 12.5% of beta-carotene substrate). After mixing, each reaction was incubated in a clear centrifuge tube for 15min and the solution color was recorded (LOX 1 and LOX2 are colorless or blue, and LOX3 is colorless or yellow). 4) At 660nm (for measuring LOX1 and LOX 2) and 452nm (for measuring LOX 3), the measurement was performed with a spectrophotometer (UV-1600; shimadzu, kyoto, japan) to determine the absorbance of each sample.

The results of the measurements are shown in FIGS. 5 to 7, wherein FIG. 5 shows the results of the measurement of the LOX1 enzyme activity of the editing material, CK (water) represents ultrapure water, ZJ602 represents Zhongji 602 having the LOX1 enzyme activity, WT is colorless, and CK (water) and Y1 show blue, indicating that Y1 does not contain the LOX1 enzyme activity. FIG. 6 is a graph showing the results of measuring the activity of LOX2 enzyme of the editing material, CK (water) represents ultrapure water, ZJ602 represents Zhongji 602 having the activity of LOX1 enzyme, WT is colorless, and CK (water) and Y1 show blue colors, indicating that Y1 does not contain the activity of LOX2 enzyme. FIG. 7 is a graph showing the results of measuring the activity of LOX3 enzyme of the editing material, CK represents ultrapure water, ZJ602 represents Zhongji 602 having the activity of LOX1 enzyme, WT is colorless, and CK (water) and Y1 show yellow color, indicating that Y1 does not contain the activity of LOX2 enzyme. As is clear from FIGS. 5 to 7, the homozygously edited material Y1 was a full deletion mutant, and did not contain LOX enzyme activity.

SDS-PAGE electrophoresis Lox isozymes identification

1) Sample treatment:

weighing 3mg of the seed powder, placing into a 2mL centrifuge tube, adding 300 mu L of protein extract, stirring uniformly by using a vibrator, centrifuging for 5min at 12000r/min, and taking 10 mu L for SDS-PAGE electrophoresis analysis.

2) Preparing polyacrylamide gel:

and (3) solution A: SDS 2.0g, tris 181.2g, 1 mol.L ^-1 HCl adjusts pH to 8.8, and finally distilled water is added to fix volume to 500mL.

And C, liquid: acylamide 30g, bisacrylamide 0.8g and distilled water to a volume of 100mL.

And (3) P solution: 1.5g of ammonium persulfate, and distilled water was added to 100mL.

And (2) liquid B: SDS 4g, tris 15g, distilled water to 500mL.

E, liquid: riboflavin 4mg, 100mL of distilled water was added and mixed well.

3) Preparation of the reaction solution

The aglycone 14.4g,Tris 3.0g,SDS 1.25g is added with 1000mL distilled water and evenly mixed to prepare the electrophoresis buffer solution. And (5) adding 440mL of ethanol (analytical alcohol) and 60mL of acetic acid into Ma Si brilliant blue R-2501.5g, and adding distilled water to 1000mL to prepare a staining solution. 200mL of methanol and 50mL of acetic acid are measured by a measuring cylinder, distilled water is added to 1000mL, and the mixture is uniformly mixed to prepare decolorized solution.

4) Assembly of glass sheets

The method comprises the steps of preparing a glass plate for common SDS-PAGE with the glue thickness of 1mm, wiping the inner surface of the glass plate with 70% ethanol, airing, placing sealing silica gel strips (or silica gel tubes) for glue leakage prevention, fixing 2 plates on the left side and the right side of the glass plate respectively by using 4 large-size long tail clips, and vertically placing the glass plate on a horizontal experiment table.

5) Preparation of separation gel

Taking 1 piece of glue with the specification of 10cm multiplied by 8cm multiplied by 1mm as an example, 6.75% of polyacrylamide gel liquid, namely adding 1.25mL of A liquid, 1.13mL of C liquid and 0.25mL of P liquid into a10 mL centrifuge tube according to the sequence of 2.38mL of distilled water, fully and uniformly mixing, adding TEMED 4uL, uniformly mixing, uniformly pouring into a gap of a glass plate, slightly dripping a proper amount of distilled water at the upper part of the glue surface to prevent the glue surface from drying, standing at room temperature for 20-30 min for solidification, pouring out the upper distilled water, standing upside down on a table top, and removing residual water for standby.

6) Preparation of concentrated gel

1.07mL of liquid B, 0.33mL of liquid C, 0.43mL of liquid E and 0.07mL of liquid P are sequentially added according to the following sequence, after the mixture is fully and uniformly mixed with 0.10mL of distilled water, TEMED 2uL is added and uniformly mixed, the mixture is evenly poured into the upper layer of the separation gel, a comb is inserted, and the mixture is placed at room temperature for 20 to 30 minutes. After the gel is solidified, the fixing clamp is removed, the incomplete solidified residual gel is gently washed by distilled water, and the residual gel is wrapped by a preservative film and is inverted and refrigerated at 4 ℃ for standby.

7) SDS-PAGE electrophoresis

From the result of electrophoresis, the deletion state of the Lox isozymes was confirmed, and as shown in fig. 8, it was found from fig. 8 that all three Lox isozymes in the editing material Y1 were deleted.

3. Fatty acid content detection

The Y1 material is planted and then harvested to obtain a T2 generation seed, the T2 generation seed is subjected to fatty acid content detection, a first internal standard method of national standard GB5009.168-2016 is adopted, a gas chromatography method is used for five fatty acid determination of a receptor material and a transgenic editing material, the result is shown in figure 9, and the oleic acid content of the editing material Y1 is improved to more than 80% as can be seen from figure 9.

Example 5 identification of editing Material Using molecular markers

Electrophoresis verification was performed on GmLOX1, gmLOX2 site and GmLOX3 site, respectively.

1.GmLOX1, gmLOX3 site verification

The site electrophoresis verification of GmLOX1 and GmLOX3 is carried out by using 6% polyacrylamide gel electrophoresis, the PCR amplification reaction is carried out by using the extracted soybean seed DNA as a template, a molecular marker as a primer and using Easy Taq enzyme, the reaction system is 20 mu L, the template is diluted to 20ng 2 mu L, the concentration of the upstream primer and the downstream primer is 2 mu L respectively (2 mu M), the Easy Taq enzyme is 0.5 mu L, dNTP is 1.5 mu L and buffer is 2 mu L. The primers used for verifying the GmLOX1 locus are shown in SEQ ID NO. 5-SEQ ID NO.6, and the primers used for verifying the GmLOX3 locus are shown in SEQ ID NO. 7-SEQ ID NO. 8. The reaction procedure: pre-denaturing at 95 ℃ for 5min, denaturing at 95 ℃ for 30s, annealing at 55 ℃ for 30s, extending at 72 ℃ for 30s, performing denaturation, annealing and extension for 25 cycles, preserving at 4 ℃ finally, and separating the amplified product by using 6% denatured polypropylene gel electrophoresis.

2.GmLOX2 site verification

The method comprises the steps of identifying GmLOX2 sites by agarose gel electrophoresis, weighing 0.4g of agar, correspondingly adding 40mL of 1xTAE solution, dissolving for 2min by a microwave oven, cleaning a gel groove in the process of dissolving the agar by the microwave oven, putting into a gel manufacturing plate, then inserting a comb with a proper aperture into a fixed clamping groove of the gel groove, after the agar is fully melted, cooling to 50-60 ℃ in water at too high temperature, adding EB (ethidium bromide) or TB Green dye, fully and uniformly mixing, pouring the agar solution gently along one side of the gel manufacturing plate to avoid generating bubbles, but also avoiding long agar solidification, and after the agar is solidified for about 20min, vertically and slowly pulling out the comb to avoid damaging gel holes. After agarose gel preparation is completed, placing the agarose gel into an electrophoresis tank for electrophoresis, pouring 1xTAE electrophoresis solution during electrophoresis, immersing the gel, sequentially adding samples (after bromophenol blue is added) into sample application holes by using a10 uL pipetting gun, turning on a power supply of an electrophoresis apparatus, setting voltage to 140V, finishing after electrophoresis for 25min, and comparing the sizes of the strips according to the gel.

As shown in FIG. 10, the size of the GmLOX1 locus product is 145bp, and the size of the editing material product is 143bp as shown in FIG. 10; the size of the GmLOX2 locus product is 162bp, and the size of the editing material product is 103bp; the size of the GmLOX3 locus product is 92bp, and the size of the editing material product is 96bp.

The electrophoresis verification is performed similarly for the GmFAD2-1A site and the GmFAD2-1B site, and the experimental procedure is the same as that for the verification of the GmLOX1 and GmLOX3 sites.

From the above examples, the present invention provides a method for constructing sgRNA combinations of new soybean varieties and cultivating new soybean varieties and application thereof, which can obtain soybean editing materials with high oleic acid content and low lipoxygenase content, and provides valuable genetic resources, germplasm resources and resource identification methods for soybean breeding.

The foregoing is merely a preferred embodiment of the present invention and it should be noted that modifications and adaptations to those skilled in the art may be made without departing from the principles of the present invention, which are intended to be comprehended within the scope of the present invention.

Claims (9)

1. The sgRNA combination for constructing the new soybean variety is characterized by comprising sgRN A-GmLOX1, sgRNA-GmLOX2, sgRNA-GmLOX3 and sgRNA-GmFAD2-1A/B, wherein the sequence of the sgRNA-GmLOX1 is shown as SEQ ID NO.1, the sequence of the sgRNA-GmL OX2 is shown as SEQ ID NO.2, the sequence of the sgRNA-GmLOX3 is shown as SEQ ID NO.3, and the sequence of the sgRNA-GmFAD2-1A/B is shown as SEQ ID NO. 4.

2. An expression vector combination for CRISPR/Cas9 editing, which is characterized by comprising a first expression vector and a second expression vector;

the first expression vector is obtained by cloning the sgRNA-GmLOX1, sgRNA-GmLOX2, sgRNA-GmLOX3 of claim 1 onto the initial expression vector pBSE 401; the second expression vector was obtained by cloning sgRNA-GmFAD2-1A/B onto the initial expression vector pBSE 401.

3. A method for constructing a new soybean variety by using CRISPR/Cas9 technology, which is characterized by comprising the following steps:

the first expression vector and the second expression vector of claim 2 are transformed into agrobacterium, soybeans are infected by using agrobacterium, and new soybean varieties with deleted genes of GmLOX1, gmLOX2, gmLOX3, gmFAD2-1A and GmFAD2-1B are obtained by screening.

4. A method according to claim 3, wherein the agrobacterium comprises agrobacterium EHA105.

5. A method according to claim 3, wherein the locus of the infested soybean is a cotyledonary node of soybean.

6. The method of claim 3, wherein the screening method comprises kanamycin resistance screening and positive plant PCR amplification and sequencing.

7. Use of the sgRNA combination of claim 1, the CRISPR/Cas9 editing expression vector combination of claim 2 or the method of any one of claims 3 to 6 for breeding high oleic acid soybean germplasm.

8. Use of the sgRNA combination of claim 1, the CRISPR/Cas9 editing expression vector combination of claim 2, or the method of any one of claims 3 to 6 for cultivating beany-free soybean germplasm.

9. A primer set for identifying a new soybean variety of claim 3, comprising primers for detecting GmLOX1 site, gmLOX2 site and GmLOX3 site;

the upstream and downstream primer sequences of the GmLOX1 locus are shown in SEQ ID NO.5 and SEQ ID NO. 6;

the upstream and downstream primer sequences for detecting the GmLOX2 locus are shown in SEQ ID NO.7 and SEQ ID NO. 8;

the upstream and downstream primer sequences for detecting the GmLOX3 locus are shown as SEQ ID NO.9 and SEQ ID NO. 10.