CN107630089A - For detecting primer, probe and the kit of the mutation of C-KIT gene 1689-1718 positions - Google Patents

Abstract

The invention discloses a kind of primer, probe and kit for being used to detect 1,689 1718 mutation of C KIT genes.The primer is as shown in SEQ ID No.1 SEQ ID No.2, and the probe is as shown in SEQ ID No.3.Real-time fluorescence PCR is carried out using the kit of the present invention, 1,689 1718 mutation for replacing with GGGTCT of C KIT genes can be detected.

Description

For detecting primer, probe and the kit of the mutation of C-KIT gene 1689-1718 positions

Technical field

The present invention relates to biological technical field, specifically, be related to it is a kind of be used to detecting the primer of C-KIT gene mutations, Probe and related kit.

Background technology

C-KIT is a kind of proto-oncogene, positioned at chromosome 4q11-12, total length about 80kb.The C-KIT albumen of C-KIT codings Belong to type III receptor tyrosine kinase family member, it is the transmembrane protein that molecular weight is about 145KD, contains the junket of intracellular Histidine kinase area, transmembrane region and ligand binding site extracellular region.Itself tyrosine protein kinase can be activated after part is in connection Enzymatic activity, downstream signal transduction path is activated by series reaction, so as to adjust the growth of cell and propagation.

Gastrointestinal stromal tumor (GIST) is most common leaf source property tumour of alimentary canal.Research shows, in GIST patient C-KIT gene mutation rates are about 90%.

Sanger PCR sequencing PCRs are the main methods of C-KIT detection in Gene Mutation at present.However, the sensitivity of this method is low, Missing inspection and the generation of false negative can be caused, and detection time is grown, and can not meet the actual demand of clinical detection.It is clinically urgent Need to develop a kind of high sensitivity, quick C-KIT detection in Gene Mutation technology.

The present inventor is found that have with gastrointestinal stromal tumor in gastrointestinal stromal tumor (GIST) routine testing Close positioned at the new mutation site of C-KIT genes, i.e. 1689-1718 positions Substitution.The present inventor is directed to the mutation The detection method of a kind of quick, highly sensitive, easy to operate detection kit and correlation is developed, it is pre- to can be used for GIST chemotherapy Afterwards.

The content of the invention

It is an object of the invention to provide a kind of primer and probe for being used to detect C-KIT gene mutations, the mutation is 1689-1718 positions replace with GGGTCT (base mutations：1689_1718 ＞ GGGTCT, protein mutation：I563_P573 ＞ MGL). The primer of the present invention includes following sequence with probe：

Forward primer (F)：GTTGTTGAGGAGATGGGTCT(SEQ ID No：1)

Reverse primer (R)：AAGTCACTGTTATGTGTACCCAA(SEQ ID No：2)

Probe (PB)：CATGGAAAGCCCCTGTTTCATACTGACC(SEQ ID No：3)

Another aspect of the present invention provides a kind of detection kit for being used to detect the mutation of C-KIT gene 1689-1718 positions, institute State probe of the kit shown in including the primer and SEQ ID No.3 shown in SEQ ID No.1-SEQ ID No.2.

According to used PCR method, kit of the invention can also include reference gene and internal control gene.

Another aspect of the present invention provides a kind of method of detection C-KIT gene 1689-1718 positions mutation, and it includes following step Suddenly：

(1) extract sample in genomic DNA, detection sample include fresh pathological tissue, paraffin-embedded tissue, whole blood and Blood plasma etc.；

(2) DNA is expanded with the kit of the present invention；

(3) the Ct values shown according to fluorescent PCR instrument judge testing result：The FAM fluorescence intensities of reaction system are detected, with FAM reaches during the threshold value of setting required cycle-index Ct values as negative, Positive judgement standards, Ct values ＞ 38 or without amplification For feminine gender, Ct value≤38 are the positive.

, can be with specific detection C-KIT gene mutations present invention employs specific primer and probe technique.The method spirit Sensitivity height, high specificity, detection speed are fast.

Brief description of the drawings

Fig. 1 is the PCR figures of detection negative sample (wild type).

Fig. 2 is the PCR figures of detection mutation positive sample.

Embodiment

With reference to specific embodiment, the present invention is expanded on further.It should be understood that these embodiments be only used for the present invention and It is not used in limitation the scope of the present invention.The experimental method of unreceipted actual conditions, ripe according to those skilled in the art in embodiment The normal condition known, or the condition suggested according to manufacturer.

One, principles

After the specific primer of the present invention is combined with probe with DNA profiling, Taq archaeal dna polymerases are with deoxynucleotide (dNTP) it is substrate, reference gene (Internal Reference, IR) and C-KIT genic mutation type genes is expanded in vitro Increase.Detection uses Fluorescence PCR assay, hydrolyzes release fluorescence by specific probe, the progress of monitoring PCR reactions, determines C-KIT Gene mutation situation.

The kit of the present invention has been separately provided reference gene detection architecture.Reference gene is to be different from C-KIT bases to be checked The house-keeping gene of cause.By detecting the amplification situation (FAM passages) of reference gene, it can analyze whether DNA to be checked can normally be expanded Increase, it is bad so as to exclude DNA purity, concentration, or cause PCR to detect situation about failing containing PCR inhibitor etc..

The kit of the present invention is provided with internal control gene (Internal simultaneously in C-KIT genic mutation type detection architectures Control, IC) detection architecture.Two kinds of systems are reacted simultaneously in same PCR pipe.Internal control gene be also be different from it is to be checked Gene C-KIT house-keeping gene.Probe modification by identification C-KIT gene mutation templates is FAM fluorophors, and in identifying The probe modification for controlling gene template is HEX fluorophors.By detecting internal control gene magnification situation (HEX passages), it can analyze and treat Whether inspection DNA can normally be expanded, and is contained PCR inhibitor etc. so as to exclude Lou reagent adding or sample, sample and is caused PCR detections to lose Situation about losing.

When carrying out the judgement of this kit testing result, FAM, HEX Air conduct measurement all should be without amplifications in negative quality-control product (NC) (not in typical S types curve.Note：Typical S types curve shows as exponential phase, straight line phase and plateau successively) or without Ct values, FAM, HEX Air conduct measurement should have amplification (being in typical S types curve) and Ct value≤28 in positive quality control product (PC)；Otherwise it is assumed that It is invalid to test, and need to repeat to test.

Two, experiment materials and equipment

1. for mutational site design synthesis specific primer and probe

Special primer and probe are designed for C-KIT gene mutation sites.By specific primer and probe optimization, so as to Realize highly sensitive and quick detection.

Primer and probe after optimization is as follows：

Forward primer (F)：GTTGTTGAGGAGATGGGTCT(SEQ ID No：1)

Reverse primer (R)：AAGTCACTGTTATGTGTACCCAA(SEQ ID No：2)

Probe (PB)：CATGGAAAGCCCCTGTTTCATACTGACC(SEQ ID No：3)

2. detect sample process and DNA extraction

It can be fresh pathological tissue, paraffin-embedded tissue, whole blood, blood plasma and seroperitoneum to detect sample.Below only with Illustrated exemplified by paraffin-embedded tissue sample.

Before sample collection, patient without tyrosine kinase inhibitor (tyrosine kinase inhibitors, TKIs) class drug therapy；Because DNA sample quality can influence testing result, therefore it should determine that the FFPE in DNA sample source Contain cancerous tissue cell in tissue samples, and no less than the 25% of whole sample；And DNA sample OD260/OD280=1.8 ± 0.2, OD260/OD230 >=1.7；Concentration is 5-10ng/ μ l.

Conserving time limit is no more than 12 months paraffin-embedded tissue sample at room temperature, and the DNA sample after extraction is cold at -20 DEG C Conserving time limit is no more than 6 months under the conditions of jelly.

3. it is applicable instrument

Stratagene Mx3000P。

4. the composition of kit

Kit forms are shown in Table 1.Nucleic acid extraction composition is free of in kit, uses QIAamp DNA FFPE Tissue (Qiagen companies produce Kit, article No.：56404) kit completes the extraction of paraffin-embedded tissue sample DNA.Detection reagent forms And C-KIT genes mutational site to be checked is shown in Table 2.IR detection reagents are containing only reference gene detection architecture (FAM passages), C-KIT inspections Test agent contains C-KIT detection in gene mutation system (FAM passages) and internal control genetic test system (HEX passages) simultaneously.

Table 1：Kit forms

The particular sequence of wherein described reference gene and internal control gene can be by those skilled in the art according to experimental conditions It is readily determined or is provided by Beijing Yakangbo Biotechnology Co., Ltd..

Three, detection methods

1. QIAamp DNA FFPE Tissue Kit (production of Qiagen companies) kit is used, according to operation instructions Carry out paraffin-embedded tissue sample DNA extraction.

2. take the detection reagent and positive quality control product (PC) in kit.Test agent to be checked and positive quality control product PC melt Of short duration centrifugation afterwards, is placed on ice.

3. volume ratio mixing IR detection reagents and Taq archaeal dna polymerases by 17: 0.3, by 17: 0.3 volume ratio Mix C-KIT detection reagents and Taq archaeal dna polymerases.IR detection reagents and C-KIT detection reagents are dispensed to eight companies by 17.3/ hole Guan Zhong.2.7 μ l DNA samples to be checked, negative matter are separately added into eight connecting legs equipped with IR detection reagents and C-KIT detection reagents Control product (NC, the buffer solution of dissolving DNA, provided for oneself by user) and positive quality control product PC, piping and druming mix, cover tightly after lid it is of short duration from The heart.Pay attention to：Vortex oscillation instrument is not used during mixing；Subsequent operation is carried out after mixing immediately.

4. the setting of fluorescent PCR instrument sense channel needs simultaneous selection FAM, HEX passage (reference dye is arranged to "None").Reaction Program is set following (table 2)：

Table 2：

The explanation of four, testing results

1.Ct values determine：The baseline of Stratagene MX3000P fluorescent PCR instrument is set first：Selection " is adapted to baseline Fluorescence signal when (Adaptive baseline) " is set, threshold value (threshold) setting principle are just above with threshold line The peak of normal negative quality-control product NC amplification curves (random noise line), even negative quality-control product NC amplification curves are shown " No Ct " are defined.Ct value of each sample in each site primer is read from software.

2. qualitative analysis：

(1) quality of experiments is judged：If in NC FAM, HEX Air conduct measurement without amplification (not in typical S types curve.Note：Allusion quotation The S types curve of type shows as exponential phase, straight line phase and plateau successively) or without Ct values, FAM, HEX Air conduct measurement have expansion in PC Increase (being in typical S types curve) and Ct value≤28, then can continue to analyze；Otherwise it is assumed that experiment is invalid, need to repeat to test.

(2) reference gene (IR) detection case is judged in DNA sample to be checked：If reference gene detection (FAM passages) has expansion Increasing and 19≤Ct value≤25, then can continue to analyze；If its Ct value is smaller, then it is assumed that DNA sample excessive concentration；If its Ct value is larger Or without amplification, then it is assumed that DNA sample concentration is too low, degrades, or may wherein contain PCR inhibitor.

(3) internal control genetic test situation is judged in DNA sample to be checked：If internal control genetic test (HEX passages) have amplification and Ct value≤25, then it can continue to analyze；If internal control genetic test (HEX passages) Ct values are larger or without amplification, but mutational site is detected (FAM passages) has amplification and Ct value≤38, then can continue analysis (may produce because mutational site expands to internal control gene magnification Suppress)；If internal control genetic test (HEX passages) Ct values are larger or without amplification, and mutational site detection (FAM passages) without amplification or There are amplification but Ct values ＞ 38, then can not continue to analyze, need to repeat experiment (degraded may occur due to DNA sample, wherein contain PCR inhibitor is not loaded product).

(4) gene mutation situation is judged in DNA sample to be checked：If certain mutational site detection (FAM passages) has expansion in sample Increasing and Ct value≤38, then judge that sample mutation result is the positive；If Ct values ＞ 38 or without amplification, the sample abrupt junction is judged Fruit is feminine gender.

Pay attention to：Various mutations are may be simultaneously present in same DNA sample.

Fig. 1 is the PCR figures that testing result is negative sample, and Fig. 2 is the PCR figures that testing result is positive sample.

Passing through contrasting detection, it was demonstrated that fluorescence PCR method of the invention is consistent with the result of traditional sequencing methods, and this The sensitivity of the fluorescence PCR method of invention and selectivity are higher than traditional sequencing methods.

Therefore, Fluorescence PCR system of the present invention can detect C-KIT gene 1689-1718 positions and replace with the prominent of GGGTCT Become, easy to detect quick, accuracy is high, can meet the requirement of C-KIT gene mutation quick detections.

Claims (5)

1. A kind of 1. primer for being used to detect the mutation of C-KIT gene 1689-1718 positions, it is characterised in that the primer such as SEQ ID Shown in No.1-SEQ ID No.2.
2. A kind of 2. probe for being used to detect the mutation of C-KIT gene 1689-1718 positions, it is characterised in that the probe such as SEQ ID Shown in No.3.
3. 3. a kind of kit for being used to detect the mutation of C-KIT gene 1689-1718 positions, it is characterised in that the kit includes The probe shown in primer and SEQ ID No.3 shown in SEQ ID No.1-SEQ ID No.2.
4. 4. kit as claimed in claim 3, it is characterised in that it also includes reference gene and internal control gene.
5. 5. a kind of method of detection C-KIT gene 1689-1718 positions mutation, it comprises the following steps：

   (1) genomic DNA in sample is extracted；

   (2) DNA is expanded with the kit described in claim 3；

   (3) the Ct values shown according to fluorescent PCR instrument judge testing result.