CN109593856A - A kind of kit and preparation method thereof of detection 2 codon 12/13 of KRAS gene extron mutation - Google Patents
A kind of kit and preparation method thereof of detection 2 codon 12/13 of KRAS gene extron mutation Download PDFInfo
- Publication number
- CN109593856A CN109593856A CN201910065629.7A CN201910065629A CN109593856A CN 109593856 A CN109593856 A CN 109593856A CN 201910065629 A CN201910065629 A CN 201910065629A CN 109593856 A CN109593856 A CN 109593856A
- Authority
- CN
- China
- Prior art keywords
- pcr
- kit
- codon
- droplet
- kras
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6883—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
- C12Q1/6886—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material for cancer
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6844—Nucleic acid amplification reactions
- C12Q1/686—Polymerase chain reaction [PCR]
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/156—Polymorphic or mutational markers
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Health & Medical Sciences (AREA)
- Organic Chemistry (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Engineering & Computer Science (AREA)
- Genetics & Genomics (AREA)
- Analytical Chemistry (AREA)
- Immunology (AREA)
- Molecular Biology (AREA)
- General Engineering & Computer Science (AREA)
- Biotechnology (AREA)
- Biophysics (AREA)
- Physics & Mathematics (AREA)
- Biochemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Microbiology (AREA)
- General Health & Medical Sciences (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Pathology (AREA)
- Oncology (AREA)
- Hospice & Palliative Care (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The present invention relates to biomedical kit for detecting nucleic acid technical fields, the specially research and development of the method for detection 2 codon 12/13 of KRAS gene extron mutation and kit.Kit includes: PCR amplification primer, and Taq-man probe, digital pcr premixed liquid, droplet generate oil, negative control and positive control；The kit is cheap, it is easy to operate, it is repeatable to obtain, based on droplet type digital pcr technology platform, due to its only must PCR reaction can detect a variety of deletion types in the most common site of codon 12 and 13 KRAS simultaneously, it can obviously reduce the consumption of reagent, consumptive material, the cost of single detection is only the 1/8 of other droplet type digital pcrs.The sensitivity of technical method in the past generally between 1%-50%, and it is proposed that technical method the detection sensitivity of genetic mutation is promoted clearly, be 1/1000.The detection method of the kit is provided simultaneously, provides reference for personalized medicine.
Description
Technical field
The present invention relates to biomedical kit for detecting nucleic acid technical field, specially detection KRAS gene extron 2 is close
The research and development of method and kit that numeral 12/13 is mutated, while preparation method being provided.
Background technique
With deepening continuously for Personalized medicine idea, the specific locus mutation for detecting specific gene, which has become, instructs target
To the prerequisite for the treatment of medication.Tyrosine kinase inhibitor (TKI) is the hot spot targeted drug of lung tumors treatment in recent years,
Compared with traditional radiotherapy and chemotherapy medicine, it can be obviously prolonged tumor patient life cycle, improve life quality.
Tumour occurrence and development are driven by oncogene.In numerous oncogenes, RAS gene family is mutated in human tumor
Probability highest is considered as ' Mountain Everest ' in oncogene field.RAS mutated tumor accounts for three points of all malignant tumours of the mankind
One of, wherein KRAS inspires a variety of fatal tumors of the mankind, such as lung cancer, colon cancer as the Main Subtype in RAS gene family
And cancer of pancreas.However, since the complexity and KRAS mutation tumour of KRAS signal path regulation are to the repellence of clinical medicine,
So that at present clinically still without the active drug and method for treating KRAS mutation tumour.KRAS mutation type tumour is most potential target
The non-small cell lung cancer molecular isoform (NSCLC) of tropism.In the case of NSCLC, KRAS mutation occurs mainly in 12 and No. 13
Codon.The most common codon mutation accounts for about the 39% of KRAS mutation type NSCLC, is KRAS-G12C mutation.Other are common prominent
Becoming includes KRAS- G12V (18-21%) and KRAS- G12D (17-18%) variant.
The detection technique of genetic mutation mainly has direct sequencing (also known as Sanger PCR sequencing PCR) and ARMS method at present.It is existing
Brief introduction is under respectively:
PCR sequencing PCR: PCR sequencing PCR needs to analyze sequencing sample amplification, purifying, sequence, and process is comparatively laborious, time-consuming, and to taking
Material and technical requirements are relatively high.Polymerase chain reaction-single-strand conformation polymorphism analysis (PCR-SSCP) PCR-SSCP is a kind of
Compare the method for classical detection in Gene Mutation, this method can detect unknown mutation.Compared with PCR sequencing PCR, PCR-
SSCP sensitivity is higher, easy to operate, is not necessarily to specific apparatus, can also detect to unknown mutation.ARMS method also referred to as expands
Increase and hinders abruptly-changing system (Amplification Refractory Mutation System, ARMS), allele characteristic PCR
(Allele Specific PCR, ASPCR) etc., i.e. allele specific amplification method (Allele Specific
Amplification, ASA selectively expand wild type or mutated genes.
The above-mentioned prior art has the following problems: it is expensive, it is complicated for operation, and generally require and lived by invasive tissue
Inspection, while being not easy to repeat to obtain.Studies have shown that in blood, pleural effusion, saliva, excrement equal samples, have mix on a small quantity in
Mutated tumor cell DNA in a large amount of wild type gene group DNA.The gene that mutation is detected from these low content samples, needs
A kind of sensitivity height, high specificity, simple and easy to do, the simple mutation detection methods of result judgement are looked for, is used for cancer patient, especially
Be patients with lung cancer targeting medication guide, highly sensitive early stage recurrence monitoring and medication during resistance mutation monitoring etc..
Summary of the invention
The purpose of the present invention is to provide a kind of kits of detection 2 codon 12/13 of KRAS gene extron mutation, should
Kit is cheap, easy to operate, repeats and obtains, and can detect various mutations type simultaneously, while providing the kit
Detection method, provide reference for personalized medicine.
The present invention using U.S. Bole droplet type digital pcr as platform, select 2 exon region of KRAS gene carry out probe and
The design of primer.The site that selected 2 exon codon 12/13 is mutated on KRAS exon 2 c.5562-c.5566,
The type that following mutation is covered in this potential 2 exon codon, 12/13 sudden change region is shown in Table 1:
The type for 2 exon codon 12/13 of the KRAS gene mutation that 1 present invention of table can detecte
Technical principle of the invention as shown in Fig. 2, first design be mutated with 2 exon codon 12/13 of KRAS gene it is wild
Type sequence is the Taq-man probe of template, this probe is marked with VIC fluorophor, is defined as site probe.
Technical principle of the invention is as shown in Figure 1, in 2 exon 3 of KRAS gene ' the not mutated region design in end, with wild
Type sequence is the Taq-man probe of template, this probe is marked with FAM fluorophor, is defined as reference probe.
Technical principle of the invention is as shown in Figure 1, if institute's test sample sheet is wild type, site probe and reference probe
In conjunction with sample DNA sequence, it is strong that the VIC and FAM fluorophor on probe can be detected identical or extremely similar signal
Degree；If the mutation of any of the above-described 2 exon codon 12/13 of KRAS gene occurs in sample, the site probe of VIC label cannot be with
Sample DNA combines, and the reference probe of FAM label can be in conjunction with sample DNA, therefore can detecte FAM fluorescence signal, and
Weaker VIC signal (mutation of 2 exon codon of KRAS gene, 12/13 heterozygous deletion), or can't detect VIC signal (KRAS
Homozygous 12/13 deletion mutation of 2 exon codon of gene).
Technical solution of the present invention is as follows:
A kind of kit that detection KRAS exon 2 codon 12/13 is mutated, comprising: PCR amplimer, Taq-man are visited
Needle, digital pcr premixed liquid, droplet generate oil, negative control and positive control；
The PCR amplimer, including inverse PCR amplimer and forward direction PCR amplimer, it is amplifiable to contain KRAS
On exon 2 c.5522-c.5637 (116-bp amplicon) sequence as shown in SEQ No.1；
The PCR amplification primer sequence is as follows:
Upstream primer sequence is as shown in SEQ No.2；
Downstream primer sequence is as shown in SEQ No.3；
Reference probe sequence is as shown in SEQ No.4；
Site probe sequence is as shown in SEQ No.5.
5 ' ends of the site probe and reference probe are connected with fluorophor, and 3 ' ends are connected with quencher.
The fluorophor is selected from 6- Fluoresceincarboxylic acid, chlordene -6- Fluoresceincarboxylic acid, FAM, Cy5, Cy3 or VIC；
The quencher is selected from 6- carboxyl tetramethylrhodamin, BHQ1, BHQ2 or MGB.
The digital pcr premixed liquid main component include Taq archaeal dna polymerase, dNTP, MgCl2, PCR buffer,
The agent of PCR increased response, stabilizer.
The use concentration of upstream primer and the downstream primer is 5 μM ~ 15 μM, the concentration in end reaction system
For the nM of 400 nM ~ 1200.
The use concentration of the site probe and reference probe is 5 μM ~ 25 μM, the concentration in end reaction system
For the nM of 100 nM ~ 500.
The negative control is from the non-small cell lung cancer cell H1975 for carrying KRAS gene wild type；It is positive right
According to from positive cell the human colon cancer cell SW480 or HCT- for carrying the mutation of 2 exon codon 12/13 of KRAS gene
116。
The preparation method of above-mentioned kit, comprising the following steps:
(1) .DNA is extracted: extracting the positive cell human colon cancer cell being mutated containing 2 exon codon 12/13 of KRAS gene
SW480 or HCT-116 and KRAS gene wild-type cell H1975；
(2) prepared by digital pcr reaction solution；
(3) .PCR reacts droplet preparation: PCR reaction solution being transferred to droplet card, droplet is added in oilhole and generates oil, system
Standby droplet；
(4) .PCR is expanded: after annealing, then amplified reaction；
(5) detection and calculating mutation rate.
The step (2) includes: by sample to be tested, PCR amplification upstream and downstream primer, without enzyme water, 2 exon of KRAS gene
The site probe and reference probe and digital pcr premixed liquid that codon 12/13 is mutated, which are mixed with to obtain digital pcr, to be mixed
Close liquid.
The amplified reaction process of the step (4) are as follows: 93~97 DEG C initial denaturation 3~15 minutes；93~97 DEG C of denaturation 5~
50 seconds, 55 DEG C~63 DEG C annealing/extension 60~120 seconds, carry out 20~60 circulations, 95 DEG C~100 DEG C enzymes inactivation 8~16 altogether
Minute, 16 DEG C of Infinite Cyclics.
The present invention has the effect of positive
(1) is at low cost
Peptide nucleic acid (Peptide Nucleic Acid, PNA) can also be used for the detection of multisite mutation at present.It and DNA template
Binding ability is higher than common oligonucleotides, if PNA and template correctly match clock synchronization and can prevent polymerase chain reaction, wild-type template
It can not expand；If mispairing occurs, binding ability declines rapidly, can be used to expand mutagenesis template at this time.This detection method has
The disadvantage and limitation being difficult to avoid that.On the one hand, need to be added the probe of PNA in this method to tie with wild type DNA
It closes, this adds increased cumbersome operating procedures；And efficiency of the PNA in conjunction with DNA is not 100%, this easily causes testing result inclined
Difference, it is difficult to avoid the occurrence of false negative or false positive；On the other hand, PNA cost is relatively high, increase testing cost at double, it is difficult to
A wide range of clinical application.
(2) a variety of missing informations in the most common site of codon 12 and 13 one-time detection KRAS
The present invention is based on droplet type digital pcr technology platform, due to its only must a PCR reaction can to detect simultaneously KRAS most normal
A variety of deletion types in the site of codon 12 and 13 seen can obviously reduce the consumption of reagent, consumptive material, and the cost of single detection is only
It is the 1/8 of other droplet type digital pcrs.12/13 mutation detection techniques of KRAS exon 2 codon of the invention are quantified with general
It compares, does not have to setting standard items, without setting quality-control product.General detection technique is qualitative detection, and mutation recall rate is lower, this
The technology of invention can achieve the absolute quantitation of real meaning, overcome the technologies such as qPCR can not accurate quantification the shortcomings that.
(3) is easy to operate
The present invention is based on droplet type digital pcr technologies to grow up, its result interpretation mode is data information, can be by software
The carry out result interpretation of full automation decreases to accelerate the speed of data analysis and generates false negative and false positive
The possibility of interpretation.The mode of its result description is the mode of absolute quantitation, can provide certain specific gene entrained by sample and become
The absolute quantity and ratio of different DNA.And accuracy rate is high, even if in the lower situation of sudden change sample content, quantitative analysis
Error also very little.
(4) sensitivity is high
The sensitivity of technical method in the past generally between 1%-50%, and it is proposed that inspection of the technical method to genetic mutation
It surveys sensitivity enhancement clearly, is 1/1000.Extremely micro take can be detected in the wild DNA of very high background
DNA with genetic mutation.
Detailed description of the invention
Fig. 1 is based on digital pcr method detection KRAS exon 2 codon 12/13 and is mutated schematic illustration；
Under Fig. 2 different temperatures, 2 exon codon 12/13 of KRAS gene is mutated amplification efficiency and the specificity inspection of digital pcr
It surveys；
Amplification efficiency and specific detection of the Fig. 3 in 63 DEG C of 2 exon codon 12/13 of KRAS gene mutation digital pcrs；
Fig. 4 specific detection: the exogenous DNA of different copy numbers, detection specificity is added；
Fig. 5 specific detection: the exogenous DNA of 46,600 copy numbers, detection specificity is added；
Fig. 6 sensitivity technique: 4.81% mutation rate DNA fluorescence detection result；
Fig. 7 sensitivity technique: 3% mutation rate DNA fluorescence detection result；
Fig. 8 sensitivity technique: 1.82% mutation rate DNA fluorescence detection result；
Fig. 9 sensitivity technique: 0.64% mutation rate DNA fluorescence detection result；
Figure 10 sensitivity technique: 0.16% mutation rate DNA fluorescence detection result；
Figure 11 sensitivity technique: 0.08% mutation rate DNA fluorescence detection result (being not detected)；
Figure 12 instance analysis: the paraffin-embedded tissue section preparation testing result of 2 exon G13A of KRAS gene mutation.
Specific embodiment
The present invention is specifically described below by embodiment, it will similarly be understood that following embodiment is served only for this
Invention is further described, and should not be understood as limiting the scope of the invention, those skilled in the art is according to this hair
Some nonessential modifications and adaptations that bright above content is made all belong to the scope of protection of the present invention.Following examples are specific
Technological parameter etc. is also only an example in OK range, i.e. those skilled in the art can be done properly by the explanation of this paper
In the range of select, and do not really want to be defined in hereafter exemplary specific value.
In following embodiments, if not specially show that reagent used is that analysis is pure, and agents useful for same can be from commercial channel
It obtains.Test method without specific conditions in text, the science that such as J Pehanorm Brooker is write usually according to normal condition
Condition described in publishing house's " Molecular Cloning:A Laboratory guide " book published in 2002, or according to item proposed by manufacturer
Part.Unless otherwise defined, all professional and scientific terms as used herein and meaning phase known to one skilled in the art
Together.In addition, any method similar to or equal to what is recorded and material can be applied to the method for the present invention.It is described in text
Preferred implement methods and materials be for illustrative purposes only.
Sequence of the invention is all from NCBI, according to the NCBI 2 exon wild type of KRAS gene announced and codon 12/
The design of 13 mutant sequences and synthesis high specific, the probe of high sensitivity, primer.Mainly there is human colon cancer cell in the source DNA
It is the genomic DNA of SW480 or HCT-116, this cell is respectively KRAS gene 2 exon G12V and G13D mutation, be can be used as
Positive control；The genomic DNA of Non-small cell lung carcinoma cell line H1975, this cell are KRAS gene wild type, can be used as yin
Property control；The paraffin-embedded tissue section preparation of 2 exon G13A of KRAS gene mutation is analyzed for case verification.
One) kit is constituted:
2 Kit components table of table
The EGFR genetic mutation detection kit of the present embodiment, including digital pcr premixed liquid, droplet generate oil, Taq-man is visited
Needle, PCR primer, negative control and positive control.Above-mentioned 2 Kit components of table are described as follows:
Digital pcr premixed liquid main component includes Taq archaeal dna polymerase, dNTP, MgCl2, PCR buffer, PCR increased response
Agent, stabilizer etc. (are provided, article No.: 1863023) by Bio-Rad company
It is mineral oil that droplet, which generates oily main component, and (provided by Bio-Rad company, article No.: 1863005), main function is micro-
PCR product is formed into Water-In-Oil microlayer model in dropization treatment process.
Taq-man probe: the TaqMan probe of 9 deletion mutation of EGFR exons 1 for identification, respectively upper rheme
Point probe and reference probe, are the nucleotide for connecting fluorophor and quencher, and sequence is shown in Table 3
PCR primer: amplifiable containing on KRAS exon 2 for inverse PCR amplimer and forward direction PCR amplimer
c.5522-c.5637 (116-bp amplicon)
CTGAAAATGACTGAATATAAACTTGTGGTAGTTGGAGCTGGTGGCGTAGGCAAGAGTGCCTTGACGATACAG
The segment of CTAATTCAGAATCATTTTGTGGACGAATATGATCCAACAATAGA sequence.Sequence is shown in Table 3
Table 3: primer probe sequence
It is 5 μM ~ 15 μM that 2 exon codon 12/13 of KRAS gene, which is mutated upstream primer and the use concentration of downstream primer,
Concentration in end reaction system is the nM of 400 nM ~ 1200, and preferred 2 exon codon 12/13 of KRAS gene is mutated upstream
The use concentration of primer and downstream primer is 10 μM, and the concentration in end reaction system is 800 nM,
The site probe of 2 exon codon 12/13 of KRAS gene mutation and the use concentration of reference probe are 5 μM ~ 25 μM,
Concentration in end reaction system is the nM of 100 nM ~ 500, preferred 2 exon codon 12/13 of KRAS gene mutation
The use concentration of site probe and reference probe is 10 μM, and the concentration in end reaction system is 200 nM,
Negative control is from the non-small cell lung cancer cell H1975 for carrying KRAS gene wild type.
Positive control is thin from the positive cell human colon carcinoma for carrying the mutation of 2 exon codon 12/13 of KRAS gene
Born of the same parents SW480 or HCT-116.
Two) application method of kit:
The specific detection step of 2 exon codon 12/13 of the KRAS gene mutation of the present embodiment is as follows:
1.DNA is extracted
The extraction of cell genomic dna: the positive cell people knot being mutated containing 2 exon codon 12/13 of KRAS gene is cultivated
Colon-cancer cell SW480 or HCT-116 and KRAS gene wild-type cell H1975.Blood/the cell provided with TIANGEN company/
Tissue gene group DNA extraction kit (article No.: DP304) extracts genomic DNA according to practical illustration book and then passes through KSP-
3700 measure its DNA concentration, determine sample-adding amount.
The extraction of paraffin-embedded tissue section preparation dissociative DNA: using there are the stones that 2 exon G13A of KRAS gene is mutated
Wax investing tissue section preparation, the paraffin-embedded tissue free nucleic acid extracts kit provided with Qiagen company (article No.:
56404), dissociative DNA is extracted according to reagent specification.Then glimmering by 3.0 nucleic acid-proteins of ThermoFisher company Qubit
Light quantitative instrument measures the concentration and purity of its dissociative DNA, controls sample-adding amount.
The preparation of digital pcr reaction solution
Site probe that sample to be tested, PCR amplification upstream and downstream primer, 2 exon codon 12/13 of KRAS gene are mutated and
Digital pcr is prepared less than the no enzyme water polishing of 22ul reaction system in reference probe and the mixing of digital pcr premixed liquid
Mixed liquor.
Table 4: the ddPCR of detection 2 exon codon 12/13 of KRAS gene mutation
3.PCR reacts droplet preparation
The 22 μ l ddPCR reaction solutions that will be prepared and be uniformly mixed are transferred to droplet and occur among card (DG8 cartridge)
In one row's sample aperture, hole bottom is avoided to generate bubble；70 μ l droplets are then added in oilhole and generate oil (droplet
Generation oil), rubber mat is installed；The droplet loaded generation card is put into QX200TM drop generators and prepares droplet.Often
The droplet preparation that card can once be completed at the same time 8 samples occurs for a droplet, generally completes in 2 minutes.This experiment reaction system
Pass through.Droplet grow up to be a useful person to be formed Water-In-Oil droplets up to a million carry out PCR reaction, each droplet at least contain one or without to
Examine nucleic acid target molecule.
Annealing temperature setting
Temperature gradient setting is followed successively by 64 DEG C, 63.7 DEG C, 63 DEG C, 61.8 DEG C, 60.4 DEG C, 59.2 DEG C, 58.4 DEG C, 58 DEG C, anneals
2 min of time.(see figure 2).The H1975 DNA (KRAS wild type) of isodose is added in each hole.It observes under different temperatures, KRAS base
Because the amplification efficiency and specificity of 2 exon codons 12/13 mutation digital pcr compare.The amplification effect of digital pcr at 63 DEG C
Rate and specificity are best.Therefore determine best 63 DEG C of (see figure 3)s of Tm.
Amplification
The droplet of each sample obtained is transferred in 96 hole PCR plates respectively in corresponding reacting hole.With aluminium film heat-sealing (180
DEG C, 5 sec), it is expanded on regular-PCR instrument.PCR response procedures are as follows: 93~97 DEG C initial denaturation 3~15 minutes；
93~97 DEG C be denaturalized 5~50 seconds, 58 DEG C~64 DEG C annealing/extension 60~120 seconds, altogether carry out 20~60 circulation,
95 DEG C~100 DEG C enzymes inactivate 8~16 minutes, 16 DEG C of Infinite Cyclics.
Preferably, digital pcr amplification condition are as follows: 95 DEG C initial denaturation 10 minutes；94 DEG C are denaturalized 30 seconds, 63 DEG C of annealing/extensions
120 seconds, 40 circulations are carried out altogether, and 98 DEG C of enzymes inactivate 10 minutes, 16 DEG C of Infinite Cyclics.
The setting of table 5:PCR amplification program
6. droplet detects
The droplet that 96 orifice plates after PCR amplification are put into QX200TM droplet type digital pcr instrument is read in instrument, and in software
The upper correct selective reagent type of QuantaSoft, and experiment type is set as RED, while detecting the fluorescence signal of FAM and VIC.
Instrument automatically analyzes the fluorescence signal of each droplet of each sample, and the label containing fluorescence signal is, without fluorescence signal
Labeled as 0.Then, it is automatically analyzed by Poisson distribution formula, QuantaSoft software can be obtained according to the ratio of positive droplet
Starting template DNA copy number concentration in PCR reaction system, and provide mutation percentage.
Result judgement
Signal collection is carried out to the product after pcr amplification reaction, 2 exon of sample to be tested KRAS gene is determined according to fluorescence signal
Whether 12/13 site of codon is mutated, and in micro- reaction droplet containing the wild type DNA profiling not mutated, while FAM occurs
With VIC fluorescence signal, it is denoted as a signal number；In micro- reaction droplet of DNA template containing mutation, only there is FAM fluorescence letter
Number.
Mutation rate calculates
The calculation formula of the 12/13 site mutation rate of codon of 2 exons is as follows:
(3) sensitivity and specificity of kit:
Specific detection: SW480DNA (2 exon G12V saltant type of KRAS gene) is diluted according to different copy numbers, copy
Number is followed successively by 600 copies, and 1250 copies, 2500 copies, 5000 copies, 10000 copies, 16500 copies, 25000 copy
Shellfish, 46600 copy (see figure 4)s remain to obviously detect its mutation (see figure 5) when copy number is 46600 copy, it was demonstrated that this
Invention has fabulous specificity.
Sensitivity technique: by SW480DNA (2 exon G12V saltant type of KRAS gene) and H1975DNA(KRAS gene
Wild type) it is diluted according to different copy numbers and mutually mixes.It when mutation rate is 0.16%, remains to detect its Positive mutants, continue
Dilution, fails to detect its Positive mutants (see Fig. 6 ~ 11), it was demonstrated that the invention has fabulous sensibility.
Four) application examples:
1. ctDNA is detected in paraffin-embedded tissue
1. the paraffin-embedded tissue section preparation (EMQN is bought) of 2 exon G13A of KRAS gene mutation, merging 1.5ml EP pipe
In, 1ml xylene soluble paraffin organization is added.
2. the paraffin-embedded tissue free nucleic acid extracts kit (article No.: 56404), according to examination provided with Qiagen company
Agent specification extracts dissociative DNA, water-soluble with 30ul.
3. ctDNA after Qubit3.0 measures its concentration and purity, determines sample-adding amount 8ul.
As a result as shown in figure 12, paraffin-embedded tissue section preparation dissociative DNA copy number are as follows: 260 copies；KRAS gene 2
Exon G13A is mutated ratio are as follows: 44.77%.
Sequence table
<110>Song Xianrang
<120>a kind of kit and preparation method thereof of detection 2 codon 12/13 of KRAS gene extron mutation
<160> 5
<170> SIPOSequenceListing 1.0
<210> 1
<211> 116
<212> DNA
<213>artificial sequence (artiartificial sequence)
<400> 1
ctgaaaatga ctgaatataa acttgtggta gttggagctg gtggcgtagg caagagtgcc 60
ttgacgatac agctaattca gaatcatttt gtggacgaat atgatccaac aataga 116
<210> 2
<211> 26
<212> DNA
<213>artificial sequence (artiartificial sequence)
<400> 2
tctattgttg gatcatattc gtccac 26
<210> 3
<211> 29
<212> DNA
<213>artificial sequence (artiartificial sequence)
<400> 3
ctgaaaatga ctgaatataa acttgtggt 29
<210> 4
<211> 20
<212> DNA
<213>artificial sequence (artiartificial sequence)
<400> 4
agctgtatcg tcaaggcact 20
<210> 5
<211> 15
<212> DNA
<213>artificial sequence (artiartificial sequence)
<400> 5
cctacgccac cagct 15
Claims (10)
1. a kind of kit that detection KRAS exon 2 codon 12/13 is mutated characterized by comprising PCR amplification is drawn
Object, Taq-man probe, digital pcr premixed liquid, droplet generate oil, negative control and positive control；
The PCR amplimer, including inverse PCR amplimer and forward direction PCR amplimer, it is amplifiable to contain KRAS
On exon 2 c.5522-c.5637 (116-bp amplicon) sequence as shown in SEQ No.1；
The PCR amplification primer sequence is as follows:
Upstream primer sequence is as shown in SEQ No.2；
Downstream primer sequence is as shown in SEQ No.3；
Reference probe sequence is as shown in SEQ No.4；
Site probe sequence is as shown in SEQ No.5.
2. kit according to claim 1, which is characterized in that 5 ' end connections of the site probe and reference probe
There is fluorophor, 3 ' ends are connected with quencher.
3. kit according to claim 1, which is characterized in that the fluorophor is selected from 6- Fluoresceincarboxylic acid, six
Chloro- 6- Fluoresceincarboxylic acid, FAM, Cy5, Cy3 or VIC；
The quencher is selected from 6- carboxyl tetramethylrhodamin, BHQ1, BHQ2 or MGB.
4. kit according to claim 1, which is characterized in that the digital pcr premixed liquid main component includes Taq
Archaeal dna polymerase, dNTP, the agent of MgCl2, PCR buffer, PCR increased response, stabilizer.
5. kit according to claim 1, which is characterized in that the use concentration of upstream primer and the downstream primer
It is 5 μM ~ 15 μM, the concentration in end reaction system is the nM of 400 nM ~ 1200.
6. kit according to claim 1, which is characterized in that the use concentration of the site probe and reference probe
It is 5 μM ~ 25 μM, the concentration in end reaction system is the nM of 100 nM ~ 500.
7. kit according to claim 1, which is characterized in that the negative control is wild from KRAS gene is carried
The non-small cell lung cancer cell H1975 of raw type；Positive control is mutated from 2 exon codon 12/13 of KRAS gene is carried
Positive cell human colon cancer cell SW480 or HCT-116.
8. a kind of preparation method of kit described in claim, which comprises the following steps:
(1) DNA is extracted: extracting the positive cell human colon cancer cell being mutated containing 2 exon codon 12/13 of KRAS gene
SW480 or HCT-116 and KRAS gene wild-type cell H1975；
(2) prepared by digital pcr reaction solution；
(3) PCR reacts droplet preparation: PCR reaction solution being transferred to droplet card, droplet is added in oilhole and generates oil, system
Standby droplet；
(4) PCR amplification: after annealing, then amplified reaction；
(5) detect and calculate mutation rate.
9. preparation method according to claim 8, which is characterized in that the step (2) includes: by sample to be tested, PCR
Expand upstream and downstream primer, without enzyme water, 2 exon codon 12/13 of KRAS gene be mutated site probe and reference probe and
Digital pcr premixed liquid is mixed with to obtain digital pcr mixed liquor.
10. preparation method according to claim 8, which is characterized in that the amplified reaction process of the step (4) are as follows:
93~97 DEG C initial denaturation 3~15 minutes；93~97 DEG C be denaturalized 5~50 seconds, 55 DEG C~63 DEG C annealing/extension 60~120 seconds, altogether
20~60 circulations are carried out, 95 DEG C~100 DEG C enzymes inactivate 8~16 minutes, 16 DEG C of Infinite Cyclics.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201910065629.7A CN109593856A (en) | 2019-01-24 | 2019-01-24 | A kind of kit and preparation method thereof of detection 2 codon 12/13 of KRAS gene extron mutation |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201910065629.7A CN109593856A (en) | 2019-01-24 | 2019-01-24 | A kind of kit and preparation method thereof of detection 2 codon 12/13 of KRAS gene extron mutation |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN109593856A true CN109593856A (en) | 2019-04-09 |
Family
ID=65965377
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201910065629.7A Pending CN109593856A (en) | 2019-01-24 | 2019-01-24 | A kind of kit and preparation method thereof of detection 2 codon 12/13 of KRAS gene extron mutation |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN109593856A (en) |
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN110452983A (en) * | 2019-07-05 | 2019-11-15 | 凯威康达(厦门)生物医药科技有限公司 | A kind of primer, probe, detection architecture and kit and method detecting 12 6 kinds of hot spot mutations of codon of KRAS gene |
| CN114196757A (en) * | 2021-12-28 | 2022-03-18 | 普瑞斯新(上海)生物医疗科技有限公司 | KRAS gene mutation multiple detection primer probe and kit thereof |
Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN105624309A (en) * | 2016-02-23 | 2016-06-01 | 深圳华大基因研究院 | Primer, probe and kit for detecting EGFR and/or K-ras genetic mutation |
| CN105713965A (en) * | 2015-11-23 | 2016-06-29 | 宋现让 | Kit for detecting PIK3CA gene mutation |
-
2019
- 2019-01-24 CN CN201910065629.7A patent/CN109593856A/en active Pending
Patent Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN105713965A (en) * | 2015-11-23 | 2016-06-29 | 宋现让 | Kit for detecting PIK3CA gene mutation |
| CN105624309A (en) * | 2016-02-23 | 2016-06-01 | 深圳华大基因研究院 | Primer, probe and kit for detecting EGFR and/or K-ras genetic mutation |
Cited By (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN110452983A (en) * | 2019-07-05 | 2019-11-15 | 凯威康达(厦门)生物医药科技有限公司 | A kind of primer, probe, detection architecture and kit and method detecting 12 6 kinds of hot spot mutations of codon of KRAS gene |
| CN110452983B (en) * | 2019-07-05 | 2022-09-20 | 凯威康达(厦门)生物医药科技有限公司 | Primer, probe, detection system, kit and method for detecting 6 hot spot mutations of KRAS gene 12 codons |
| CN114196757A (en) * | 2021-12-28 | 2022-03-18 | 普瑞斯新(上海)生物医疗科技有限公司 | KRAS gene mutation multiple detection primer probe and kit thereof |
| CN114196757B (en) * | 2021-12-28 | 2024-02-23 | 普瑞斯新(上海)生物医疗科技有限公司 | KRAS gene mutation multiple detection primer probe and kit thereof |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN107419018B (en) | Method and kit for detecting gene mutation based on Blocker primer and ARMS primer | |
| CN106520931A (en) | EGFR gene mutation detection primer probe and kit thereof | |
| CN105803088B (en) | The primer and probe and its kit of one group of detection Kras gene mutation | |
| CN103710460A (en) | Kit for quantitatively detecting EGFR (Epidermal Growth Factor Receptor) gene mutation and application thereof | |
| JP2014500028A (en) | Methods and compositions for detecting mutations in the human epidermal growth factor receptor gene | |
| CN107460235A (en) | A kind of mankind's ApoE genetic polymorphism detection kits based on ARMS PCR melting curve methods | |
| CN103923975A (en) | Kit for detecting deletion mutation of EGFR gene exon 19, and method thereof | |
| CN103923974A (en) | Kit for detecting T790M site mutation of EGFR gene exon 20, and method thereof | |
| CN104862401B (en) | Detect primer, kit and its PCR method of KRAS gene hot mutant sites | |
| CN109593856A (en) | A kind of kit and preparation method thereof of detection 2 codon 12/13 of KRAS gene extron mutation | |
| Tang et al. | Determination of low-abundance single-base point mutations based on endonuclease IV and branch migration system | |
| JP6453781B2 (en) | Methods and compositions for detecting human PI3KCA (PIK3CA) gene mutations | |
| CN105803076A (en) | Specific primer and probe for detecting T790M locus of EGFR gene | |
| CN107513577A (en) | A kind of method of efficient detection EGFRT790M mutant and probe and kit for detection | |
| CN110863053A (en) | Primer, probe and method for detecting EGFR vIII mutant | |
| CN104818340B (en) | Detect primer, kit and its PCR method of JAK2 gene V617F loci polymorphisms | |
| CN103740843A (en) | Kit and method for detecting 21L858R point mutation of EGFR (Epidermal Growth Factor Receptor) gene exons | |
| CN109971832A (en) | It is a kind of to detect the kit of gene mutation, method and application thereof | |
| CN108004320A (en) | EGFR genetic mutation detection architecture and its kit | |
| CN107937524A (en) | Mankind's KRAS gene mutation detection kit and detection method | |
| CN108251511A (en) | The detection kit and detection method of a kind of EGFR genetic mutation | |
| CN106755551A (en) | A kind of EGFR/L858R is mutated liquid biopsy kit and its application | |
| CN104846108B (en) | Detect primer, kit and its PCR method in C-KIT gene D816V mutational sites | |
| CN108728538B (en) | ALK gene fusion detection primer, method and kit | |
| CN107630089A (en) | For detecting primer, probe and the kit of the mutation of C-KIT gene 1689-1718 positions |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| RJ01 | Rejection of invention patent application after publication | ||
| RJ01 | Rejection of invention patent application after publication |
Application publication date: 20190409 |