CN104846108A

CN104846108A - Primer, kit as well as PCR method for detecting of D816V mutation site of C-KIT gene

Info

Publication number: CN104846108A
Application number: CN201510290519.2A
Authority: CN
Inventors: 高劲松; 张英杰; 魏欣芳; 李星颐; 魏潇; 魏奇
Original assignee: SHENYANG EUGENOM BIOLOGICAL TECHNOLOGY Co Ltd
Current assignee: SHENYANG EUGENOM BIOLOGICAL TECHNOLOGY Co Ltd
Priority date: 2015-05-29
Filing date: 2015-05-29
Publication date: 2015-08-19
Anticipated expiration: 2035-05-29
Also published as: CN104846108B

Abstract

The invention discloses a primer, a kit as well as a PCR method for detecting a D816V mutation site of a C-KIT gene. The primer comprises a wild-type specific forward primer, a mutant-type specific forward primer and a reverse primer which are shared by the wild-type specific forward primer and the mutant-type specific forward primer, wherein the wild-type specific forward primer has a sequence shown in SEQ No.17, the-mutant type specific forward primer has a sequence shown in SEQ No.14, and the shared reverse primer has a sequence shown in SEQ No.16. The kit has the advantages of being simple, rapid, accurate and cheap in detection; and a powerful instrument is provided for scientific research and clinical D816V site typing and gene mutation analysis of the C-KIT gene.

Description

Detect the primer in C-KIT gene D816V mutational site, test kit and PCR method thereof

Technical field

The present invention relates to molecular biology field of gene detection, specifically provide a kind of primer, test kit and the PCR method thereof that detect C-KIT transgenation, for the rapid detection in C-KIT gene D816V mutational site.

Background technology

C-KIT gene belongs to proto-oncogene, and the KIT acceptor of coding belongs to III type tyrosine kinase.After this receptor and part---STEM CELL FACTOR (SCF) combines, downstream signal is activated by forming dimer, comprise Ras/Raf/MAPK path, Akt/PI3K path etc., the intracytoplasmic transcription factor of final activation, regulatory gene is expressed, control Growth of Cells and propagation.

Under normal circumstances, KIT acceptor activates under the participation role of STEM CELL FACTOR.If C-KIT gene is undergone mutation, KIT receptor activation does not need ligand SCF to participate in, thus causes the continuous proliferation of tumour cell, and causes the out of control of apoptotic signal path.Research finds, the sudden change of C-KIT gene can cause the generation of malignant tumour, comprises acute myelocytic leukemia, gastrointestinal stromal tumor and carcinoma of testis etc.

Wherein gastrointestinal stromal tumor (Gastrointestinal Stromal Tumor, GIST) is digestive tube modal mesenchymal tissue source property tumour.The Kit albumen (CD117) of the GIST tumor cells expression C-KIT genes encoding of the overwhelming majority, and often there is C-KIT transgenation in GIST, sudden change causes the activation of KIT albumen not need ligand SCF to participate in just stimulating the out of control of the continuous proliferation of tumour cell and anti-apoptotic signal, thus generation tumour.In GIST, C-KIT gene mutation rate is about 80-90%, and mutant form is various, comprises replacement, deletion and insertion repeats.Wherein be positioned at the sudden change the most common (accounting for 70-80%) of exons 1 1Lys550-Val560 section, 6 bases insertions of exon 9 Ala502-Tyr503 section repeat sudden change and account for 5-10%.

Imatinib(imatinib), also known as Glivec(imatinib mesylate) be small molecule tyrosine kinase inhibitors, it optionally can suppress KIT, BCR-ABL and PDGFR.Imatinib is incorporated into the ATP-binding site of Tyrosylprotein kinase functional zone in KIT albumen endochylema, blocks phosphate group by the transfer of ATP to substrate tyrosine residue, thus antiproliferative effect recover apoptotic program.At present, Imatinib be used for the treatment of the KIT positive, can not excision and/or metastatic malignant GIST, its clinical efficacy is exciting.But and not all GIST patient can obtain good efficacy after Imatinib treatment, clinical study shows that the curative effect of the catastrophe of C-KIT gene in GIST and Imatinib molecular targeted therapy is closely related.The patient's curative effect that there is C-KIT exons 11 sudden change is best, and patient's curative effect that exon 9 suddenlys change is taken second place, and the poorest without GIST patient's curative effect of transgenation.In addition, to the patient that exon 9 suddenlys change, dosage can improve curative effect by bringing up to 400mg/ day 800mg/ day.

2006 another kind of targeted drug Sutent (Sunitinib, also known as SU11248 Sutent) obtain U.S. FDA approval for the intractable GIST patient of Imatinib resistance.Similar to Imatinib, the clinical efficacy of Sunitinib is relevant with gene mutation site.Unlike, it is best to C-KIT exon 9 sudden change person effect, undesirable to the effect of exon 11 sudden change person.

Propose in american cancer integrated network (NCCN) " soft tissue sarcoma's clinical therapeutic guideline ", before GIST patient accepts targeted drug treatment, first should carry out C-KIT detection in Gene Mutation, determine whether use targeted drug as clinical treatment measure according to detected result.Detect C-KIT transgenation for the reasonable application molecular targeted agents treatment instructing GIST patient, there is important reference value.

At present to the detection of transgenation and gene pleiomorphism, common have direct sequencing; Gene chip hybridization method; PCR-RFLP method; Pcr amplification product capillary electrophoresis analysis method; PCR-SSCP; PCR high-resolution fusion curve analytical technology; PCR-Taqman MGB(Minor Groove Binder) probe method; AS-PCR method; Cast-PCR method etc.It is high more or less also to there is instrument price in these methods, and operation easier is large, and there is certain false negative and false positive, testing cost is high, and clinical popularity is low, can not detect the shortcomings such as clinical samples on a large scale simultaneously.

As: 1) direct sequencing is the gold standard of mutation analysis, can find known and unknown mutation site, but the mutator gene DNA profiling number that the sensitivity of this method detection transgenation is 20%(and goal gene accounts for 20% of wild-type DNA profiling number).Also there is complicated operation, the cycle is long simultaneously, and analysis speed is slow, the normal needs time of 2 days, and this method is open pipe operation, greatly increases the possibility of pollution, be not suitable for the detection to extensive sample, also need expensive instrument simultaneously, exist in shortcomings such as basic unit not easily implement.

2) regular-PCR-RFLP method and technology is easy; low price; the test in laboratory of suitable a small amount of sample; but RFLP only can detect the sudden change of restriction enzyme site; can not detect without restriction enzyme site; waste time and energy, also there is PCR primer pollution and cause false-positive risk, see [Mol Diagn Ther. 2010 Jun 1; 14 (3): 163-9, United States Patent 20120135406].

3) chip technology has the features such as high-throughput, microminiaturization, automatization compared with traditional instrument detection method, is applicable to full genome mutated scanning, and the mutational site being not suitable for individual gene is detected, and precision is low, expensive.

4) PCR high-resolution fusion curve analytical technology; the catastrophe of energy high throughput testing gene; reagent cost is lower; but because its fluorescent signal is from dyestuff; specificity is affected, and detecting instrument is the fluorescent PCR instrument of upgrade version, and price is high; universal limited, see [Clin Chim ACqa. 2012 Nov 12; 413 (21-22): 1781-5; United States Patent 20110045479].

5) PCR-Taqman MGB probe method is applicable to known mutations site, usually need two probes, and the synthesis price of Taqman MGB probe is several times of general T aqman probe, sees [J Clin Microbiol. 2010 Aug; 48 (8): 2909-15; United States Patent 20090311679], and allelotrope or the mutational site of the content less (1 in >=1,000) in sample can not be detected.

6) although PCR-SSCP method is simple, this method is open detection system, easily cause the pollution of PCR primer, and operation steps is many, wastes time and energy.

7) allele-specific primers pcr amplification method (AS-PCR); this method detects transgenation or the most simple and quick method (Wu D Y, Ugozzoli L, the Pal B K of SNP at present; Wallace R B., Proc Natl Acad Sci USA 1989; 86:2757-2760), its principle is the base mispairing of primer 3' terminal bases and template, and the efficiency of its PCR will decline 10 ³-10 ^6.6doubly (Chen, X., and Sullivan, P F, The Pharmacogeonomics Journal 2003,3,77-96).Although the party's ratio juris is simple, still can there is non-specific amplification in the primer of mispairing; amplification situation looks type (the Ayyadevara S relevant with the base sequence around detection site of sudden change; Thaden J J, Shmookler Reis R J., Anal Biochem 2000; 284:11-18), also with the impact of allelotrope variable that exists in sample.In order to increase the specificity of AS-PCR, many scientists have done a lot of effort.A large amount of experiments proves, the method is it is crucial that two special primers of design and 3' terminal mutation site base complementrity or mispairing, and design of primers is bad, by causing the intersection of high background to increase, can cause higher false positive.Although many people make great efforts this drawback to overcome; as the TaqMAMA method of report; 3 ' penultimate or the 3rd introduce mutating alkali yl; really the specificity of reaction can be increased; but still false positive cannot be eliminated completely, and in the judgement of homozygote and heterozygote, lack standard; there will be chaotic situation, see [J Virol Methods. 2008 Nov; 153 (2): 156-62; Genomics. 2004 Feb; 83 (2): 311-20].Simple AS-PCR, carry out electrophoresis again after usually adopting PCR reaction to terminate, from there being reactionless band to carry out judged result, although this method does not need expensive instrument, electrophoretic procedures, adds the opportunities for contamination of PCR, and time and effort consuming.Possessor has done improvement to the method to the greatest extent, adopt fluorescent quantitative PCR technique, but what obtain is not the result of " all or none " formula, always have the generation of nonspecific reaction, namely all can increase in same primer pair wild-type and saltant type site, just its Ct(Cycle threshold obtained) different, therefore the concept of Δ Ct is just introduced, i.e. Δ Ct=wild Ct-sudden change Ct, but calculation of complex, be greater than homozygote Ct value as wanted Δ Ct value and be judged to saltant type homozygote, Δ Ct value is less than heterozygote Ct value, be judged to heterozygote, the introducing of Δ Ct value not only increases operation steps, also confusion can be caused, because the established standards of Δ Ct value cannot accurately be located, different samples and different detecting instruments all can have different numerals, very large difficulty is brought to clinical application, practical application is still limited, see [Chinese patent CN101235415, CN101565742A].

8) U.S. LIFE company adopts a kind of MGB to close the method for probe; be called Cast-PCR(Competitive allele specific Taqman PCR); with MGB probe, the site do not detected is closed; then the method testing goal site of allele specific primer quantitative fluorescent PCR is used; although this improves the specificity of detection, owing to adding to close probe into a MGB, cost certainly will be increased; how much can bring interference to reaction efficiency, see [Exp Mol Pathol. 2012 Jun; 92 (3): 275-80; United States Patent 20100221717; CN102428190A].Someone adopts the PCR primer of the base (Anal Biochem.2005,340:287-294) of lock nucleic acid (LNA) (Plant Method 2007,3:2) or modification, and AS-PCR detection sensitivity can be made to improve.But, these approaches increases the overall cost of analysis, and depth optimization need be carried out to reaction.

At present, a kind of C-KIT gene mutation detection liquid-phase chip of domestic Guangzhou Yishan Biotechnology Co., Ltd. application adopts liquid-phase chip technology to analyze (patent No. CN 101984070 A) C-KIT sudden change; A kind of probe, primer and detection kit for detecting C-KIT transgenation of Xiamen Amoydx Bio-Pharmaceutical Technology Co., Ltd.'s application adopts real-time fluorescence PCR method to detect C-KIT sudden change (patent No. CN 103114133 A).

Chip technology has the features such as high-throughput, microminiaturization, automatization compared with traditional instrument detection method, is applicable to full genome mutated scanning, and the mutational site being not suitable for individual gene is detected, and precision is low, expensive.And common fluorescent quantitative PCR technique designs the most key site-specific primer, also only carry out according to the rule of design of primers, the screening objective indicator of the good special primer of neither one, the most key is, and their result judges, still fuzzy, do not have the concept of " all or none ", nonspecific like this shortcoming still cannot overcome.

Therefore, how to carry out simply detecting accurately to C-KIT gene D816V mutational site, become people's problem demanding prompt solution.

Summary of the invention

Given this, the invention provides a kind of primer, test kit and the PCR method thereof that detect C-KIT gene D816V mutational site, high with the result interpretation complexity, the detecting instrument price that at least solve test kit existence in the past, operation easier is large, there is certain false negative and false positive, testing cost is high, and clinical popularity is low, can not detect one or more problems such as clinical samples on a large scale simultaneously.

Scheme provided by the invention is specially: a kind of primer detecting C-KIT gene D816V mutational site, it is characterized in that, described primer comprises: the downstream primer that wild-type specific upstream primer, saltant type specific upstream primer and wild-type specific upstream primer and saltant type specific upstream primer share;

And described wild-type specific upstream primer has SEQ No.17 sequence, described saltant type specific upstream primer has SEQ No.14 sequence, and described shared downstream primer has SEQ No.16 sequence.

One aspect of the present invention additionally provides a kind of reagent detecting C-KIT gene D816V mutational site, it is characterized in that: described reagent contains above-mentioned primer.

The present invention additionally provides a kind of test kit detecting C-KIT gene D816V mutational site on the other hand, it is characterized in that: described test kit is also containing above-mentioned primer.

Preferably, also comprise in described test kit with described primer with the use of probe, wherein, described probe is Taqman probe, has SEQ No.15 sequence.

Further preferably, described test kit also comprises PCR reaction tubes, dNTPs and Taq enzyme mixed solution, PCR damping fluid, the upstream primer detecting house-keeping gene GAPDH, the downstream primer detecting house-keeping gene GAPDH, the probe detecting house-keeping gene GAPDH, positive quality control product and blank;

The upstream primer of described detection house-keeping gene GAPDH has SEQ No.19 sequence; The downstream primer of described detection house-keeping gene GAPDH has SEQ No.20 sequence; The probe of described detection house-keeping gene GAPDH has SEQ No.21 sequence.

Further preferably, the probe of the upstream primer of described saltant type specific upstream primer, described shared downstream primer, described probe, described detection house-keeping gene GAPDH, the downstream primer of described detection house-keeping gene GAPDH and described detection house-keeping gene GAPDH is coated in T-shaped PCR reaction tubes in advance; And be coated in advance in A type PCR reaction tubes with the probe of the upstream primer of described wild-type specific upstream primer, described shared downstream primer, described probe, described detection house-keeping gene GAPDH, the downstream primer of described detection house-keeping gene GAPDH and described detection house-keeping gene GAPDH.

Further preferably, in described T-shaped PCR reaction tubes, the concentration and probe concentration of the upstream primer of saltant type specific upstream primer, described shared downstream primer, described probe, described detection house-keeping gene GAPDH, the downstream primer of described detection house-keeping gene GAPDH and described detection house-keeping gene GAPDH is respectively 50nM-2um, 50nM-2uM, 50nM-400nM, 1pm-20pm, 1pm-20pm, 0.05pm-5pm; And the concentration and probe concentration of the upstream primer of wild type specificity upstream primer, described shared downstream primer, described probe, described detection house-keeping gene GAPDH, the downstream primer of described detection house-keeping gene GAPDH and described detection house-keeping gene GAPDH is respectively 50nM-2um, 50nM-2uM, 50nM-400nM, 1pm-20pm, 1pm-20pm, 0.05pm-5pm in described A type PCR reaction tubes.

Further preferred, in described T-shaped PCR reaction tubes, the concentration and probe concentration of the upstream primer of saltant type specific upstream primer, described shared downstream primer, described probe, described detection house-keeping gene GAPDH, the downstream primer of described detection house-keeping gene GAPDH and described detection house-keeping gene GAPDH is respectively 500nM, 500nM, 100nM, 5pm, 5pm, 2.5pm; And the concentration and probe concentration of the upstream primer of wild type specificity upstream primer, described shared downstream primer, described probe, described detection house-keeping gene GAPDH, the downstream primer of described detection house-keeping gene GAPDH and described detection house-keeping gene GAPDH is respectively 500nM, 500nM, 100nM, 5pm, 5pm, 2.5pm in described A type PCR reaction tubes.

Present invention also offers the PCR method of above-mentioned primer and test kit, it is characterized in that: PCR reaction is undertaken by two step amplification cycles programs, and the cycle number of the first step amplification is less than the cycle number of second step amplification, the annealing temperature that the annealing temperature that the described the first step increases increases higher than described second step.

Preferably, the condition of described PCR reaction is: 37 DEG C of 2min, 95 DEG C of 2min denaturations; The first step increases, 95 DEG C of sex change 5s, and 55 DEG C ~ 68 DEG C annealing 32s, circulate 10 ~ 15 times; Second step, 95 DEG C of sex change 5s, 50 DEG C ~ 65 DEG C annealing, extend 32s, circulates 30 ~ 50 times, collection fluorescent signal; Further preferably, the condition of described PCR reaction is: 37 DEG C of 2min, 95 DEG C of 2min denaturations; The first step increases, 95 DEG C of sex change 5s, and 63 DEG C of annealing 32s, circulate 15 times; Second step, 95 DEG C of sex change 5s, 60 DEG C of annealing, extend 32s, circulates 40 times, collection fluorescent signal.

The primer in detection C-KIT gene D816V mutational site provided by the invention and test kit thereof, greatly can increase the ability that allele-specific primers PCR distinguishes not isoallele site, the non-specific possibility of intersecting amplification between different loci is made to drop to minimum, the amplification of real " all or none " formula can be accomplished, not only there is good specificity, also there is extraordinary sensitivity, the genotype distribution situation in 1ng genomic dna can be detected.

The primer in detection C-KIT gene D816V mutational site provided by the invention and test kit thereof, have the following advantages:

1) by for a change making the people on primer sequence detected result really accomplish to judge result " all or none ", enormously simplify the difficulty of result interpretation, reducing the possibility of makeing mistakes, for scientific research and clinical application are provided convenience.

2) the mixing of Taq enzyme and dNTPs, ensured the stability of dNTPs, made it can stand repeatedly the test of multigelation.

3) shift to an earlier date the pre-assigned damping fluid that can directly use, user is convenient.

4) primer and probe are coated in PCR reaction tubes in advance, avoid the possibility that site mismatch appears in operator, and also save a large amount of operating time.

5) in the present invention primer and test kit to have specificity good, detection highly sensitive, detection speed is fast, and whole process can complete in 1 hour 20 minutes.

6) only use a conventional Taqman probe in test kit, such as do not close probe without other, reduce costs.

7) this test kit has and detects the advantage such as simple, quick, accurate, inexpensive.

Accompanying drawing explanation

Fig. 1 is pcr amplification graphic representation when designing wild-type and mutant primers;

Fig. 2 is the pcr amplification graphic representation detecting mutated genes sequence;

Fig. 3 is the pcr amplification graphic representation detecting wildtype gene sequence;

Fig. 4 is the pcr amplification graphic representation of house-keeping gene GAPDH.

Embodiment

With concrete case, the present invention is further expalined below, but is not limited to protection scope of the present invention.

If do not specialize, the conventional means that technique means used in embodiment is well known to those skilled in the art, product used is commercial.

The explanation of relational language in the present invention to give a definition:

" allelotrope " generally refers to region of DNA section, in the same, physical on homologous chromosomes, controls the one pair of genes of contrast character.In some cases, allelotrope can correspond to the replacement of the mononucleotide on specific physics locus.In other situation, allelotrope can correspond to Nucleotide (single or multiple) and insert or disappearance.

" allele-specific primers " refers to the complementary with target alleles, can extend special PCR reaction when PCR.Allele-specific primers can be designed to detect few primer very special to 1 nucleotide difference in target sequence, and this primer can comprise allele-specific nucleotide part, 3 ' end target specificity part and tail.

" MGB group " refers to minor groove binding.When the 3 ' end with oligonucleotide is puted together, MGB group can play a role as inextensible enclosure portion.MGB is the molecule that can be incorporated in the ditch of double-stranded DNA, usually adopts its synthetic method of DPI3(see U.S. Patent number 6,084,102; With 6,727,356).

" detection probes " refers to: instruction amplification multi-signal transduction molecule in any one.Such as, SYBR Green and other DNA binding dye are all detection probes.Some detection probes can be sequence-specific, such as Taqman probe (U.S. Patent number 5, 538, 848), multiple stem toroidal molecule beacon (U.S. Patent number 6, 103, 476 and 5, 925, 517 and Tyagi and Kramer, Nature Biotechnology, 1996, 14:303-308), acaulescence or Linear Beacon (WO99/21881), PNA Molecular Beacons TM (U.S. Patent number 6, 355, 421 and 6, 593, 091), the linear PNA beacon (people such as Kubista, 2001, SPIE4264:53-58), non-FRET probe (U.S. Patent number 6, 150, 097), Sunrise/Amplifluor probe (U.S. Patent number 6, 548, 250), stem ring and the double-strand Scorpion TM probe (people such as Solinas, 2001, NucleicAcidsResearch29:E96 and U.S. Patent number 6, 589, 743), ring probe (the U.S. Patent number 6 heaved, 590, 091), false knot probe (U.S. Patent number 6, 589, 250), cyclicon (U.S. Patent number 6, 383, 752), MGB Eclipse TM probe (Epoch Biosciences), hairpin probe (U.S. Patent number 6, 596, 490), peptide nucleic acid(PNA) (PNA) probe.Detection probes can comprise fluorescent reporter molecule, such as, 6-Fluoresceincarboxylic acid (6-FAM) or Tetrachlorofluorescein (TET), with quencher molecule part, such as tetramethylrhodamin (TAMRA), Black Hole Quenche RS (Biosearch), Iowa Black (IDT), QSY quencher (Molecular Probes) and Dabsyl and Dabcel sulfonate/carboxylate salt quencher (Epoch).

" share Auele Specific Primer " and refer to the primer matched with allele-specific primers in PCR reaction, it can use with the allele-specific primers pairing of different loci.

" polysaccharase of thermostability " refer to thermostability or the enzyme of heat resistance, mainly referring to archaeal dna polymerase, when pcr amplification, can not there is inactivation in this enzyme at an elevated temperature.

" Tm " or " melting temperature (Tm) " of oligonucleotide refers to temperature during molecule and the complementary sequence hybridization of in section of DNA 50%.Tm value can use the formula known to calculate (see, people such as Maniatis, T.: Molecular cloning, Cold Spring Harbor, N.Y.:1982).

" susceptibility " refers to the minimum (copy number) that can be detected template.

" specificity " refers to the ability distinguishing matching template and mispairing template.Specificity is mated through being often expressed as Δ Ct=Ct mispairing-Ct.

" selectivity " refers to that AS-PCR measures and can be used for measuring minority (normally suddenling change) allelotrope in mixture and without the degree from most (being often wild-type) allelic interference.Selectivity is through being often expressed as ratio or percentage.Such as, the mensuration that can detect 1 mutagenesis template when existence 100 wild-type template is referred to as the selectivity with 1: 100 or 1%.

" Ct " value refers to cycle threshold, represents cycle number when pcr amplification curve becomes exponential growth flex point from baseline.

When " Delta Ct " or " Δ Ct " refers to signal by fixed threshold, two different samples or reaction between cycle number difference.Δ Ct is when reaching exponential amplification, two different samples or reaction between cycle number difference.Δ Ct can be used for identifying the specificity between coupling primer and mismatched primers.

The present invention relates to primer and the test kit in rapid detection C-KIT gene D816V mutational site.Specifically, the present invention is on the basis based on Past-PCR (Perfect allele-specific Taqman PCR) method, is successfully applied to C-KIT gene D816V mutational site and detects.So-called Past-PCR is combined into by detecting gene SNP or the high specific AS-PCR method of sudden change and the Fluorescence PCR assay of Taqman probe, it only uses a Taqman probe, under most of the cases, this probe is conventional Taqman probe, only in portion gene because being rich in the special sequence of AT base, adopt the probes such as Taqman-MGB or LNA, in addition without the need to any extra closed probe or reporter probe, Past-PCR method is by the two kinds of method perfect adaptations of AS-PCR and Taqman fluorescent PCR, and make both advantages obtain performance extremely, be in particular in AS-PCR method, when not increasing any cost, successfully non-specific amplification is eliminated by design of primers and unique verification method, result is made to judge to present " complete and nothing " mode, namely have and just have, just do not have, make the judgement of result simply and accurately, this is to the maximum improvement of the AS-PCR method in past, also be effectively making up that AS-PCR method is that This is what people generally disapprove of, thus the advantage of AS-PCR method performed to ultimate attainment, the tidemark that the method can reach.As everyone knows, Taqman fluorescent PCR has stopping property and detects the process after finishing without the need to reaction, not only save the time, and decrease the risk of PCR primer pollution, the second time identification target sequence of probe has ensured the specificity and reliability that detect, also can be used for, to the detection by quantitative of gene, reaching the advantages such as criterion for clinical use.Past-PCR method has the two-fold advantage of AS-PCR method and Taqman fluorescence PCR method, and be these two kinds of methods combining together time, detect the most simplification formation that component can reach, therefore, we call it as perfect allele-specific Taqman PCR.

Based on Past-PCR method, invented the test kit for detecting gene C-KIT gene D816V mutational site, it basic composition is: the allele-specific primers of (a) high special; (b) fluorescent detection probe; C another Auele Specific Primer that () and allele-specific primers match.

Wherein, the primer in detection C-KIT gene D816V mutational site provided by the invention, comprising: the downstream primer that wild-type specific upstream primer, saltant type specific upstream primer and wild-type specific upstream primer and saltant type specific upstream primer share;

Additionally provide the detection reagent containing above-mentioned primer and test kit simultaneously, operation easier is there is large with solution detection C-KIT transgenation in the past, there is certain false negative and false positive, testing cost is high, clinical popularity is low, simultaneously can not detect the problems such as clinical samples on a large scale, achieve and detect simple, quick, accurate, cheap desirable, for scientific research and clinical C-KIT gene D816V site somatotype and gene mutation analysis provide strong instrument.

Preferably, also comprise in described test kit with described primer with the use of probe, wherein, described probe is Taqman probe, has SEQ No.15 sequence, only uses a probe in whole test kit, other without other such as closed probes etc., reduce the cost of test kit.

The upstream primer of described detection house-keeping gene GAPDH has SEQ No.19 sequence; The downstream primer of described detection house-keeping gene GAPDH has SEQ No.20 sequence; The probe of described detection house-keeping gene GAPDH has SEQ No.21 sequence; Wherein, by dNTPs and Taq enzyme mixing, the stability of dNTPs can be ensured, make it can stand repeatedly the test of multigelation; Detecting the upstream primer of house-keeping gene GAPDH, downstream primer and probe is for as internal reference, for preventing occurring false negative when detecting; Positive quality control product is T-shaped (or A type) human gene group DNA; Blank is sterilizing ultrapure water.

Further preferably, the probe of the upstream primer of described saltant type specific upstream primer, described shared downstream primer, described probe, described detection house-keeping gene GAPDH, the downstream primer of described detection house-keeping gene GAPDH and described detection house-keeping gene GAPDH is coated in T-shaped PCR reaction tubes in advance, and with described wild-type specific upstream primer, described shared downstream primer, described probe, the upstream primer of described detection house-keeping gene GAPDH, the downstream primer of described detection house-keeping gene GAPDH and the probe of described detection house-keeping gene GAPDH are coated in A type PCR reaction tubes in advance, be coated in PCR reaction tubes in advance by the reaction consumption of the best, in each reaction tubes, actual bag is by six oligonucleotides, namely one for allelic a kind of specific upstream primer, , a probe (being generally Taqman probe), , a shared specific Down Stream primer, article one, detect house-keeping gene GAPDH upstream primer, article one, detect house-keeping gene GAPDH downstream primer and a detection house-keeping gene GAPDH probe.Like this in order to detect the different gene pleiomorphism in a site, often need to wrap respectively and managed above PCR reaction tubes by two pipes or two, their middle probes, shared specific Down Stream primer, the upstream primer detecting house-keeping gene GAPDH, downstream primer are the same with probe, different is only other specific upstream primer of qualification allelotrope different shaped, bag is avoided the possibility that site mismatch appears in operator so in advance, and has saved a large amount of operating time.

Further preferably, in described T-shaped PCR reaction tubes, the concentration and probe concentration of the upstream primer of saltant type specific upstream primer, described shared downstream primer, described probe, described detection house-keeping gene GAPDH, the downstream primer of described detection house-keeping gene GAPDH and described detection house-keeping gene GAPDH is respectively 50nM-2um, 50nM-2uM, 50nM-400nM, 1pm-20pm, 1pm-20pm, 0.05pm-5pm; And the concentration and probe concentration of the upstream primer of wild type specificity upstream primer, described shared downstream primer, described probe, described detection house-keeping gene GAPDH, the downstream primer of described detection house-keeping gene GAPDH and described detection house-keeping gene GAPDH is respectively 50nM-2um, 50nM-2uM, 50nM-400nM, 1pm-20pm, 1pm-20pm, 0.05pm-5pm in described A type PCR reaction tubes.Optimum is, in described T-shaped PCR reaction tubes, the concentration and probe concentration of the upstream primer of saltant type specific upstream primer, described shared downstream primer, described probe, described detection house-keeping gene GAPDH, the downstream primer of described detection house-keeping gene GAPDH and described detection house-keeping gene GAPDH is respectively 500nM, 500nM, 100nM, 5pm, 5pm, 2.5pm; And the concentration and probe concentration of the upstream primer of wild type specificity upstream primer, described shared downstream primer, described probe, described detection house-keeping gene GAPDH, the downstream primer of described detection house-keeping gene GAPDH and described detection house-keeping gene GAPDH is respectively 500nM, 500nM, 100nM, 5pm, 5pm, 2.5pm in described A type PCR reaction tubes.

Owing to introducing the base of mispairing in allele-specific primers, make its react time decrease in efficiency, different primer decline degree is different, usually 10 to 20 effects that just can reach when not having mispairing that circulate will be increased, ensure the sensitivity detected, preferred PCR reaction is undertaken by two step amplification cycles programs, and the cycle number of the first step amplification is less than the cycle number of second step amplification, the annealing temperature that the annealing temperature that the described the first step increases increases higher than second step, the first step amplification uses higher anneal temperature, second step amplification uses comparatively low temperature thermal oxidation, specificity when object is primer annealing when increasing the first step amplification, thus ensure that Past-PCR detects the object of high degree of specificity, specifically the condition of preferred described PCR reaction is: 37 DEG C of 2min, 95 DEG C of 2min denaturations, the first step increases, 95 DEG C of sex change 5s, and 55 DEG C ~ 68 DEG C annealing 32s, circulate 10 ~ 15 times, second step, 95 DEG C of sex change 5s, 50 DEG C ~ 65 DEG C annealing, extend 32s, circulates 30 ~ 50 times, collection fluorescent signal, the condition of more preferred PCR reaction is: 37 DEG C of 2min, 95 DEG C of 2min denaturations, the first step increases, 95 DEG C of sex change 5s, and 63 DEG C of annealing 32s, circulate 15 times, second step, 95 DEG C of sex change 5s, 60 DEG C of annealing, extend 32s, circulates 40 times, collection fluorescent signal.

Concrete testing process is:

1) detected sample is put into respectively be coated with wild-type special primer respectively in advance, the downstream primer shared, probe, detect the upstream primer of house-keeping gene GAPDH, detect the downstream primer of house-keeping gene GAPDH, detect probe and the saltant type special primer of house-keeping gene GAPDH, the downstream primer shared, probe, detect the upstream primer of house-keeping gene GAPDH, detect the downstream primer of house-keeping gene GAPDH, detect in probe two groups of PCR reaction tubess of house-keeping gene GAPDH, and add PCR damping fluid, dNTPs and Taq enzyme mixed solution, sterilizing ultrapure water and genomic dna, cover tightly pipe lid, quantitative real time PCR Instrument reacts, and collect fluorescent signal,

2) if detect the sample amplification curve that only has saltant type reaction tubes to have logarithm to increase at FAM passage, while the VIC passage amplification curve that has logarithm to increase, can judge that sample is as T-shaped, i.e. saltant type homozygote;

If detect the sample amplification curve that only has wild-type reaction tubes to have logarithm to increase at FAM passage, while the VIC passage amplification curve that has logarithm to increase, can judge that sample is as A type, i.e. wild-type homozygote;

If detection sample saltant type and wild-type reaction tubes are at FAM passage all without the amplification curve that logarithm increases, possible sample or operation have problems, or sample DNA concentration is too low, should again extract sample DNA and test.

Each component introduction in testing process is described in detail in detail below:

(1) allele-specific primers:

The allele-specific nucleotide partial complementarity of allele-specific primers in an allelotrope site of gene, but is not complementary to another allelotrope site of this gene.Typically, the allele-specific nucleotide part of allele-specific primers is positioned at the last bit base that 3 ' of allele-specific primers is held.In some cases, allele-specific nucleotide part also can be positioned at other base positions of allele-specific primers 3 ' end.

In some cases, allele-specific primers is except 3 ' termini-complementary changes to some extent in allelotrope site, we usually will introduce the base of mispairing in other positions of primer, as held penultimate or the 3rd to introduce base mispairing at primer 3 ', or second and the continuous mispairing of the 3rd; For different SNP or mutational site, hold at primer 3 ' on the basis of penultimate or the 3rd introducing base mispairing, also can increase the requirement that base mispairing meet atopic in other site of primer, more away from 3 ' end, the base number increasing mispairing is more, can reach at most at 5 ' end.Its T of length Main Basis of allele-specific primers _mvalue decides, typically its T _mbe worth about 5-20 DEG C lower than the annealing temperature of PCR circulation.

Article two, detect the allele-specific upstream primer of corresponding gene pleiomorphism, except its base difference of site that 3 ' end detects, all the other sequences are identical as far as possible, the T of two primers _mbe worth also consistent as far as possible.

Low T _mallele-specific primers (ASP) have higher specificity.Generally, allele-specific primers is short oligonucleotide, and its length is about 15-30, its T _mabout 40 DEG C to 60 DEG C, lower than the annealing/elongating temperature of the PCR cycling condition used in amplification procedure about 5 DEG C to 20 DEG C.

Due to the design of allele-specific primers and screening very important, good primer needs to select from numerous primer to be selected, and therefore we establish the method for a screening, and the concrete screening process of its allele-specific primers is as follows:

(1) design peripheral primer and pcr amplification: first in the upstream and downstream of transgenation point to be checked or SNP site, design a pair pcr amplification primer, then use this to primer, conventional PCR reaction is carried out to goal gene, wherein expanding fragment length can at tens to many kilobases pair, and preferred length is 200 to 500 base pairs;

(2) clone PCR products: by the PCR primer amplified, utilizes the method that AT clones, and in the carrier T plasmid of recombinating common, obtains recombinant plasmid, and the recombinant plasmid wherein obtained can carry out sequence verification, thus guarantees the exactness of PCR primer;

(3) build recombinant mutant: the information provided according to information biology, adopt molecule clone technology, by the sequence of mutant, build up in recombinant plasmid obtained above, the recombinant mutant of structure is carried out sequence verification sequence, thus guarantee its exactness;

(4) design and screen specific primer on the mutated site: designing two allele-specific primerses, 3 ' end of a primer is complementary with mutant nucleotide sequence, and 3 ' end of another primer is complementary with normal sequence; Then respectively with allele-specific primers and the common downstream primer pairing of corresponding Standard PCR, using the above-mentioned recombinant mutant built as reaction template, utilize quantitative real time PCR Instrument, to reaction system, screen; Wherein, reaction can adopt fluorescence dye, as SYBR GREEN, also can adopt specific Taqman fluorescence probe, and the standard being 0.1 microgram complete genome DNA according to added sample size is screened, and its concrete screening content is as follows:

(a) setting PCR reaction conditions: the annealing temperature first setting PCR reaction is completely the same, actual temp is 55 DEG C ~ 68 DEG C, PCR cycle index is 40 times, the enzyme of PCR reaction and buffer system immobilize after all optimizing, and simultaneously the setting of this reaction conditions conveniently detects several genes sudden change;

(b) specificity screening: adopt the primer of saltant type with the recombinant plasmid of wild-type for template, its Ct of the primer filtered out is greater than 40;

Wherein the determination reason of cycle threshold is as follows, mutant primers at wild-type template generation non-specific amplification than wild primers in many 19 circulations of wild-type template generation specific amplification, when detecting according to clinical practice, added sample size is the standard of 0.1 microgram complete genome DNA, we are by following formula, and copy number=(DNA measures ng × 6.022 × 10 ²³)/(length bp × 10 ⁹× 660), wherein the length of complete genome DNA is 3,000,000,000 pairs of bases, and therefore the copy number of 0.1 microgram complete genome DNA is: 3.09 × 10 ⁴be reflected in the quantitative cycle threshold of Ct(of quantitative fluorescent PCR) be probably 21, we obtain second screening index like this, namely use the primer of saltant type, when the recombinant plasmid of wild-type is template, the Ct of gained should be greater than 40, can ensure that detection there will not be false positive, both amplification efficiency differences are 40-21=19 circulation, and namely amplification efficiency differs more than 19 circulations, will become the objective indicator that we judge allele-specific primers specificity quality.We know when primer 3 ' is held with template mispairing, extend efficiency and will decline 10 ³-10 ^6.6doubly, be converted into reaction cycle number then to decline about 13 to 27 circulations, Here it is, and we can filter out the theoretical foundation of desirable primer, because do not carry out primer screening, 19-13=6 circulation, certainly will produce false positive, the specificity of this primer is just bad, and 19-27=-8, false positive can not be produced, have the scope of 8 cycle numbers to screen primer for us.According to this requirement, we design a series of allele-specific primers, set about from length, near the artificial base mispairing of introducing of 3 ' end, add its downstream primer matched, utilize the wild-type and saltant type recombinant plasmid that build, carry out the intersection screening of quantitative fluorescent PCR reaction respectively, namely when increasing by the template of mutant primer and wild-type, more than multiplex 19 cycle numbers are wanted with the reaction of wild-type template with wild primers, vice versa, and so such primer just possesses the specificity of height.

C () susceptibility is screened: the Auele Specific Primer filtered out is done sensitivity test with recombination mutation type plasmid, and Auele Specific Primer detection sensitivity being less than 10-1000 copy screens, and is required mutant-specific primers.

By the screening of above several respects, the allele-specific primers obtained will possess high degree of specificity and extremely sensitive desirable primer.

(2) detection probes:

In some cases, the T of detection probes _mvalue is approximately 60 DEG C to 70 DEG C, and the best is 65 DEG C, and probe length is according to its T _mvalue determines.Although there is multiple multi-form probe available, Taqman probe (Applied Biosystems, Foster City) is usually first-selected.In some special cases, as detected AT too high levels in sequence, can adopt and improve T _mthe probe of the types such as the Taqman-MGB of value.

The Auele Specific Primer shared, in some cases, the T of the Auele Specific Primer shared _mvalue is approximately 50 DEG C to 70 DEG C, and the best is 60 DEG C, and its length is by its T _mvalue determines, generally between 15-25 base.

(3) other compositions:

The archaeal dna polymerase that the present invention uses is Taq enzyme, and mutant, derivative or fragment, may also be other hot resistant DNA polymerase, in some cases, also can adopt Hotstart Taq enzyme, to increase the special of reaction and high efficiency.

The primer provided for C-KIT gene D816V mutational site provided in the present invention and test kit, mainly for the shortcoming of allele-specific primers pcr amplification method, utilize molecule clone technology, build the recombinant plasmid containing gene wild-type to be checked and saltant type in advance respectively, with this recombinant plasmid for positive template, screening determine specifically respectively with two special primers of 3' terminal mutation site or wild site base complementrity, once the specific primer sequences filtered out, it will be the key element of our detection system.The said products of the present invention, can be used for the quantitative real time PCR Instrument of any model, and reagent cost is worked as with nowadays quantitative fluorescent PCR Reagent evaluation on the market, therefore overcomes the deficiency that other adopt allele-specific primers pcr amplification methods preferably.

The invention has the advantages that: described test kit has simple to operate, cost is low, result judges easily simple, highly sensitive, and the mutator gene DNA template number that this test kit detection transgenation sensitivity can reach 1%(and goal gene accounts for 1% of wild-type DNA profiling number); And the mutator gene DNA template number that the sensitivity detecting transgenation in direct Sequencing is 20%(and goal gene accounts for 20% of wild-type DNA template number); Taqman probe technique has ensured that the stopped pipe that is detected as of test kit reacts, effectively avoid false-positive generation, its detection specificity is also fully guaranteed, and detect quick and convenient, whole testing process only has 80 minutes, direct Sequencing then needs the time of 2 days, and is open pipe operation, and the possibility that PCR primer is polluted increases.

PCR(Past-PCR in the present invention) implementation step:

1. the structure of positive plasmid

Upstream and downstream design one couple of PCR primers in C-KIT gene D816V mutational site to be detected, the length of its amplified fragments can in the scope of 500bp, be template with gDNA, adopt conventional PCR method, amplify this fragment, by the mode that AT clones, be cloned in the plasmid of order-checking by this fragment, the pCR2.1 Topo carrier T test kit of usual Invitrogen, operation by specification carries out, also can with the carrier T test kit of other producers, the carrier T plasmid even can prepared with oneself.The positive colony obtained, through sequence verification, prove the exactness of sequence, then the Quickchange test kit of Stratagene company is adopted, design another genotyping primer in corresponding site, by the method for Quickchange, obtain other positive colony of this saltant type, operation by specification carries out, and the positive plasmid obtained must be all next step the use of being correctly allowed for access through sequence verification.The quantitative plasmid of Taqman, and be used as template to verify susceptibility, linear dynamic range, the specificity of given assay method.

2. the design of allele-specific primers (ASP) and screening

At the transgenation base position of primer 3 ' termini-complementary in correspondence, and introduce base mispairing primer 3 ' end penultimate or the 3rd, or second and the continuous mispairing of the 3rd; For different SNP or mutational site, hold on the basis of penultimate or the 3rd introducing base mispairing at primer 3 ', also can increase the requirement that base mispairing meets atopic in other site of primer, more away from 3 ' end, the base number increasing mispairing is more, can reach maximum allele-specific primerses at 5 ' end.

The screening of ASP utilizes the wild-type and saltant type recombinant plasmid that build, carry out the intersection screening of quantitative fluorescent PCR reaction respectively, namely when increasing by the template of mutant primer and wild-type, more than multiplex 19 cycle numbers are wanted with the reaction of wild-type template with wild primers, vice versa, and so such primer just possesses the specificity of height.The Auele Specific Primer filtered out is done sensitivity test with corresponding recombinant plasmid, detection sensitivity is less than the sensitivity requirement that namely 10-1000 the primer copied reach detection, the primer meeting above-mentioned two conditions is exactly the ASP primer that we select, and can carry out next step detection.

3. amplifing reagent prepares and adds detected sample

(1) from test kit, take out each moiety, room temperature slowly melts PCR damping fluid, dNTPs and Taq enzyme mixed solution, positive quality control product, blank, puts upside down and shakes up.Each reaction tubes need add PCR damping fluid, Taq enzyme (dNTPs), sterilizing ultrapure water and DNA sample.Cover tightly pipe lid, after brief centrifugation, transfer to pcr amplification district.

(2) advise that the analysis of sample, positive quality control product, blank is carried out in each PCR reaction all simultaneously, the loading methods of positive quality control product and blank is with sample Adding Way.

4. reaction conditions

In each reaction tubes, (scope of reaction final volume can at 10-50 μ l, and the best is at 20-25 μ l reaction volume) comprises PCR damping fluid (10mM Tris-HCl pH8.3,50mM KCl, 0.1%Triton X-100,2.0mM MgCl ₂), 10-100ng DNA or 1,000, the plasmid DNA of 000 copy, the general specificity T aqman probe that 50nM-400nM mono-is common, the general reverse specific Down Stream primer common with a 50nM-2uM, and the different allele-specific primers of 50nM-2uM, 1pm-20pm detects the upstream primer of house-keeping gene GAPDH, 1pm-20pm detects the downstream primer of house-keeping gene GAPDH, 0.05pm-5pm detects the probe of house-keeping gene GAPDH, adds 1.5 units of Taq polymerase, 200 μMs of dNTPs.

1), cycling condition is arranged

For making fluorescence curve more attractive in appearance, advise collecting fluorescent signal from second step.

2), instrument sense channel is selected

Fluorescence signal acquisition temperature is set to 60 DEG C, and concrete method to set up please refer to corresponding instrument working instructions.

3), type of detection setting: blank is set to " NTC ", and positive quality control product and sample to be checked are set to " Unknown ".

5. interpretation of result

If detect the sample amplification curve that only has saltant type reaction tubes to have logarithm to increase at FAM passage, while the VIC passage amplification curve that has logarithm to increase, can judge that sample is as T-shaped, i.e. saltant type homozygote; If detect the sample amplification curve that only has wild-type reaction tubes to have logarithm to increase at FAM passage, while the VIC passage amplification curve that has logarithm to increase, can judge that sample is as A type, i.e. wild-type homozygote; Because present method result is " all or none ", result very easily judges, which pipe responds, and which pipe is exactly positive.

Specific embodiment

Below for the situation detected C-KIT gene D816V mutational site, specifically the present invention is further detailed explanation.

Embodiment 1: for the wild-type in C-KIT gene D816V mutational site and the preparation of saltant type positive plasmid

C-KIT encoded K IT acceptor participates in regulatory gene and expresses, controls Growth of Cells and propagation, and the sudden change of C-KIT gene can cause the generation of the malignant tumours such as acute myelocytic leukemia, gastrointestinal stromal tumor and carcinoma of testis.Clinical study shows that the curative effect of the catastrophe of C-KIT gene in gastrointestinal stromal tumor and Imatinib molecular targeted therapy is closely related.The patient's curative effect that there is C-KIT exons 11 sudden change is best, and patient's curative effect that exon 9 suddenlys change is taken second place, and the poorest without GIST patient's curative effect of transgenation.Propose in american cancer integrated network (NCCN) " soft tissue sarcoma's clinical therapeutic guideline ", before GIST patient accepts targeted drug treatment, first should carry out C-KIT detection in Gene Mutation, determine whether use targeted drug as clinical treatment measure according to detected result.Detect C-KIT transgenation for the reasonable application molecular targeted agents treatment instructing GIST patient, there is important reference value.

First we recall the gene order before and after C-KIT gene D816V mutational site from gene pool, and mutational site double underline is marked, in the upstream and downstream appropriate location (indicating with boldface type and underscore) in mutational site, design a pair cloning primer, amplified fragments is 116bp, mutational site comprises in it, and gene order shows below, SEQ No.1:

tttgatttttatttttggtgtactgaatactttaaaacaaaagtattggattttttataatataagcaacactatagtattaaaaagttagttttcactctttacaagttaaaatgaatttaaatggttttcttttctcctccaacctaatagtgtattcacagagacttggcagccagaaatatcct ccttactcatggtcggatcac aaagatttgtgattttggtctagccagag a catcaagaatgattctaattatgtggttaaaggaaacgtga gtacccattctctgcttgacagtc ctgcaaaggatttttagtttcaactttcgataaaaattgtttcctgtgattttcataatgtaaatcctgtctagggatatcacacattttagcagtcaaattaagtatacttcagcaaaatttgcatggtatgctgaacattactacaactaacattcaataatagaagtcctaattctaattgtgtaattttggggcatgtgaagg

Experimental procedure is as follows:

1) genomic dna is extracted

With the genome DNA extracting reagent kit of domestic Tian Gen company or Qiagen company, extract genomic dna, concrete operation step by specification carries out.The DNA sample prepared, measures concentration through ultraviolet spectrophotometer, its concentration is adjusted to 50ng/ μ l, be stored in-20 DEG C, or directly carry out reaction below.

2) AT clone obtains positive plasmid

First at catastrophe point upstream and downstream design cloning primer, in table 1:

Table 1. C-KIT gene D816V mutational site Wild type clone primer

In the PCR amplification system of 2 × PCR Master Mix (Fermentas) of 12.5 μ l, add 10 μMs of upstream primers and 10 μMs of downstream primers, and genomic dna 50ng, add water to cumulative volume 25 μ l, PCR reaction conditions is set as 95 DEG C of denaturation 3min, 95 DEG C of sex change 10s, 60 DEG C of annealing and extension 30s, 35 circulations altogether, get 15 μ l reaction product after reaction terminates, carry out the gel electrophoresis of concentration 2.5%, electrophoresis terminates rear observation, band conforms to the size of prediction, shows to increase successfully.Adopt the pCR2.0 TOPO carrier T of Life company of the U.S., by its operation instructions, the mode of being cloned by TA, obtain C-KIT gene D816V mutational site wild-type positive plasmid, concrete gene order is as follows, and it is correct that order-checking proves that institute obtains plasmid.

SEQNo.4：ccttactcatggtcggatcacaaagatttgtgattttggtctagccagag a catcaagaatgattctaattatgtggttaaaggaaacgtgagtacccattctctgcttgacagtc

3) rapid mutation method obtains mutant plasmid

Then, adopt the method (Quickchange, QC) producing rapid mutation, design mutant primer, because C-KIT D816V site is the change of a to t, concrete primer sequence is in table 2.

Table 2. obtains C-KIT gene D816V mutational site mutant clones primer

According to reaction conditions and the step of (Stratagene company) Quickchange test kit, complete the structure of mutant, the recombinant plasmid obtained, concrete gene order is as follows, through sequence verification, it is saltant type, then saltant type and wild plasmid is put-20 DEG C respectively and saves backup.

SEQ No.7：ccttactcatggtcggatcacaaagatttgtgattttggtctagccagag t catcaagaatgattctaattatgtggttaaaggaaacgtgagtacccattctctgcttgacagtc

Embodiment 2: the design of allele-specific primers (ASP) and specificity screening

For C-KIT gene D816V mutational site, design wild-type and a series of sudden change Idiotype primer as follows:

C-KIT-D816V-WT-F: gatttgtgattttggtctagccagtga（SEQ No.8）

C-KIT-D816V-mut-F: gatttgtgattttggtctagccagtgt（SEQ No.9）

C-KIT-D816V-mut-F1: atttgtgattttggtctagccagtgt（SEQ No.10）

C-KIT-D816V-mut-F2: tttgtgattttggtctagccagtgt（SEQ No.11）

C-KIT-D816V-mut-F3: gatttgtgattttggtctagccagact（SEQ No.12）

C-KIT-D816V-mut-F4: atttgtgattttggtctagccagact（SEQ No.13）

C-KIT-D816V-mut-F5: tttgtgattttggtctagccagact（SEQ No.14）

Design and synthesis Taqman specific probe C-KIT-D816V-Probe simultaneously:

SEQ No.15：FAM-aaaggaaacgtgagtacccattctctgctt-BHQ1。

Relevant primer and probe synthesize in Sangon Biotech (Shanghai) Co., Ltd..

Then match with above-mentioned 7 primers and C-KIT-D816V-R:5 '-gactgtcaagcagagaatgggtac-3 ' (SEQ No.16) primer respectively, add Taqman specific probe, adding wild-type recombinant plasmid about 30,000 copy that aforementioned structure obtains is template, quantitative real time PCR Instrument carries out primer specificity screening, reaction conditions is set as the first step 95 DEG C of 2min denaturations, 95 DEG C of 5s, 63 DEG C of 30s totally 15 circulations, do not collect fluorescent signal, second step 95 DEG C of 5s, 60 DEG C of 30s totally 40 circulations, collect fluorescent signal, the results are shown in Figure 1.

Wherein, in Fig. 1,1 ~ 7 curve represents C-KIT-D816V-WT-F respectively, C-KIT-D816V-mut-F, C-KIT-D816V-mut-F1, C-KIT-D816V-mut-F2, C-KIT-D816V-mut-F3, C-KIT-D816V-mut-F4, the pcr amplification curve of C-KIT-D816V-mut-F5, from Fig. 1, we find out that No. 1 wild primers produces amplified signal 19.5 circulations, the specificity of 2-6 primer is poor, non-specific amplification is produced respectively at 20.5-24 circulation time, same wild primers (No. 1) amplification efficiency difference is less than 19 circulations, No. 7 primer meets our requirement, at 40 circulation times, still do not increase, 19 circulations are differed by more than with wild primers amplification efficiency.In order to have better comparability with mutant primer, we with reference to the primer of No. 7 Primer redesign wild-type are: tttgtgattttggtctagccagaca(SEQ No.17).

Embodiment 3:ASP sensitivity is screened

Match with the common downstream primer SEQ No.16 in C-KIT gene D816V mutational site respectively with the mutant primers after screening again, use saltant type recombinant plasmid, according to 10 ⁶, 10 ⁵, 10 ⁴, 10 ³, 10 ², 10,0 makes gradient dilution, adds Taqman specific probe, in the enterprising line sensitivity checking of quantitative real time PCR Instrument.Mutant-specific primers can detect 100 mutant copied, and therefore this primer is exactly filter out by our method the best primer detecting C-KIT gene D816V mutational site, is shown in Table 3.

Embodiment 4: prefabricated PCR(Past-PCR of the present invention) reaction tubes

According to the requirement of two reaction tubess in each mutational site, namely a pipe detects wild type site, and another pipe detects mutational site, is coated in advance by the primed probe of suitable concentration in the milky PCR reaction tubes of 0.2ML.

In order to prevent occurring false negative when detecting, in each reaction tubes, be coated with the upstream primer, downstream primer and the probe that detect house-keeping gene GAPDH all in advance, wherein, GAPDH gene order is as follows:

cctccgggaaactgtggcgtgatggccgcggggctctccagaacatcatccctgcctctactggcgctgccaaggctgtgggcaaggtcatccctgagctgaacgggaagctcactggcatggccttccgtgtccccactgccaacgtgtcagtggtggacctgacctgccgtctagaaaaacctgccaaatatgatgacatcaagaaggtggtgaagcaggcgtcggagggccccctcaagggcatcctgggctacactgagcaccaggtggtctcctctgacttcaacagcgacacccactcctccacctttgacgctggggctggcattgccctcaacg（SEQ No.18）

The upstream primer sequence detecting house-keeping gene GAPDH is: ggctgtgggcaaggtcatc(SEQ No.19)

The downstream primer sequence detecting house-keeping gene GAPDH is: ctccgacgcctgcttcaccac (SEQ No.20)

The probe sequence detecting house-keeping gene GAPDH is: ccttccgtgtccccactgccaacgt (SEQ No.21)

Wherein, the probe 5 ' end detecting house-keeping gene GAPDH uses HEX fluorescent mark, 3 ' end BHQ mark, and because HEX and VIC belongs to same Air conduct measurement, and many instruments often adopt VIC to indicate, and therefore describe with VIC in literary composition.

In PCR reaction tubes, concrete details is in table 3.

The component of table 3. prefabricated C-KIT gene D816V mutational site Past-PCR reaction tubes and concentration

Because we are coated on saltant type and wild-type upstream primer, probe and common downstream primer, the upstream and downstream primer of detection house-keeping gene GAPDH and the probe of detection house-keeping gene GAPDH in the differential responses pipe of the number of finishing in advance, effectively prevent the operate miss of user, substantially increase operation efficiency simultaneously, greatly facilitate actual use clinically.

Embodiment 5: the checking of sample

Gather the tissue sample of melanoma patient, and with the genome DNA extracting reagent kit of Qiagen company, extraction genomic dna, concrete operation step by specification carries out.The DNA sample prepared, measures concentration through ultraviolet spectrophotometer, its concentration is adjusted to 100ng/ μ l for subsequent use.

We, with this mutant-specific primers filtered out, compare with wild primers simultaneously, and on same PCR Sptting plate, every two reaction tubess detect a gene locus, and one of them is mutational site, and another is wild type site.10mM Tris-HCl pH8.3 is comprised, 50mM KCl, 0.1%Triton X-100,2.0mM MgCl in each reaction tubes 20 μ l reaction volume ₂the DNA of 100ng melanoma patient, 100nM specificity T aqman probe, 500nM shares specific Down Stream primer, and 500nM wild-type specific upstream primer, or saltant type specific upstream primer, 5pm detects the upstream primer of house-keeping gene GAPDH, and 5pm detects the downstream primer of house-keeping gene GAPDH, 2.5pm detects the probe of house-keeping gene GAPDH, add 1.5 unit Taq archaeal dna polymerases, 200 μMs of dNTPs, all the other are deionized water.

The first step PCR reaction conditions is: 37 DEG C of 2min, 95 DEG C of 2min denaturations, then 95 DEG C of 5s, 63 DEG C of 30s, 15 circulations, and this step does not collect fluorescence; Second step PCR reaction conditions is: 95 DEG C of 5s, 60 DEG C of 30s, totally 40 circulations, and this step collects fluorescence.

1, carry out mutation allele homozygote (t site) according to the method described above to detect, its concrete gene order is:

SEQ No.22：ctagccagag t catcaagaat

The FAM passage pcr amplification graphic representation collected, as shown in Figure 2, wherein, 1 curve representative detects the amplification curve in saltant type PCR reaction tubes, and 2 curve representatives detect the amplification curve in wild-type PCR reaction tubes.

2, carry out wild allele genic homozygote (a site) according to the method described above to detect, its concrete gene order is:

SEQ No.23：ctagccagag a catcaagaat

The FAM passage pcr amplification graphic representation collected, as shown in Figure 3, wherein, 3 curve representatives detect the amplification curve in wild-type PCR reaction tubes, and 4 curve representatives detect the amplification curve in saltant type PCR reaction tubes.

Meanwhile, above-mentioned 2 are detected in cases, and when the amplification curve that VIC passage house-keeping gene GAPDH has logarithm to increase, as shown in Figure 4, the FAM passage amplification curve that has logarithm to increase simultaneously, then this experimental result is effective.

Therefore, from above-mentioned detection experiment, the detected result of this test kit is the result of " all or none ", even detected sample is mutation allele homozygote, in two PCR reaction tubess, only have the amplification curve that saltant type PCR reaction tubes all has logarithm to increase at FAM passage and VIC passage, and wild-type PCR reaction tubes has no the amplification curve of logarithm growth at FAM passage; If detected sample is wild allele genic homozygote, in two PCR reaction tubess, only have the amplification curve that wild-type PCR reaction tubes all has logarithm to increase at FAM passage and VIC passage, and saltant type PCR reaction tubes has no the amplification curve of logarithm growth at FAM passage.The detected result interpretation of this test kit is simple, the detected result decreasing test kit in the past needs the process of carrying out the series of complex calculating such as Δ Ct, reduce false determination ratio, also effectively prevent the generation that there is false negative false positive phenomenon in test kit detected result in the past simultaneously.In addition test kit provided by the invention can be used for the quantitative real time PCR Instrument of any model, and detecting instrument is simple, and cost is low, for scientific research and clinical C-KIT gene D816V site somatotype and gene mutation analysis provide strong instrument.

Sequence table

You Jinuo bio tech ltd, <110> Shenyang

<120> detects the primer in C-KIT gene D816V mutational site, test kit and PCR method thereof

<130> 2015

<160> 23

<170> PatentIn version 3.3

<210> 1

<211> 511

<212> DNA

<213> synthetic

<400> 1

tttgattttt atttttggtg tactgaatac tttaaaacaa aagtattggattttttataa 60

tataagcaac actatagtat taaaaagtta gttttcactc tttacaagttaaaatgaatt 120

taaatggttt tcttttctcc tccaacctaa tagtgtattc acagagacttggcagccaga 180

aatatcctcc ttactcatgg tcggatcaca aagatttgtg attttggtctagccagagac 240

atcaagaatg attctaatta tgtggttaaa ggaaacgtga gtacccattctctgcttgac 300

agtcctgcaa aggattttta gtttcaactt tcgataaaaa ttgtttcctgtgattttcat 360

aatgtaaatc ctgtctaggg atatcacaca ttttagcagt caaattaagtatacttcagc 420

aaaatttgca tggtatgctg aacattacta caactaacat tcaataatagaagtcctaat 480

tctaattgtg taattttggg gcatgtgaag g 511

<210> 2

<211> 21

<212> DNA

<213> synthetic

<400> 2

ccttactcat ggtcggatca c 21

<210> 3

<211> 24

<212> DNA

<213> synthetic

<400> 3

gactgtcaag cagagaatgg gtac 24

<210> 4

<211> 116

<212> DNA

<213> synthetic

<400> 4

ccttactcat ggtcggatca caaagatttg tgattttggt ctagccagagacatcaagaa 60

tgattctaat tatgtggtta aaggaaacgt gagtacccat tctctgcttgacagtc 116

<210> 5

<211> 28

<212> DNA

<213> synthetic

<400> 5

gtctagccag agtcatcaag aatgattc 28

<210> 6

<211> 28

<212> DNA

<213> synthetic

<400> 6

gaatcattct tgatgactct ggctagac 28

<210> 7

<211> 116

<212> DNA

<213> synthetic

<400> 7

ccttactcat ggtcggatca caaagatttg tgattttggt ctagccagagtcatcaagaa 60

tgattctaat tatgtggtta aaggaaacgt gagtacccat tctctgcttg acagtc 116

<210> 8

<211> 27

<212> DNA

<213> synthetic

<400> 8

gatttgtgat tttggtctag ccagtga 27

<210> 9

<211> 27

<212> DNA

<213> synthetic

<400> 9

gatttgtgat tttggtctag ccagtgt 27

<210> 10

<211> 26

<212> DNA

<213> synthetic

<400> 10

atttgtgatt ttggtctagc cagtgt 26

<210> 11

<211> 25

<212> DNA

<213> synthetic

<400> 11

tttgtgattt tggtctagcc agtgt 25

<210> 12

<211> 27

<212> DNA

<213> synthetic

<400> 12

gatttgtgat tttggtctag ccagact 27

<210> 13

<211> 26

<212> DNA

<213> synthetic

<400> 13

atttgtgatt ttggtctagc cagact 26

<210> 14

<211> 25

<212> DNA

<213> synthetic

<400> 14

tttgtgattt tggtctagcc agact 25

<210> 15

<211> 30

<212> DNA

<213> synthetic

<400> 15

aaaggaaacg tgagtaccca ttctctgctt 30

<210> 16

<211> 24

<212> DNA

<213> synthetic

<400> 16

gactgtcaag cagagaatgg gtac 24

<210> 17

<211> 25

<212> DNA

<213> synthetic

<400> 17

tttgtgattt tggtctagcc agaca 25

<210> 18

<211> 342

<212> DNA

<213> synthetic

<400> 18

cctccgggaa actgtggcgt gatggccgcg gggctctcca gaacatcatc cctgcctcta 60

ctggcgctgc caaggctgtg ggcaaggtca tccctgagct gaacgggaag ctcactggca 120

tggccttccg tgtccccact gccaacgtgt cagtggtgga cctgacctgccgtctagaaa 180

aacctgccaa atatgatgac atcaagaagg tggtgaagca ggcgtcggagggccccctca 240

agggcatcct gggctacact gagcaccagg tggtctcctc tgacttcaacagcgacaccc 300

actcctccac ctttgacgct ggggctggca ttgccctcaa cg 342

<210> 19

<211> 19

<212> DNA

<213> synthetic

<400> 19

ggctgtgggc aaggtcatc 19

<210> 20

<211> 21

<212> DNA

<213> synthetic

<400> 20

ctccgacgcc tgcttcacca c 21

<210> 21

<211> 25

<212> DNA

<213> synthetic

<400> 21

ccttccgtgt ccccactgcc aacgt 25

<210> 22

<211> 21

<212> DNA

<213> synthetic

<400> 22

ctagccagag tcatcaagaa t 21

<210> 23

<211> 21

<212> DNA

<213> synthetic

<400> 23

ctagccagag acatcaagaa t 21

Claims

1. one kind is detected the primer in C-KIT gene D816V mutational site, it is characterized in that, described primer comprises: the downstream primer that wild-type specific upstream primer, saltant type specific upstream primer and wild-type specific upstream primer and saltant type specific upstream primer share;

2. detect the reagent in C-KIT gene D816V mutational site, it is characterized in that: described reagent contains primer according to claim 1.

3. detect the test kit in C-KIT gene D816V mutational site, it is characterized in that: described test kit contains primer according to claim 1.

4. according to the test kit detecting C-KIT gene D816V mutational site described in claim 3, it is characterized in that: described test kit also comprise with primer described in claim 1 with the use of probe, wherein, described probe is Taqman probe, has SEQ No.15 sequence.

5. according to the test kit detecting C-KIT gene D816V mutational site described in claim 4, it is characterized in that: described test kit also comprises PCR reaction tubes, dNTPs and Taq enzyme mixed solution, PCR damping fluid, the upstream primer detecting house-keeping gene GAPDH, the downstream primer detecting house-keeping gene GAPDH, the probe detecting house-keeping gene GAPDH, positive quality control product and blank;

6. according to the test kit detecting C-KIT gene D816V mutational site described in claim 5, it is characterized in that: the probe of the upstream primer of described saltant type specific upstream primer, described shared downstream primer, described probe, described detection house-keeping gene GAPDH, the downstream primer of described detection house-keeping gene GAPDH and described detection house-keeping gene GAPDH is coated in T-shaped PCR reaction tubes in advance; And be coated in advance in A type PCR reaction tubes with the probe of the upstream primer of described wild-type specific upstream primer, described shared downstream primer, described probe, described detection house-keeping gene GAPDH, the downstream primer of described detection house-keeping gene GAPDH and described detection house-keeping gene GAPDH.

7. according to the test kit detecting C-KIT gene D816V mutational site described in claim 6, it is characterized in that: in described T-shaped PCR reaction tubes, the concentration and probe concentration of the upstream primer of saltant type specific upstream primer, described shared downstream primer, described probe, described detection house-keeping gene GAPDH, the downstream primer of described detection house-keeping gene GAPDH and described detection house-keeping gene GAPDH is respectively 50nM-2um, 50nM-2uM, 50nM-400nM, 1pm-20pm, 1pm-20pm, 0.05pm-5pm; And the concentration and probe concentration of the upstream primer of wild type specificity upstream primer, described shared downstream primer, described probe, described detection house-keeping gene GAPDH, the downstream primer of described detection house-keeping gene GAPDH and described detection house-keeping gene GAPDH is respectively 50nM-2um, 50nM-2uM, 50nM-400nM, 1pm-20pm, 1pm-20pm, 0.05pm-5pm in described A type PCR reaction tubes.

8. according to the test kit detecting C-KIT gene D816V mutational site described in claim 7, it is characterized in that: in described T-shaped PCR reaction tubes, the concentration and probe concentration of the upstream primer of saltant type specific upstream primer, described shared downstream primer, described probe, described detection house-keeping gene GAPDH, the downstream primer of described detection house-keeping gene GAPDH and described detection house-keeping gene GAPDH is respectively 500nM, 500nM, 100nM, 5pm, 5pm, 2.5pm; And the concentration and probe concentration of the upstream primer of wild type specificity upstream primer, described shared downstream primer, described probe, described detection house-keeping gene GAPDH, the downstream primer of described detection house-keeping gene GAPDH and described detection house-keeping gene GAPDH is respectively 500nM, 500nM, 100nM, 5pm, 5pm, 2.5pm in described A type PCR reaction tubes.

9. the PCR method of primer or the arbitrary test kit of claim 3 ~ 8 described in a claim 1, it is characterized in that: PCR reaction is undertaken by two step amplification cycles programs, and the cycle number of the first step amplification is less than the cycle number of second step amplification, the annealing temperature that the annealing temperature that the described the first step increases increases higher than described second step.

10. according to PCR method according to claim 9, it is characterized in that, the condition of described PCR reaction is: 37 DEG C of 2min, 95 DEG C of 2min denaturations; The first step increases, 95 DEG C of sex change 5s, and 55 DEG C ~ 68 DEG C annealing 32s, circulate 10 ~ 15 times; Second step, 95 DEG C of sex change 5s, 50 DEG C ~ 65 DEG C annealing, extend 32s, circulates 30 ~ 50 times, collection fluorescent signal; Or the condition of described PCR reaction is: 37 DEG C of 2min, 95 DEG C of 2min denaturations; The first step increases, 95 DEG C of sex change 5s, and 63 DEG C of annealing 32s, circulate 15 times; Second step, 95 DEG C of sex change 5s, 60 DEG C of annealing, extend 32s, circulates 40 times, collection fluorescent signal.