CN105349682A - C-KIT gene D816V mutation fluorescent PCR detection kit - Google Patents
C-KIT gene D816V mutation fluorescent PCR detection kit Download PDFInfo
- Publication number
- CN105349682A CN105349682A CN201510888493.1A CN201510888493A CN105349682A CN 105349682 A CN105349682 A CN 105349682A CN 201510888493 A CN201510888493 A CN 201510888493A CN 105349682 A CN105349682 A CN 105349682A
- Authority
- CN
- China
- Prior art keywords
- kit
- gene
- fluorescence pcr
- detection reagent
- sudden change
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6883—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
- C12Q1/6886—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material for cancer
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6844—Nucleic acid amplification reactions
- C12Q1/6858—Allele-specific amplification
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/156—Polymorphic or mutational markers
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Organic Chemistry (AREA)
- Health & Medical Sciences (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Engineering & Computer Science (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Immunology (AREA)
- Genetics & Genomics (AREA)
- Analytical Chemistry (AREA)
- General Engineering & Computer Science (AREA)
- Pathology (AREA)
- Biotechnology (AREA)
- Microbiology (AREA)
- Molecular Biology (AREA)
- General Health & Medical Sciences (AREA)
- Physics & Mathematics (AREA)
- Biophysics (AREA)
- Biochemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Oncology (AREA)
- Hospice & Palliative Care (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
- Investigating Or Analysing Materials By The Use Of Chemical Reactions (AREA)
Abstract
The invention provides a C-KIT gene D816V mutation fluorescent PCR detection kit which comprises a D816V mutation detection reaction liquid. The D816V mutation detection reaction liquid comprises a 10*PCR buffer solution, deoxyribonucleoside triphosphate, a forward primer and a reverse primer which are used for amplification of target polynucleotide, and a probe used for detection of target polynucleotide. The C-KIT gene D816V mutation fluorescent PCR detection kit provided by the invention is a detection kit based on a real-time fluorescent quantitative PCR technology and an ARMS-PCR technology, is very high in specificity, quick to operate, simple and convenient in method, and high in detection precision, and can effectively prevent false-negative results due to an internal standard added in a reaction system.
Description
Technical field
The present invention relates to technical field of medical detection, more specifically, relate to a kind of C-KIT gene D816V sudden change fluorescence PCR detection reagent kit.
Background technology
C-KIT gene is positioned at human chromosome 4q12-13, belongs to proto-oncogene, and the product of C-KIT gene is III type tyrosine kinase.After C-KIT expression of proto-oncogenes product C-KIT acceptor is combined with its part cytokine, tyrosine residues phosphorylation can be excited, thus regulate the growth of cell, the aspects such as the propagation of tumour, pernicious evolution and apoptosis are all played an important role.Inhibitor imatinib mesylate (imatinib) for C-KIT development is a kind of tyrosine kinase inhibitor, its mechanism of action is that medicine is incorporated into the ATP-binding site of Tyrosylprotein kinase functional zone in C-KIT albumen endochylema, block phosphate group by the transfer of ATP to substrate tyrosine residue, thus antiproliferative effect recover apoptotic program.Research finds, GIST (the GastrointestinalStromalTumors of about 80%, i.e. gastrointestinal stromal tumor) there is the sudden change of coding C-KIT receptor tyrosine kinase acceptor gene, late in GIST patient, the patient about 90% having C-KIT exons 11 to suddenly change can produce response to treatment with imatinib, the patient about 50% having C-KIT exon 9 to suddenly change can produce response to treatment with imatinib, and imatinib dosage is increased to 800mg from the 400mg of standard and can improves treatment response rate, the majority sudden change of C-KIT gene produces response to imatinib, and the D816V sudden change of exons 17 produces resistance to imatinib.Therefore, if treatment GIST should give tyrosine kinase inhibitor, then the genetics that should carry out tumour detects, because whether the sudden change of C-KIT specific region replys relevant to treatment with tyrosine kinase inhibitors.
Research shows, due to the difference of patient gene's background, the validity of medicine metabolism in vivo, pharmacological agent and the prognosis of side reaction, even patient all exist individual difference.Therefore, to the detection of drug effect genes involved, doctor can be instructed the accurate dispenser of patient, evade drug side effect, improve the medical expense efficiency of patient and even society simultaneously.
At present, the research adopting molecular biology method to detect people C-KIT transgenation mainly comprises order-checking, gene chip, probe hybridization technology etc.And along with FQ-PCR (fluorescenceQuantitative-PolymeraseChainReaction, i.e. fluorescent quantitative poly chain reaction) development of technology, FQ-PCR technology is more and more extensive in the application of people C-KIT transgenation diagnostic field, also be more and more held in esteem and look, in the detection of people C-KIT transgenation, real-time fluorescence PCR technology shows the superiority of its clinical diagnosis by feat of the advantage such as quick, responsive, special.
Summary of the invention
The object of this invention is to provide a kind of C-KIT gene D816V sudden change fluorescence PCR detection reagent kit, operate the C-KIT gene D816V mutation detection kit quick, method is easy, detection sensitivity is high, sensing range is wide to provide a kind of.
The invention provides following technical scheme:
The invention provides a kind of C-KIT gene D816V sudden change fluorescence PCR detection reagent kit, described detection kit comprises D816V abrupt climatic change reaction solution, and described D816V abrupt climatic change reaction solution comprise 10 × PCR damping fluid, deoxyribonucleoside triphosphate, for the upstream primer of amplified target polynucleotide and downstream primer and the probe for detecting target polynucleotide; The base-pair sequence of the described probe for detecting target polynucleotide is:
5’FAM-CAAATCTTTGTGATCCGACCATGAGTAAGG-BHQ13’。
Preferably, the base-pair sequence of the described upstream primer for amplified target polynucleotide and downstream primer is:
Upstream primer: 5 '-TCTCCTCCAACCTAATAGTGTATTCAC-3 ';
Downstream primer: 5 '-CCACATAATTAGAATCATTCTTGACGT-3 '.
Preferably, described detection kit also comprises interior mark, be designated as region segments relatively conservative in C-KIT gene, and the sequence of described region segments is in described:
5’-ATCCTGCCAAGCTTTTCCTTGTTGACCGCTCCTTGTATGGGAAAGAAGACAACGACACGCTGGTCCGCTGTCCTCTCACAGACCCAGAAGTGACCAATTATTCCCTCAAGGGGTGCCAGGGGAAGCC-3’。
Preferably, described D816V abrupt climatic change reaction solution also comprises for detecting interior target probe, and in described detection, the base-pair sequence of target probe is:
5’HEX-AAGAAGACAACGACACGCTGGTCCG-BHQ13’。
Preferably, described D816V abrupt climatic change reaction solution also comprises upstream primer for amplification interior label and downstream primer; The base-pair sequence of described upstream primer and downstream primer is:
Upstream primer: 5 '-CCTTGTTGACCGCTCCTTGTA-3 ';
Downstream primer: 5 '-GAGGGAATAATTGGTCACTTCTGG-3 '.
Preferably, the Klorvess Liquid that the magnesium chloride solution that described 10 × PCR damping fluid comprises Tri(Hydroxymethyl) Amino Methane Hydrochloride solution that pH value is the 200mmol/L of 7.5, concentration is 30mmol/L, concentration are 500mmol/L, volume ratio be 0.2% Triton solution and volume ratio be the formamide soln of 10%.
Preferably, described deoxyribonucleoside triphosphate is dATP, dCTP, dGTP, dUTP or dTTP.
Preferably, described detection kit also comprises enzyme mixation, and described enzyme mixation comprises hot resistant DNA polymerase and 0.05U/ μ l ~ 0.2U/ μ l uracil dna glycosylase of 1U/ μ l ~ 5U/ μ l.
Preferably, described detection kit also comprises positive control, and described positive control is comprise the plasmid of interior label sequence fragment and the mixture of region, C-KIT gene D816V mutational site fragment of plasmid.
Preferably, described detection kit also comprises negative control, and described negative control is sterile saline.
The C-KIT gene D816V provided by the present invention fluorescence PCR detection reagent kit that suddenlys change comprises D816V abrupt climatic change reaction solution, and described D816V abrupt climatic change reaction solution comprise 10 × PCR damping fluid, deoxyribonucleoside triphosphate, for the upstream primer of amplified target polynucleotide and downstream primer and the probe for detecting target polynucleotide.C-KIT gene D816V sudden change fluorescence PCR detection reagent kit provided by the present invention is the detection kit based on Real-Time Fluorescent Quantitative PCR Technique and ARMS-PCR technology, this detection kit has good specificity, and operation is quick, method is easy, accuracy of detection is high, in increasing in reaction system, mark can effectively prevent from detecting in false negative simultaneously.
Accompanying drawing explanation
In order to be illustrated more clearly in the technical scheme in the embodiment of the present invention, below the accompanying drawing used required in describing embodiment is briefly described, apparently, for those of ordinary skills, under the prerequisite not paying creative work, other accompanying drawing can also be obtained according to these accompanying drawings.
Fig. 1 is that the C-KIT gene D816V that provides of the embodiment of the present invention suddenlys change the amplification curve diagram of fluorescence PCR detection reagent kit to weak positive precision reference material test;
Fig. 2 is that the C-KIT gene D816V that provides of the embodiment of the present invention suddenlys change the amplification curve diagram that fluorescence PCR detection reagent kit tests strong positive precision reference material;
Fig. 3 is that the C-KIT gene D816V that the embodiment of the present invention provides suddenlys change fluorescence PCR detection reagent kit to the amplification curve diagram of wild type human DNA tests;
Fig. 4 is that the C-KIT gene D816V that the embodiment of the present invention provides suddenlys change fluorescence PCR detection reagent kit to the amplification curve diagram containing people's DNA tests that 1%D816V suddenlys change.
Embodiment
The C-KIT gene D816V sudden change fluorescence PCR detection reagent kit that the embodiment of the present invention provides, operates the C-KIT gene D816V mutation detection kit quick, method is easy, detection sensitivity is high, sensing range is wide to provide a kind of.
Technical scheme in the embodiment of the present invention is understood better in order to make those skilled in the art person, and enable the above-mentioned purpose of the embodiment of the present invention, feature and advantage become apparent more, below in conjunction with accompanying drawing, the technical scheme in the embodiment of the present invention is described in further detail.
C-KIT gene D816V that the embodiment of the present invention the provides fluorescence PCR detection reagent kit that suddenlys change comprises D816V abrupt climatic change reaction solution, and described D816V abrupt climatic change reaction solution comprises the probe for detecting target polynucleotide of 10 × PCR damping fluid of 5 μ L, the deoxyribonucleoside triphosphate of 0.2mmol/L, the upstream primer for amplified target polynucleotide of 0.2 μm of ol/L ~ 0.4 μm ol/L and downstream primer and 0.2 μm of ol/L ~ 0.4 μm ol/L.
The present invention by SeqMan and the MegAlign software in application DNAStar software package to the C-KIT gene order retrieved in Genbank, tetraploid rice is carried out at D816VC-KIT mutated site, and for this mutated site devise 3 covers respectively include an Auele Specific Primer ARMS primer, a downstream primer and a probe primed probe combination, through optimizing, filtered out relatively good a pair probe for amplified target polynucleotide of expanding effect and upstream and downstream primer, this probe and primer come from people C-KIT gene D816V sudden change exon region, place 17.
Wherein, the base-pair sequence of this probe is:
5’-FAMCAAATCTTTGTGATCCGACCATGAGTAAGG-BHQ13’；
For the upstream primer of amplified target polynucleotide and the base-pair sequence of downstream primer be:
Upstream primer: 5 '-TCTCCTCCAACCTAATAGTGTATTCAC-3 ';
Downstream primer: 5 '-CCACATAATTAGAATCATTCTTGACGT-3 '.
C-KIT gene D816V that the embodiment of the present invention the provides particular location that gene is being detected in mutational site that fluorescence PCR detection reagent kit detects that suddenlys change is codon 816 place, and base be changed to GAC > GTC.Owing to have employed above-mentioned probe and upstream and downstream primer, 1% mutant human C-KIT gene 100% can be realized under the wild-type DNA background of 50ng/ reaction to detect and wild type human C-KIT gene zero detects, illustrate that test kit of the present invention has good specificity and extremely strong immunity from interference, greatly reduce false positive rate.
C-KIT gene D816V that the embodiment of the present invention the provides fluorescence PCR detection reagent kit that suddenlys change comprises interior mark further, namely comprises positive internal reference, and this is interior is designated as region segments relatively conservative in C-KIT gene.In this detection kit, this interior mark can monitor DNA extraction and PCR reaction process, and whether monitoring reaction system is effective, and then prevents the inhibition Interference Detection that may exist in sample, and makes detected result be false negative.Wherein, this interior target base-pair sequence is:
5’-ATCCTGCCAAGCTTTTCCTTGTTGACCGCTCCTTGTATGGGAAAGAAGACAACGACACGCTGGTCCGCTGTCCTCTCACAGACCCAGAAGTGACCAATTATTCCCTCAAGGGGTGCCAGGGGAAGCC-3’。
The D816V abrupt climatic change reaction solution that the embodiment of the present invention provides also comprise 0.1 μm of ol/L ~ 0.2 μm ol/L for detecting interior target probe, the base-pair sequence of this probe is: 5 ' HEX-AAGAAGACAACGACACGCTGGTCCG-BHQ13 '.
Meanwhile, the embodiment of the present invention additionally provides the upstream and downstream primer for amplification interior label, and the base-pair sequence of this upstream and downstream primer is:
Upstream primer: 5 '-CCTTGTTGACCGCTCCTTGTA-3 ';
Downstream primer: 5 '-GAGGGAATAATTGGTCACTTCTGG-3 '.
Further, the Klorvess Liquid that the magnesium chloride solution that 10 × PCR damping fluid in the detection kit that the embodiment of the present invention provides comprises Tris-HCl (Trishydroxymethylaminomethane, i.e. Tri(Hydroxymethyl) Amino Methane Hydrochloride solution) that pH value is the 200mmol/L of 7.5, concentration is 30mmol/L, concentration are 500mmol/L, volume ratio be 0.2% Triton solution and volume ratio be the formamide soln of 10%.
Further, the deoxyribonucleoside triphosphate in the detection kit that provides of the embodiment of the present invention is dATP, dCTP, dGTP, dUTP or dTTP.
The C-KIT gene D816V sudden change fluorescence PCR detection reagent kit that the embodiment of the present invention provides also comprises enzyme mixation, and described enzyme mixation comprises hot resistant DNA polymerase (Taq enzyme) and 0.05U/ μ l ~ 0.2U/ μ l uracil dna glycosylase (UNG enzyme) of 1U/ μ l ~ 5U/ μ l.UNG enzyme in enzyme mixation can be degraded containing the DNA chain of dU, and dUTP and UNG enzyme combinationally use the pollution that can prevent previous PCR product, prevent pattern detection false positive.
Preferably, the C-KIT gene D816V sudden change fluorescence PCR detection reagent kit that the embodiment of the present invention provides also comprises positive control, and this positive control is comprise the plasmid of interior label sequence fragment and the mixture of region, C-KIT gene D816V mutational site fragment of plasmid.
Preferably, the C-KIT gene D816V sudden change fluorescence PCR detection reagent kit that the embodiment of the present invention provides also comprises negative control, and this negative control is sterile saline.
C-KIT gene D816V that the embodiment of the present invention the provides fluorescence PCR detection reagent kit that suddenlys change for the operation steps of the C-KIT transgenation situation in the sample of nucleic acid that detects paraffin section and extract is:
S01: take out each component in packing box, room temperature is placed, and after its temperature equilibrium to room temperature, each component is mixed respectively, for subsequent use;
S02: according to the quantity of sample to be tested, negative control, positive control, gets D816V abrupt climatic change reaction solution and enzyme mixation that volume ratio is 43:2, is fully mixed evenly and forms PCR-mix, for subsequent use after brief centrifugation;
S03: use business-like paraffin section nucleic acid extraction kit to extract DNA, for subsequent use;
S04: according to the PCR-mix adding 45 μ l according to the quantity of sample to be tested, negative control, positive control in each reaction tubes, and get step S03 for subsequent use sample DNA, negative control, each 5 μ l of positive control join in above-mentioned PCR-mix, build pipe lid, form testing sample;
S05: testing sample is placed on fluorescent quantitative PCR instrument and tests.
Further, testing sample is placed on and fluorescent quantitative PCR instrument (for ABI7500 instrument) carries out test pack draws together following steps:
(1) PCR reaction tubes is put into amplification instrument sample cell, sample to be tested title concentration is set by correspondence order;
(2) fluorescence detection channel is selected: select FAM passage (Reporter:FAM, Quencher:None); Interior mark selects HEX or VIC passage (Reporter:VIC, Quencher:None).Reference fluorescent (PassiveReference) is set to ROX.
(3) quantitative fluorescent PCR reaction conditions please refer to table 1.
Table 1: quantitative fluorescent PCR reaction conditions
(4) setting completed, preserves file, runs response procedures.
Interpretation of result
After reaction terminates, the automatic saving result of instrument, the software that instrument can be utilized to carry carries out automatic analysis (also can the starting value of manual regulation baseline, end value and threshold line value analyze), then records sample Ct value and result.The intersection point of amplification curve and threshold line, is called Ct (i.e. cyclethreshold, the cycling numerical value experienced when the fluorescent signal referring in PCR reaction tubes reaches the threshold value of setting); Instrument software, according to each sample Ct value size, can judge detected result.If sample amplification curve is S-type, there is Ct value and Ct value≤39, can the positive be judged as; If sample amplification curve is straight, and without Ct value display (Undet) display, feminine gender can be judged to.
(1) specific test
The detection kit that theres is provided of the embodiment of the present invention is used to detect enterprise's yin and yang attribute operating reference product, in this test, the wild type human DNA of negative operating reference product to be concentration be 25ng/ μ L; Positive operating reference product are D816V mutant plasmids that concentration is respectively 6000copies/ μ L, 1500copies/ μ L and 112.5copies/ μ L.The detected result obtained by above-mentioned detection is yin and yang attribute reference material coincidence rate is 100%, meets quality standard, and this illustrates that the detection kit that the embodiment of the present invention provides has good specificity.
(2) precision test
The detection kit that the embodiment of the present invention provides carries out Fluorescence PCR test respectively to weak positive precision reference material and strong positive precision reference material, and this test often organizes repetition 10 times, and the test result of reaction please refer to accompanying drawing 1 and accompanying drawing 2.In this test, weak positive precision reference material is the mixture of wild type human DNA and D816V mutant plasmid, and the percentage wherein containing D816V sudden change is 1.5%; Strong positive precision reference material is the mixture of wild type human DNA and D816V mutant plasmid, and the percentage wherein containing D816V sudden change is 80%.Can find out from accompanying drawing 1 and accompanying drawing 2, all there is Ct value in twice test, and the Ct value in accompanying drawing 1 has good amplification curve from 30-45, Ct value in accompanying drawing 2 has good amplification curve from 23-45, and linearity range is good, batch in and batch between reproducible, the equal <5% of the variation coefficient of Ct value, it can be said that bright detection kit has good precision.
(3) sensitivity and wild by patience
Please refer to accompanying drawing 3 and accompanying drawing 4, accompanying drawing 3 and the C-KIT gene D816V fig. 4 illustrating the embodiment of the present invention and provide suddenly change fluorescence PCR detection reagent kit to wild type human DNA and the amplification curve diagram carrying out Fluorescence PCR test containing the people DNA of 1%D816V sudden change.
As can be seen from accompanying drawing 3, have no amplification curve the detection kit that the embodiment of the present invention provides is by carrying out Fluorescence PCR test during to wild type human DNA, and coincidence rate is 100%.As can be seen from accompanying drawing 4, occur obvious amplification curve when the detection kit that the embodiment of the present invention provides is by carrying out Fluorescence PCR test to the people DNA containing 1%D816V sudden change, and the repeatability of amplification curve is fine, and coincidence rate is 100%.By relatively can drawing of above-mentioned two tests, the detection kit that the embodiment of the present invention provides can not detect wild type human DNA, and still can detect when the D816V sudden change concentration of people DNA is very little, and there is amplification curve, it can be said that bright detection kit provided by the present invention has higher sensitivity and extremely strong immunity from interference, greatly reduce false positive rate, thus reach the object directly distinguishing saltant type and wild type gene.
C-KIT gene D816V that the embodiment of the present invention the provides fluorescence PCR detection reagent kit that suddenlys change comprises D816V abrupt climatic change reaction solution, and described D816V abrupt climatic change reaction solution comprise 10 × PCR damping fluid, deoxyribonucleoside triphosphate, for the upstream primer of the Auele Specific Primer ARMS of amplified target polynucleotide and downstream primer and the probe for detecting target polynucleotide.C-KIT gene D816V sudden change fluorescence PCR detection reagent kit provided by the present invention is the detection kit based on Real-Time Fluorescent Quantitative PCR Technique and ARMS-PCR technology, this detection kit can realize 1% mutant human C-KIT gene 100% and to detect and wild type human C-KIT gene zero detects under the wild-type DNA background of 50ng/ reaction, thus illustrate that this detection kit has good specificity and extremely strong immunity from interference, greatly reduce false positive rate, and operation fast, method is easy, accuracy of detection is high, in increasing in reaction system, mark can effectively prevent from detecting in false negative simultaneously.C-KIT gene D816V that the embodiment of the present invention provides suddenly change fluorescence PCR detection reagent kit batch in and reproducible between criticizing, and the variation coefficient <5% of Ct value.
Above-described embodiment of the present invention, does not form limiting the scope of the present invention.Any amendment done within the spirit and principles in the present invention, equivalent replacement and improvement etc., all should be included within protection scope of the present invention.
Claims (10)
1. a C-KIT gene D816V sudden change fluorescence PCR detection reagent kit, it is characterized in that, described detection kit comprises D816V abrupt climatic change reaction solution, and described D816V abrupt climatic change reaction solution comprise 10 × PCR damping fluid, deoxyribonucleoside triphosphate, for the upstream primer of amplified target polynucleotide and downstream primer and the probe for detecting target polynucleotide;
The base-pair sequence of the described probe for detecting target polynucleotide is:
5’FAM-CAAATCTTTGTGATCCGACCATGAGTAAGG-BHQ13’。
2. C-KIT gene D816V sudden change fluorescence PCR detection reagent kit according to claim 1, it is characterized in that, the base-pair sequence of the described upstream primer for amplified target polynucleotide and downstream primer is:
Upstream primer: 5 '-TCTCCTCCAACCTAATAGTGTATTCAC-3 ';
Downstream primer: 5 '-CCACATAATTAGAATCATTCTTGACGT-3 '.
3. C-KIT gene D816V sudden change fluorescence PCR detection reagent kit according to claim 2, it is characterized in that, described detection kit also comprises interior mark, be designated as region segments relatively conservative in C-KIT gene, and the sequence of described region segments is in described:
5’-ATCCTGCCAAGCTTTTCCTTGTTGACCGCTCCTTGTATGGGAAAGAAGACAACGACACGCTGGTCCGCTGTCCTCTCACAGACCCAGAAGTGACCAATTATTCCCTCAAGGGGTGCCAGGGGAAGCC-3’。
4. C-KIT gene D816V sudden change fluorescence PCR detection reagent kit according to claim 3, it is characterized in that, described D816V abrupt climatic change reaction solution also comprises for detecting interior target probe, and in described detection, the base-pair sequence of target probe is:
5’HEX-AAGAAGACAACGACACGCTGGTCCG-BHQ13’。
5. C-KIT gene D816V according to claim 4 suddenlys change fluorescence PCR detection reagent kit, it is characterized in that, described D816V abrupt climatic change reaction solution also comprises upstream primer for amplification interior label and downstream primer; The base-pair sequence of described upstream primer and downstream primer is:
Upstream primer: 5 '-CCTTGTTGACCGCTCCTTGTA-3 ';
Downstream primer: 5 '-GAGGGAATAATTGGTCACTTCTGG-3 '.
6. C-KIT gene D816V sudden change fluorescence PCR detection reagent kit according to claim 5, it is characterized in that, described 10 × PCR damping fluid comprises Tri(Hydroxymethyl) Amino Methane Hydrochloride solution that pH value is the 200mmol/L of 7.5, Klorvess Liquid that magnesium chloride solution that concentration is 30mmol/L, concentration are 500mmol/L, volume ratio be 0.2% Triton solution and volume ratio be the formamide soln of 10%.
7. C-KIT gene D816V sudden change fluorescence PCR detection reagent kit according to claim 5, it is characterized in that, described deoxyribonucleoside triphosphate is dATP, dCTP, dGTP, dUTP or dTTP.
8. according to the C-KIT gene D816V sudden change fluorescence PCR detection reagent kit in claim 1-7 described in any one, it is characterized in that, described detection kit also comprises enzyme mixation, and described enzyme mixation comprises hot resistant DNA polymerase and 0.05U/ μ l ~ 0.2U/ μ l uracil dna glycosylase of 1U/ μ l ~ 5U/ μ l.
9. C-KIT gene D816V sudden change fluorescence PCR detection reagent kit according to claim 8, it is characterized in that, described detection kit also comprises positive control, and described positive control is comprise the plasmid of interior label sequence fragment and the mixture of region, C-KIT gene D816V mutational site fragment of plasmid.
10. C-KIT gene D816V sudden change fluorescence PCR detection reagent kit according to claim 8, it is characterized in that, described detection kit also comprises negative control, and described negative control is sterile saline.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201510888493.1A CN105349682A (en) | 2015-12-07 | 2015-12-07 | C-KIT gene D816V mutation fluorescent PCR detection kit |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201510888493.1A CN105349682A (en) | 2015-12-07 | 2015-12-07 | C-KIT gene D816V mutation fluorescent PCR detection kit |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN105349682A true CN105349682A (en) | 2016-02-24 |
Family
ID=55325742
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201510888493.1A Pending CN105349682A (en) | 2015-12-07 | 2015-12-07 | C-KIT gene D816V mutation fluorescent PCR detection kit |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN105349682A (en) |
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN106011254A (en) * | 2016-06-17 | 2016-10-12 | 四川大学华西医院 | Diagnostic kit and method for detecting human C-Kit gene exon 17 mutations |
| CN109295175A (en) * | 2017-09-08 | 2019-02-01 | 广州健天基因技术有限公司 | For detecting primer, detection method and the kit of human gastrointestinal tract's mesenchymoma C-KIT gene V559A mutation |
Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN104328184A (en) * | 2014-10-30 | 2015-02-04 | 武汉百泰基因工程有限公司 | Primer, probe, locked nucleic acid probe, kit and detection method for detecting C-kit gene mutation |
| CN104846108A (en) * | 2015-05-29 | 2015-08-19 | 沈阳优吉诺生物科技有限公司 | Primer, kit as well as PCR method for detecting of D816V mutation site of C-KIT gene |
-
2015
- 2015-12-07 CN CN201510888493.1A patent/CN105349682A/en active Pending
Patent Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN104328184A (en) * | 2014-10-30 | 2015-02-04 | 武汉百泰基因工程有限公司 | Primer, probe, locked nucleic acid probe, kit and detection method for detecting C-kit gene mutation |
| CN104846108A (en) * | 2015-05-29 | 2015-08-19 | 沈阳优吉诺生物科技有限公司 | Primer, kit as well as PCR method for detecting of D816V mutation site of C-KIT gene |
Non-Patent Citations (2)
| Title |
|---|
| GIOVANNA DE MATTEISA ET AL.: "The impact of sensitive KIT D816V detection on recognition of Indolent Systemic Mastocytosis", 《LEUKEMIA RESEARCH》 * |
| 张均田，杜冠华: "《现代药理试验方法 上》", 31 July 2012 * |
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN106011254A (en) * | 2016-06-17 | 2016-10-12 | 四川大学华西医院 | Diagnostic kit and method for detecting human C-Kit gene exon 17 mutations |
| CN109295175A (en) * | 2017-09-08 | 2019-02-01 | 广州健天基因技术有限公司 | For detecting primer, detection method and the kit of human gastrointestinal tract's mesenchymoma C-KIT gene V559A mutation |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN104099425B (en) | A kind of test kit for detecting B-raf transgenation | |
| CN105112500B (en) | A kind of primer, probe and kit for being used to detect C-KIT gene mutations | |
| CN105296666A (en) | Fluorescent PCR detecting kit for V600E mutation of BRAF gene | |
| US20080261219A1 (en) | Polynucleotide Primers | |
| CN106119362B (en) | It is a kind of for detecting the primer sets and kit of HLA-B*1502 allele | |
| CN104328164A (en) | Kit for detecting human EGFR gene mutation by using fluorescence probe hybridization method | |
| CN104263847A (en) | Primer probe group and kit for performing multiple-fluorescence parting detection on plasmodium | |
| CN104531881A (en) | Fluorescence PCR detection kit for human K-RAS gene mutation | |
| CN107988369A (en) | Kit that is a kind of while detecting 45 mutational sites of Human epidermal growth factor receptor gene | |
| CN103103251A (en) | Kit for detecting FLT3-ITD (Fms-like tyrosine kinase 3-internal tandem duplication) gene mutation by using fluorescence PCR (Polymerase Chain Reaction) capillary electrophoresis | |
| KR102041001B1 (en) | Method for quantitative analysis of FLT3 gene mutation and kit | |
| CN105349682A (en) | C-KIT gene D816V mutation fluorescent PCR detection kit | |
| CN105349681A (en) | BCR-ABL fusion gene T315I mutation fluorescent PCR detection kit | |
| CN104087674B (en) | A kind of human epiterm growth-factor receptor mutation gene detection kit | |
| CN108728538B (en) | ALK gene fusion detection primer, method and kit | |
| CN105950766A (en) | Primer group and kit for detecting HLA-B*5801 allelic genes | |
| CN107723362A (en) | For detecting primer, probe and the kit of 1,675 1681 mutation of C KIT genes | |
| CN107630089A (en) | For detecting primer, probe and the kit of the mutation of C-KIT gene 1689-1718 positions | |
| CN105969908A (en) | CTNNB1 third exon mutation detection primer probes and kit thereof | |
| CN107739757A (en) | For detecting primer, probe and the kit of 37 1738 mutation of C KIT gene 17s | |
| CN106636365B (en) | Nucleic acid, kit and method for detecting A1166C polymorphic site of AGTR1 gene | |
| CN109593856A (en) | A kind of kit and preparation method thereof of detection 2 codon 12/13 of KRAS gene extron mutation | |
| CN105316426A (en) | TPMT (thiopurine S-methyltransferase) genetic polymorphism detection kit | |
| CN104498616A (en) | Human EGFR gene mutation fluorescent PCR detection kit | |
| CN106811537A (en) | One kind detection epidermal growth factor receptor gene T790M low frequencies mutant primer and its application |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| RJ01 | Rejection of invention patent application after publication |
Application publication date: 20160224 |
|
| RJ01 | Rejection of invention patent application after publication |