CN104818340B

CN104818340B - Detect primer, kit and its PCR method of JAK2 gene V617F loci polymorphisms

Info

Publication number: CN104818340B
Application number: CN201510290700.3A
Authority: CN
Inventors: 高劲松; 张英杰; 李星颐; 王莹; 魏潇; 魏奇
Original assignee: SHENYANG EUGENOM BIOLOGICAL TECHNOLOGY Co Ltd
Current assignee: SHENYANG EUGENOM BIOLOGICAL TECHNOLOGY Co Ltd
Priority date: 2015-05-29
Filing date: 2015-05-29
Publication date: 2018-06-26
Anticipated expiration: 2035-05-29
Also published as: CN104818340A

Abstract

The invention discloses it is a kind of detect JAK2 gene V617F loci polymorphisms primer, kit and its PCR method, including：The downstream primer that wild type specific forward primer, saltant type specific forward primer and wild type specific forward primer are shared with saltant type specific forward primer；And the wild type specific forward primer has SEQ No.17 sequences, the saltant type specific forward primer has SEQ No.14 sequences, and the shared downstream primer has SEQ No.16 sequences；Kit has many advantages, such as that detection is simple, quick, accurate, cheap, and strong tool is provided for scientific research and clinic JAK2 gene V617F site partings and gene mutation analysis.

Description

Detect primer, kit and its PCR method of JAK2 gene V617F loci polymorphisms

Technical field

The present invention relates to molecular biology genetic test fields, specifically provide a kind of drawing for detection JAK2 gene pleiomorphisms Object, kit and its PCR method, for the quick detection of JAK2 gene V617F polymorphic sites.

Background technology

JAK is a kind of non-receptor type tyrosine protein kinase, finds there are 4 family members altogether so far, respectively JAK1, JAK2, JAK3 and JAK4.STAT is the direct substrate of JAK, and signal can be directly delivered in core, adjusts specific gene Expression.JAK-STAT signal paths are a signal paths very close with cell growth, proliferation, differentiation relationship, are also joined With hematopoiesis and the signal transduction of the systems such as immune, and kinases JAK plays key effect to the activation of entire signal path.Exist so far A variety of JAK point mutations are found in human leukaemia cell, some of them mutation can lead to stat protein sustained activation.Such as JAK2 genes V617F is mutated the abnormal activation that can lead to JAK-STAT signal paths, and bone marrow cell is caused to generate abnormality proliferation.

Bone marrow proliferative diseases（Myeloproliferative diseases, MPD）It is that one group of hematopoietic neoplasia increases Natural disposition disease.There are a system or polyphyly cell especially to protrude on the basis of the universal hyperplasia of bone marrow cell, in continual excessive Mature cell quantity, which increases, in proliferation and peripheral blood is characterized.Its clinical manifestation have heterogeneity, but each hypotype nearly all with Leucocyte, blood platelet and megacaryocyte increase, and myelofibrosis and marrow failure occurs in the later stage, can be converted with disease progression part For other diseases.Its classical classification is broadly divided into chronic myelocytic leukemia（Chronic myelogenous leukemia, CML）, polycythemia vera（Polycythemia vera, PV）, primary thrombocytosis（essential Thrombocythemia, ET）And primary myelofibrosis（Primary myelofibrosis, PMF）Deng.

JAK2 gene V617F polymorphic sites are happened at 65% ~ 97% polycythemia vera（PV）, 23% ~ 57% Primary thrombocytosis（ET）And 35% ~ 57% primary myelofibrosis（PMF）In patient.According to JAK2 mutation and bone The substantial connection of marrow proliferative disease, in 2008 World Health Organization of revision（WHO）In categorizing system, JAK2 genes V617F Polymorphic site becomes Chronic Myeloid proliferative diseases（MPD）Main diagnosis index.

It is common to have direct sequencing at present to the detection of gene mutation and gene pleiomorphism；Gene chip hybridization method；PCR- RFLP methods；Pcr amplification product capillary electrophoresis analysis method；PCR-SSCP；PCR high-resolution fusion curve analytical technologies；PCR- Taqman MGB（Minor Groove Binder）Sonde method；AS-PCR methods；Cast-PCR methods etc..These methods are more or less Also there are instrument price height, and operation difficulty is big, and there are certain false negative and false positives, and testing cost is high, and clinical popularity is low, The shortcomings of clinical samples cannot be detected on a large scale simultaneously.

Such as：1）Direct sequencing is the goldstandard of mutation analysis, can find known and unknown mutation site, but the method detects The sensitivity of gene mutation is 20%（That is the mutator DNA profiling number of target gene accounts for the 20% of wild type DNA profiling number）.Together When also there are complicated for operation, the period is long, and analyze speed is slow, often needs the time of 2 days, and the method is open pipe operation, is increased greatly Add the possibility of pollution, be not suitable for the detection to extensive sample, while also need to expensive instrument, exist and be not easy reality in base The shortcomings of applying.

2）Regular-PCR-RFLP method and technologies are easy, cheap, and suitable for the test in laboratory of a small amount of sample, but RFLP is only The mutation for having restriction enzyme site can be detected, no restriction enzyme site cannot detect, time-consuming and laborious, and also there are PCR product pollutions to lead to false sun The risk of property, is shown in [2010 Jun 1 of Mol Diagn Ther.;14(3):163-9, United States Patent 20120135406]。

3）Chip technology has the characteristics that high-throughput, micromation, automation compared with traditional instrument detection method, is applicable in In full genome mutated scanning, it is not suitable for the mutational site detection of individual gene, and precision is low, it is expensive.

4）PCR high-resolution fusion curve analytical technologies, the catastrophe of the high-throughput detection gene of energy, reagent cost is relatively low, But because its fluorescence signal is from dyestuff, specificity is affected, and detecting instrument is the fluorescent PCR instrument of upgrade version, and price is high It is high, it popularizes and is limited, see [2012 Nov 12 of Clin Chim ACta.;413(21-22):1781-5; United States Patent 20110045479]。

5）PCR-Taqman MGB sonde methods are suitble to known mutations site, it is often necessary to two probes, and Taqman MGB The synthesis price of probe is several times of general T aqman probes, sees [2010 Aug of J Clin Microbiol.;48(8): 2909-15；United States Patent 20090311679], and cannot detect the content in sample it is less (>=1, 1 in 000) allele or mutational site.

6）Although PCR-SSCP methods are simple, which is open detecting system, be easy to cause the pollution of PCR product, And operating procedure is more, and it is time-consuming and laborious.

7）Allele-specific primers PCR amplification method (AS-PCR), this method are current detection gene mutations or more The most simple and quick method of state property（Wu D Y, Ugozzoli L, Pal B K, Wallace R B., Proc Natl Acad Sci USA 1989; 86:2757-2760), principle is the base mispairing of primer 3' terminal bases and template, PCR Efficiency will decline 10³-10^6.6(Chen, X., and Sullivan, P F, The Pharmacogeonomics again Journal 2003, 3, 77-96).Although the principle of this method is simple, non-specificity can still occur for the primer of mispairing Amplification, amplification situation regard type (Ayyadevara S, the Thaden J related to the base sequence around detection site of mutation J, Shmookler Reis R J., Anal Biochem 2000; 284:11-18), also with equipotential base present in sample The influence of dependent variable.In order to increase the specificity of AS-PCR, many scientists have done many effort.It largely it is demonstrated experimentally that should For method it is crucial that design and 3' terminal mutations site base complementrity or two special primers of mispairing, design of primers is bad, The intersection for leading to high background is expanded, higher false positive can be caused.Although many people make great efforts to overcome this drawback, such as report TaqMAMA methods, introduce mutating alkali yl in 3 ' penultimates or third position, the specificity of reaction can be increased really, But still false positive can not be completely eliminated, and in the judgement of homozygote and heterozygote, lack standard, it may appear that chaotic feelings Condition is shown in [2008 Nov of J Virol Methods.;153(2):156-62;Genomics. 2004 Feb;83(2):311- 20].Simple AS-PCR, generally use PCR carry out electrophoresis again after reaction, from there is reactionless band to carry out judging result, this Although kind method does not need to expensive instrument, but electrophoretic procedures, increase the opportunities for contamination of PCR, and time and effort consuming.In spite of People improves this method, and using fluorescent quantitative PCR technique, but what is obtained is not " all or none " formula as a result, always having non- The generation of specific reaction, i.e., same primer pair wild type and saltant type site can all expand, only its obtained Ct （Cycle threshold）It is different, therefore just introduce the concept of Δ Ct, i.e. Δ Ct=wild Ct- mutation Ct, but calculate Complexity, such as wants Δ Ct values to be judged to saltant type homozygote more than homozygote Ct values, and Δ Ct values are less than heterozygote Ct values, are judged to heterozygosis Son, the introducing of Δ Ct values not only increase operating procedure, can also cause confusion, because the established standards of Δ Ct values can not accurately be determined Position, the operating of different personnel, different samples and different detecting instruments can all have different numbers, be brought very to clinical practice Big difficulty, practical application are still limited, and are seen [Chinese patent CN101235415, CN101565742A].

8）LIFE companies of the U.S. are using a kind of method of MGB closing probes, referred to as Cast-PCR（ Competitive allele specific Taqman PCR）, the site do not detected is closed with MGB probes, is then drawn with allele specific The method testing goal site of object quantitative fluorescent PCR, although this improves the specificity of detection, due to adding into a MGB Probe is closed, cost certainly will be increased, how much interference can be brought to reaction efficiency, see [2012 Jun of Exp Mol Pathol.;92 (3):275-80； United States Patent 20100221717；CN102428190A].Someone uses lock nucleic acid (LNA) (Plant Method 2007,3：2) or the base of modification (Anal Biochem.2005,340：PCR 287-294) Primer can cause AS-PCR detection sensitivities to improve.However, these approaches increases the overall cost of analysis, and need to be to anti- It should carry out depth optimization.

Therefore, simple accurately detection how is carried out to JAK2 gene V617F polymorphic sites, it is urgently to be resolved hurrily to become people The problem of.

Invention content

In consideration of it, the present invention provides it is a kind of detect the primers of JAK2 gene V617F polymorphic sites, kit and its PCR method, at least to solve result interpretation complexity existing for previous kit, detecting instrument price height, operation difficulty is big, exists Certain false negative and false positive, testing cost is high, and clinical popularity is low, it is impossible to while extensive detection clinical samples etc. one Or multiple problems.

Scheme provided by the invention is specially：A kind of primer for detecting JAK2 gene V617F polymorphic sites, feature exist In the primer includes：Wild type specific forward primer, saltant type specific forward primer and wild type specific upstream draw The downstream primer that object is shared with saltant type specific forward primer；

And the wild type specific forward primer has SEQ No.17 sequences, the saltant type specific forward primer With SEQ No.14 sequences, the shared downstream primer has SEQ No.16 sequences.

One aspect of the present invention additionally provides a kind of reagent for detecting JAK2 gene V617F polymorphic sites, it is characterised in that： The reagent contains above-mentioned primer.

Another aspect of the present invention additionally provides a kind of kit for detecting JAK2 gene V617F polymorphic sites, feature It is：The kit also contains above-mentioned primer.

It is preferred that the probe being used cooperatively with the primer is further included in the kit, wherein, the probe is Taqman Probe has SEQ No.15 sequences.

Further preferably, the kit further includes PCR reaction tubes, dNTPs and Taq enzyme mixed liquor, PCR buffer solutions, inspection Survey the spy of the sense primer of house-keeping gene GAPDH, the downstream primer of detection house-keeping gene GAPDH, detection house-keeping gene GAPDH Needle, positive quality control product and blank control；

The sense primer of the detection house-keeping gene GAPDH has SEQ No.19 sequences；The detection house-keeping gene The downstream primer of GAPDH has SEQ No.20 sequences；The probe of the detection house-keeping gene GAPDH has SEQ No.21 sequences Row.

Further preferably, the saltant type specific forward primer, the shared downstream primer, the probe, described Detect the sense primer of house-keeping gene GAPDH, the downstream primer of the detection house-keeping gene GAPDH and the detection house-keeping gene The probe of GAPDH is coated in advance in T-shaped PCR reaction tubes；And with the wild type specific forward primer, it is described share Downstream primer, the probe, the sense primer of the detection house-keeping gene GAPDH, under the detection house-keeping gene GAPDH The probe of trip primer and the detection house-keeping gene GAPDH are coated in advance in G type PCR reaction tubes.

Further preferably, saltant type specific forward primer in the T-shaped PCR reaction tubes, the shared downstream primer, The probe, the sense primer of the detection house-keeping gene GAPDH, the downstream primer of the detection house-keeping gene GAPDH and institute The concentration and probe concentration for stating detection house-keeping gene GAPDH is respectively 50nM-2um, 50nM-2uM, 50nM-400nM, 1pm-20pm, 1pm- 20pm、0.05pm-5pm；And wild type specificity sense primer, the shared downstream are drawn in the G types PCR reaction tubes Object, the probe, the sense primer of the detection house-keeping gene GAPDH, the detection house-keeping gene GAPDH downstream primer and The concentration and probe concentration of the detection house-keeping gene GAPDH be respectively 50nM-2um, 50nM-2uM, 50nM-400nM, 1pm-20pm, 1pm-20pm、0.05pm-5pm。

Still more preferably, saltant type specific forward primer, the shared downstream are drawn in the T-shaped PCR reaction tubes Object, the probe, the sense primer of the detection house-keeping gene GAPDH, the detection house-keeping gene GAPDH downstream primer and The concentration and probe concentration of the detection house-keeping gene GAPDH is respectively 500nM, 500nM, 100nM, 5pm, 5pm, 2.5pm；It is and described Wild type specificity sense primer, the shared downstream primer, the probe, detection house keeper's base in G type PCR reaction tubes Because of the spy of the sense primer of GAPDH, the downstream primer of the detection house-keeping gene GAPDH and the detection house-keeping gene GAPDH Needle concentration is respectively 500nM, 500nM, 100nM, 5pm, 5pm, 2.5pm.

The present invention also provides above-mentioned primer or the PCR methods of kit, it is characterised in that：PCR reactions are expanded by two steps Cyclic program carries out, and the recurring number of first step amplification is less than the recurring number of second step amplification, the annealing of the first step amplification Temperature is higher than the annealing temperature of second step amplification.

It is preferred that the condition of the PCR reactions is：37 DEG C of 2min, 95 DEG C of 2min pre-degenerations；The first step expands, 95 DEG C of changes Property 5s, 55 DEG C ~ 68 DEG C annealing 32s, recycle 10 ~ 15 times；Second step, 95 DEG C of denaturation 5s, 50 DEG C ~ 65 DEG C annealing, extension 32s is recycled 30 ~ 50 times, collects fluorescence signal；Further preferably, the condition of the PCR reactions is：37 DEG C of 2min, 95 DEG C 2min pre-degenerations；The first step expands, and 95 DEG C are denaturalized 5s, and 63 DEG C of annealing 32s are recycled 15 times；Second step, 95 DEG C of denaturation 5s, 60 DEG C of annealing, extension 32s, recycle 40 times, collect fluorescence signal.

The primer and its kit of detection JAK2 gene V617F polymorphic sites provided by the invention, can greatly increase Allele-specific primers PCR sector divides the ability in not iso-allele site, expands the non-specific intersection between different loci The possibility of increasing is preferably minimized, and can accomplish the amplification of real " all or none " formula, not only have good specificity, it may have very Good sensitivity, can detect the genotype distribution situation in 1ng genomic DNAs.

The primer and its kit of detection JAK2 gene V617F polymorphic sites provided by the invention, have the following advantages：

1）Result " all or none " is judged by being truly realized testing result the artificial change on primer sequence, significantly The difficulty of result interpretation is simplified, reduces the possibility of error, unrivaled facility is provided for scientific research and clinical practice.

2）The mixing of Taq enzyme and dNTPs has ensured the stability of dNTPs, makes it that can be subjected to examining for multiple multigelation It tests.

3）The buffer solution that can be used directly pre-assigned in advance, user are more convenient.

4）Primer and probe is coated in advance in PCR reaction tubes, avoids the possibility that site mismatch occurs in operator, and Also save a large amount of operating times.

5）Primer and kit have specific good in the present invention, and the high sensitivity of detection, detection speed is fast, whole process It can be completed in 20 minutes 1 hour.

6）Only probe is not closed such as without other, is reduced cost with a routine Taqman probe in kit.

7）The kit has many advantages, such as that detection is simple, quick, accurate, inexpensive.

Description of the drawings

Fig. 1 is PCR amplification curve graph when designing wild type and mutant primers；

Fig. 2 is the PCR amplification curve graph for detecting wildtype gene sequence；

Fig. 3 is the PCR amplification curve graph for detecting mutated genes sequence；

Fig. 4 is the PCR amplification curve graph in TG sites；

Fig. 5 is the PCR amplification curve graph of house-keeping gene GAPDH.

Specific embodiment

The present invention is further expalined with specific case below, but the protection model being not intended to restrict the invention It encloses.

Unless otherwise specified, the conventional means that technological means used in embodiment is well known to those skilled in the art, Product used is purchased in market.

Defined below is the explanation of relational language in the present invention：

" allele " generally refers to DNA section, in the same, physical on homologue, controls relativity One pair of genes.In some cases, allele can correspond to the replacement of the mononucleotide on specific physics locus.At it In its situation, allele can correspond to (single or multiple) insertions of nucleotide or missing.

" allele-specific primers " refer to the sequence of target alleles complementation, completion can be extended in PCR Special PCR reactions.Allele-specific primers can be designed to detect in target sequence as little as 1 nucleotide difference ten The different primer of dtex, the primer can include allele-specific nucleotide part, 3 ' end target specificity parts and tail.

" MGB groups " refers to minor groove binding.When conjugated with the 3 ' of oligonucleotides ends, MGB groups can be used as not Extendible enclosure portion plays a role.MGB is the molecule that can be incorporated into the ditch of double-stranded DNA, generally use DPI3（It is closed Into method referring to U.S. Patent number 6,084,102；With 6,727,356).

" detection probe " refers to：Indicate any one in the multi-signal transduction molecule of amplification.For example, SYBR Green All it is detection probe with other DNA binding dyes.Some detection probes can be sequence-specific, such as Taqman probes (U.S. Patent number 5,538,848), a variety of stem ring molecular beacons (U.S. Patent number 6,103,476 and 5,925,517 and Tyagi and Kramer, Nature Biotechnology, 1996,14：303-308), acaulescence or Linear Beacon (WO99/ 21881), PNA Molecular Beacons TM (U.S. Patent number 6,355,421 and 6,593,091), linear PNA beacons (Kubista et al., 2001, SPIE4264：53-58), non-FRET probes (U.S. Patent number 6,150,097), Sunrise/ Amplifluor probes (U.S. Patent number 6,548,250), stem ring and double-strand Scorpion TM probes (Solinas et al., 2001, NucleicAcidsResearch29：E96 and U.S. Patent number 6,589,743), the ring probe (U.S. Patent number heaved 6,590,091), false knot probe (U.S. Patent number 6,589,250), cyclicon (U.S. Patent number 6,383,752), MGB Eclipse TM probes (Epoch Biosciences), hairpin probe (U.S. Patent number 6,596,490), peptide nucleic acid (PNA) are visited Needle.Detection probe can include fluorescent reporter molecule, for example, 6- Fluoresceincarboxylic acids (6-FAM) or tetrachlorofluorescein (TET) and Quencher molecule part, such as tetramethylrhodamin (TAMRA), Black Hole Quenche RS (Biosearch), Iowa Black (IDT), QSY quenchers (Molecular Probes) and Dabsyl and Dabcel sulfonate/carboxylate quencher (Epoch)。

" shared specific primer " refers to the primer matched in PCR reacts with allele-specific primers, it can be same The allele-specific primers pairing of different loci uses.

" polymerase of thermal stability " refers to thermal stability or heat resistance enzyme, refers mainly to archaeal dna polymerase, which exists During PCR amplification, it will not inactivate at an elevated temperature.

" Tm " or " melting temperature " of oligonucleotides refers to temperature when 50% molecule and complementary sequence hybridization in section of DNA Degree.Tm values can be calculated using well known formula (see Maniatis, T. et al.：Molecular cloning, Cold Spring Harbor, N.Y.：1982).

" sensitivity " is to refer to be detected the minimum (copy number) of template.

" specificity " refers to distinguish the ability of matching template and mispairing template.Specificity is often expressed as Δ Ct=Ct mistakes It is matched with-Ct.

" selectivity " refer to AS-PCR measure can be used for measuring minority (typically be mutated) allele in mixture and Degree without the interference from most (often wild type) allele.Selectivity is often expressed as ratio or percentage.Example Such as, the measure that 1 mutagenesis template can be detected in the case of there are 100 wild-type templates is referred to as having 1: 100 or 1% Selectivity.

" Ct " value refers to cycle threshold, represents recurring number when PCR amplification curve becomes exponential increase inflection point from baseline.

When " Delta Ct " or " Δ Ct " refers to that signal passes through fixed threshold, the cycle between two different samples or reaction Number difference.Δ Ct is the recurring number difference between two different samples or reaction when reaching exponential amplification.Δ Ct can be used for identifying Match the specificity between primer and mismatched primers.

The present invention relates to the primers and kit in the V617F mutational sites of quick detection JAK2 genes.In particular, this hair Bright is based on Past-PCR（Perfect allele-specific Taqman PCR）On the basis of method, it is successfully applied to The polymorphic site detection of JAK2 genes V617F.So-called Past-PCR is the high specific by detection gene pleiomorphism or mutation The Fluorescence PCR assay of AS-PCR methods and Taqman probes is combined into, only with a Taqman probe, in most of the cases Under, this probe is conventional Taqman probes, because of the special sequence rich in AT bases only in portion gene, is used The probes such as Taqman-MGB or LNA, in addition to this without any additional closing probe or reporter probe, Past-PCR methods are incited somebody to action AS-PCR and Taqman fluorescent PCR two methods perfect adaptations, and the advantages of both making obtained the performance of extreme, specific manifestation In AS-PCR methods in the case where not increasing any cost, successfully eliminated by design of primers and unique verification method Non-specific amplification so that result judgement shows " complete and nothing " mode, that is, having just has, and does not just have so that result is sentenced Disconnected simple and accurate, this is the improvement to past AS-PCR methods maximum and has to AS-PCR methods for what This is what people generally disapprove of Effect makes up, ultimate attainment so as to which the advantages of AS-PCR methods performed to, and is the attainable tidemark of this method institute.Many institute's weeks Know, Taqman fluorescent PCRs have seal detection without reacting the processing after finishing, and not only save the time, and reduce The risk of PCR product pollution, second of identification target sequence of probe have ensured the specificity and reliability of detection, it may also be used for right The quantitative detection of gene, the advantages that having reached criterion for clinical use.Past-PCR methods are glimmering with AS-PCR methods and Taqman The two-fold advantage of light PCR method, and when being that both methods is combined together, the attainable most simplified structure of detection component institute Into therefore, we are called it as perfect allele-specific Taqman PCR.

Based on Past-PCR methods, the kit for detecting JAK2 gene V617F polymorphic sites has been invented, it is basic It forms and is：(a) allele-specific primers of high special；(b) fluorescent detection probe；(c) draw with allele-specific Another specific primer of object pairing.

Wherein, the primer of detection JAK2 gene V617F polymorphic sites provided by the invention, including：Wild type specificity Sense primer, saltant type specific forward primer and wild type specific forward primer and saltant type specific forward primer share Downstream primer；

Detection reagent and kit containing above-mentioned primer are additionally provided simultaneously, to solve previous detection JAK2 genes V617F polymorphic sites are big there are operation difficulty, and there are certain false negative and false positives, and testing cost is high, clinical popularity It is low, it is impossible to while the problems such as extensive detection clinical samples, realize and detect simple, quick, accurate, cheap desirable, Strong tool is provided for scientific research and clinical gene type and gene mutation analysis.

It is preferred that the probe being used cooperatively with the primer is further included in the kit, wherein, the probe is Taqman Probe has SEQ No.15 sequences, a probe is used only in entire kit, does not close probe etc. without other, reduces The cost of kit.

The sense primer of the detection house-keeping gene GAPDH has SEQ No.19 sequences；The detection house-keeping gene The downstream primer of GAPDH has SEQ No.20 sequences；The probe of the detection house-keeping gene GAPDH has SEQ No.21 sequences Row；Wherein, dNTPs and Taq enzyme are mixed, can ensures the stability of dNTPs, make it that can be subjected to examining for multiple multigelation It tests；Sense primer, downstream primer and the probe of detection house-keeping gene GAPDH is for use as internal reference, and to prevent detection when goes out Existing false negative；Positive quality control product is TG type human gene group DNAs；Blank control is sterilizing ultra-pure water.

Further preferably, the saltant type specific forward primer, the shared downstream primer, the probe, described Detect the sense primer of house-keeping gene GAPDH, the downstream primer of the detection house-keeping gene GAPDH and the detection house-keeping gene The probe of GAPDH is coated in advance in T-shaped PCR reaction tubes；And with the wild type specific forward primer, it is described share Downstream primer, the probe, the sense primer of the detection house-keeping gene GAPDH, under the detection house-keeping gene GAPDH The probe of trip primer and the detection house-keeping gene GAPDH are coated in advance in G type PCR reaction tubes, are used by best reaction Amount is coated in PCR reaction tubes in advance, and six oligonucleotides are actually coated in each reaction tube, i.e., one is directed to allele A kind of specific forward primer, a probe（Usually Taqman probes）, a shared specific downstream primer, an inspection Survey house-keeping gene GAPDH sense primers, a detection house-keeping gene GAPDH downstream primer and a detection house-keeping gene GAPDH Probe.In this way in order to detect a different gene pleiomorphism in site, often need the PCR being coated with respectively more than two pipes or two pipes anti- Ying Guan, their middle probes, the sense primer, downstream primer and the probe that share specific downstream primer, detect house-keeping gene GAPDH It is the same, different is only the identification other specific forward primer of allele different shaped, and coating avoids behaviour in advance in this way There is the possibility of site mismatch in author, and has saved a large amount of operating times.

Further preferably, saltant type specific forward primer in the T-shaped PCR reaction tubes, the shared downstream primer, The probe, the sense primer of the detection house-keeping gene GAPDH, the downstream primer of the detection house-keeping gene GAPDH and institute The concentration and probe concentration for stating detection house-keeping gene GAPDH is respectively 50nM-2um, 50nM-2uM, 50nM-400nM, 1pm-20pm, 1pm- 20pm、0.05pm-5pm；And wild type specificity sense primer, the shared downstream are drawn in the G types PCR reaction tubes Object, the probe, the sense primer of the detection house-keeping gene GAPDH, the detection house-keeping gene GAPDH downstream primer and The concentration and probe concentration of the detection house-keeping gene GAPDH be respectively 50nM-2um, 50nM-2uM, 50nM-400nM, 1pm-20pm, 1pm-20pm、0.05pm-5pm.It is optimal to be, it is saltant type specific forward primer in the T-shaped PCR reaction tubes, described shared Downstream primer, the probe, the sense primer of the detection house-keeping gene GAPDH, the downstream for detecting house-keeping gene GAPDH The concentration and probe concentration of primer and the detection house-keeping gene GAPDH are respectively 500nM, 500nM, 100nM, 5pm, 5pm, 2.5pm；With And wild type specificity sense primer, the shared downstream primer, the probe, the detection in the G types PCR reaction tubes The sense primer of house-keeping gene GAPDH, the downstream primer of the detection house-keeping gene GAPDH and the detection house-keeping gene The concentration and probe concentration of GAPDH is respectively 500nM, 500nM, 100nM, 5pm, 5pm, 2.5pm.

Due to introducing the base of mispairing in allele-specific primers, decline its efficiency in reaction, no Same primer declines degree difference, usually to increase effects when 10 to 20 cycles can be only achieved no mispairing, ensure to detect Sensitivity, preferably PCR reaction by two step amplification cycles programs carry out, and the first step amplification recurring number be less than second step amplification Recurring number, the annealing temperature of first step amplification is higher than the annealing temperature of second step amplification, and first step amplification use is higher Annealing temperature, second step expand use compared with low temperature thermal oxidation, it is therefore an objective to specificity when increasing the first step amplification during primer annealing, So as to ensure the purpose of Past-PCR detection high degree of specificity；Specifically the condition of preferably described PCR reactions is：37℃ 2min, 95 DEG C of 2min pre-degenerations；The first step expands, and 95 DEG C are denaturalized 5s, and 55 DEG C ~ 68 DEG C annealing 32s are recycled 10 ~ 15 times；The Two steps, 95 DEG C of denaturation 5s, 50 DEG C ~ 65 DEG C annealing, extension 32s recycle 30 ~ 50 times, collect fluorescence signal；It is more highly preferred to PCR The condition of reaction is：37 DEG C of 2min, 95 DEG C of 2min pre-degenerations；The first step expands, 95 DEG C of denaturation 5s, 63 DEG C of annealing 32s, Cycle 15 times；Second step, 95 DEG C of denaturation 5s, 60 DEG C of annealing, extension 32s recycle 40 times, collect fluorescence signal.

Specifically detection process is：

1）Detected sample is respectively put into and is coated with wild type special primer respectively in advance, shared downstream primer, visits Needle, the sense primer of detection house-keeping gene GAPDH, the downstream primer of detection house-keeping gene GAPDH and detection house-keeping gene GAPDH Probe and saltant type special primer, shared downstream primer, probe, the sense primer of detection house-keeping gene GAPDH, detection In two groups of PCR reaction tubes of the downstream primer of house-keeping gene GAPDH and the probe of detection house-keeping gene GAPDH, and add in PCR and delay Fliud flushing, dNTPs and Taq enzyme mixed liquor, sterilizing ultra-pure water and genomic DNA, cover tightly pipe lid, are carried out on fluorescence quantitative PCR instrument Reaction, and collect fluorescence signal；

2）If detection sample only has the amplification curve that saltant type reaction tube has logarithm to increase in FAM channels, while VIC leads to There is the amplification curve that logarithm increases in road, and can determine that sample to be T-shaped, i.e. saltant type homozygote；

If detection sample only has the amplification curve that wild type reaction tube has logarithm to increase in FAM channels, while VIC channels The amplification curve for having logarithm to increase can determine that sample as G types, i.e. wild-type homozygote；

If detection sample saltant type and wild type reaction tube have the amplification curve of logarithm growth in FAM channels, simultaneously VIC channels have the amplification curve that logarithm increases, and can determine that sample as TG types, i.e. heterozygote；

It, may if detecting the amplification curve that sample saltant type and wild type reaction tube increase in FAM channels without logarithm Sample or operation should extract sample DNA again and be tested there are problem or sample DNA concentration are too low.

Each component introduction in detection process is explained in detail below：

（One）Allele-specific primers：

The allele-specific nucleotide partial complementarity of allele-specific primers is in an allele of gene Site, but it is not complementary to another allele site of the gene.Typically, the equipotential base of allele-specific primers Because specific nucleotide acid moieties are located at the last bit base at 3 ' ends of allele-specific primers.In some cases, equipotential base Because specific nucleotide acid moieties may be alternatively located at other base positions of 3 ' end of allele-specific primers.

In some cases, allele-specific primers are in addition to 3 ' termini-complementaries are varied from allele site, We are often required to introduce the base of mispairing in the other positions of primer, such as penultimate or third position are held to introduce alkali in primer 3 ' Base mispairing or second and third position continuous mispairing；For different polymorphisms or mutational site, held in primer 3 ' second from the bottom Position or third position are introduced on the basis of base mispairing, and it is special to meet reaction can also to increase base mispairing in other sites of primer Property requirement, further away from 3 ' end, the base number for increasing mispairing is more, 5 ' end up at most.Allele-specific primers Its T of length Main Basiss_mValue determines, typically its T_mValue is about 5-20 DEG C lower than the annealing temperature of PCR cycle.

The allele-specific sense primer of the corresponding gene pleiomorphism of two detections, except its base of site of 3 ' end detections Different outer, remaining sequence is as identical as possible, the T of two primers_mValue is also as consistent as possible.

Low T_mAllele-specific primers (ASP) have higher specificity.Under normal circumstances, allele-specific Primer is short oligonucleotide, and length is about 15-30, T_mIt it is about 40 DEG C to 60 DEG C, than the PCR used in amplification procedure Annealing/elongating temperature of cycling condition is about 5 DEG C to 20 DEG C low.

Since the design and screening of allele-specific primers are particularly significant, good primer needs draw from numerous to be selected It is selected in object, therefore we establish a method screened, the specific screening process of allele-specific primers is as follows：

(1) peripheral primer and PCR amplification are designed：First in the upstream and downstream of gene mutation point to be checked or polymorphic site, design Then a pair of of PCR amplification primer uses this that primer is carried out conventional PCR to target gene and reacted, wherein expanding fragment length can Tens to many kilobases pair, preferred length is 200 to 500 base-pairs；

(2) clone PCR products：The PCR product that will be amplified, the method cloned using AT, recombination to common carrier T matter In grain, recombinant plasmid is obtained, wherein obtained recombinant plasmid can carry out sequence verification, so that it is guaranteed that the correctness of PCR product；

(3) recombinant mutant is built：The information provided according to bioinformatics, using molecule clone technology, by mutant Sequence, build into recombinant plasmid obtained above, the recombinant mutant of structure be subjected to sequence verification sequence, so that it is guaranteed that Its correctness；

(4) design and screen specific primer on the mutated site：Two allele-specific primers are designed, primer 3 ' ends are with mutant nucleotide sequence complementation, and 3 ' ends of another primer are the same as normal sequence complementation；Then drawn respectively with allele-specific Object and the common downstream primer pairing of corresponding Standard PCR, using the above-mentioned recombinant mutant built as reaction template, utilization is glimmering Fluorescent Quantitative PCR instrument to reaction system, is screened；Wherein, fluorescent dye can be used in reaction, such as SYBR GREEN, can also be used The Taqman fluorescence probe of specificity is screened according to standard of the added sample size for 0.1 microgram complete genome DNA, is had The screening content of body is as follows：

（a）Set PCR reaction conditions：First setting PCR reaction annealing temperature it is completely the same, actual temp for 55 DEG C~ 68 DEG C, PCR cycle number is 40 times, and the enzyme and buffer system that PCR reacts immobilize after optimizing, the setting of this reaction condition Be for convenience simultaneously detect several genes be mutated；

（b）Specificity screening：The primer of saltant type is used using the recombinant plasmid of wild type as template, the primer filtered out its Ct is more than 40；

Wherein cycle threshold determine the reason is as follows that, in wild-type template non-specific amplification occurs for mutant primers than wild In wild-type template 19 cycles more than specific amplification occur for raw type primer, and when being detected according to clinical practice, added sample size is The standard of 0.1 microgram complete genome DNA, we pass through following equation, copy number=(amount of DNA ng × 6.022 × 10²³)/(length bp×10⁹× 660), the wherein length of complete genome DNA is 3,000,000,000 pairs of bases, therefore the copy of 0.1 microgram complete genome DNA Number is：3.09×10⁴, it is reflected in the Ct of quantitative fluorescent PCR（Quantitative cycle threshold）About 21, in this way we obtain second Screening index, i.e., with the primer of saltant type, when the recombinant plasmid of wild type is template, the Ct of gained should be more than 40, can It is not in false positive to ensure detection, and the amplification efficiency difference of the two is recycled for 40-21=19, i.e., amplification efficiency differs 19 More than cycle, the objective indicator of allele-specific primers specificity quality will be judged as us.It is understood that work as primer When 3 ' ends are with template mispairing, extension efficiency will decline 10³-10^6.6Times, it is converted into reaction cycle number and then declines about 13 to 27 and follow Ring, here it is the theoretical foundation that we can filter out preferable primer, because without primer screening, 19-13=6 cycle certainly will False positive is generated, the specificity of the primer is just bad, and 19-27=- 8, it is impossible to generate false positive, the range for there are 8 recurring numbers Primer is screened for us.According to this requirement, we design a series of allele-specific primers, from length, Set about from being artificially introduced on base mispairing close to 3 ' ends, in addition the downstream primer of its pairing, using the wild type built and dashes forward Modification recombinant plasmid carries out the intersection screening of quantitative fluorescent PCR reaction respectively, i.e., when with the template of mutant primer and wild type into During row amplification, to be mostly used more than 19 recurring numbers with reacting for wild-type template with wild primers, vice versa, then this The primer of sample just has the specificity of height.

（c）Sensibility is screened：The specific primer filtered out is made into sensitivity tests with recombination mutation type plasmid, will be examined The specific primer that sensitivity is surveyed less than 10-1000 copy screens, as required mutant-specific primers.

By the screening of more than several respects, obtained allele-specific primers will be provided with high degree of specificity and height Sensitive preferable primer.

（Two）Detection probe：

In some cases, the T of detection probe_mValue is about 60 DEG C to 70 DEG C, and most preferably 65 DEG C, probe length is according to it T_mValue determines.Although there are many various forms of probes are available, Taqman probes (Applied Biosystems, Foster City) it is often preferred.In some special cases, such as AT too high levels in detection sequence, raising may be used T_mThe probe of the types such as the Taqman-MGB of value.

Shared specific primer, in some cases, the T of shared specific primer_mValue is about 50 DEG C to 70 DEG C, Most preferably 60 DEG C, length is by its T_mValue determines, generally between 15-25 bases.

（Three）Other compositions：

The archaeal dna polymerase that the present invention uses is that Taq enzyme and its mutant, derivative or segment or others are heat-resisting In some cases, Hotstart Taq enzymes can also be used in archaeal dna polymerase, to increase the special and high efficiency of reaction.

The primer and kit that are there is provided for JAK2 gene V617F polymorphic sites provided in the present invention, mainly The shortcomings that being for allele-specific primers PCR amplification method, using molecule clone technology, structure contains base to be checked respectively in advance Because of the recombinant plasmid of wild type and saltant type, using this recombinant plasmid as positive template, screening determine specifically respectively with 3' ends Mutational site or two special primers of wild site base complementrity, once the specific primer sequences filtered out, will be that we examine The key element of survey system.The said goods of the present invention, available for the fluorescence quantitative PCR instrument of any model, reagent cost is the same as such as Modern quantitative fluorescent PCR reagent on the market is suitable, therefore preferably overcomes other and expanded using allele-specific primers PCR The deficiency of increasing method.

The advantage of the invention is that：The kit has easy to operate, and at low cost, it is simple easy as a result to judge, spirit Sensitivity is high, and the detection gene mutation sensitivity of this kit can reach 1%（That is the mutator DNA template numbers of target gene account for The 1% of wild type DNA profiling number）；And the sensitivity that gene mutation is detected in direct Sequencing is 20%（That is the mutation base of target gene Because DNA template numbers account for the 20% of wild type DNA template numbers）；Taqman probe techniques ensured kit to be detected as stopped pipe anti- Should, the generation of false positive is effectively avoided, detection specificity is also fully guaranteed, and detection is quick and convenient, entirely Detection process only has 80 minutes, and direct Sequencing then needs the time of 2 days, and is open pipe operation, and what PCR product polluted can Energy property increases.

PCR in the present invention（Past-PCR）Implementation steps：

1. the structure of positive plasmid

One couple of PCR primers is designed in the upstream and downstream of JAK2 gene V617F polymorphic sites to be detected, amplified fragments Length can be template with gDNA in the range of 500bp, using conventional PCR method, amplify this segment, cloned by AT Mode, which is cloned into the plasmid of sequencing, usually use Invitrogen pCR2.1 Topo carrier T kits, It operates by specification to carry out, it is also possible to the carrier T kit of other producers or even the carrier T plasmid that oneself preparation can be used.It obtains Positive colony, through sequence verification, it was demonstrated that the correctness of sequence, then using the Quickchange of Stratagene companies try Agent box designs another genotyping primer of corresponding site, by the method for Quickchange, obtains the other sun of the saltant type Property clone, operation by specification carries out, and obtained positive plasmid must be all allowed for access in next step through sequence verification to be correct Use.Taqman quantifies plasmid, and as template to verify the sensitivity of given measuring method, linear dynamic range, special Property.

2. the design and screening of allele-specific primers (ASP)

In 3 ' termini-complementary of primer in corresponding gene mutation base position, and in 3 ' end penultimate of primer or Three introduce base mispairings or second and third position continuous mispairing；For different polymorphisms or mutational site, in primer 3 ' Penultimate or third position is held to introduce on the basis of base mispairing, can also increase base mispairing in other sites of primer to expire The requirement of sufficient atopic, further away from 3 ' ends, the base number for increasing mispairing is more, at 5 ' ends up to most allele 1 Specific primer.

The screening of ASP is using the wild type and saltant type recombinant plasmid built, carries out quantitative fluorescent PCR reaction respectively Intersection screening, i.e., when being expanded with the template of mutant primer and wild type, and with the same wild-type template of wild primers Reaction to be mostly used more than 19 recurring numbers, vice versa, then such primer just has the specificity of height.It will filter out Specific primer make sensitivity tests with corresponding recombinant plasmid, detection sensitivity is less than the 10-1000 primer copied Reach the sensitivity requirement of detection, the primer for meeting above-mentioned two condition is exactly the ASP primers that we select, and can be carried out next The detection of step.

3. amplifing reagent prepares and adds in tested sample

（1）Take out each constituent from kit, room temperature slowly melt PCR buffer solutions, dNTPs and Taq enzyme mixed liquor, Positive quality control product, blank control, it is reverse to shake up.Each reaction tube need to add in PCR buffer solutions, Taq enzyme（dNTPs）, sterilizing it is ultrapure Water and DNA sample.Pipe lid is covered tightly, PCR amplification area is transferred to after brief centrifugation.

（2）It is recommended that each PCR reaction be carried out at the same time sample, positive quality control product, blank control analysis, positive quality control product Loading methods with blank control are the same as sample Adding Way.

4. reaction condition

(range of reaction final volume can be in 10-50 μ l, most preferably in 20-25 μ l reaction volumes) is included in each reaction tube PCR buffer solutions（10mM Tris-HCl pH8.3,50mM KCl, 0.1%Triton X-100,2.0mM MgCl₂）, 10- 100ng DNA or 1, the Plasmid DNA of 000,000 copy, mono- common general specificity T aqman of 50nM-400nM are visited Needle, general reversed specific downstream primer common a 50nM-2uM, 50nM-2uM difference allele-specifics upstream is drawn Object, the sense primer of 1pm-20pm detection house-keeping genes GAPDH, the downstream primer of 1pm-20pm detection house-keeping genes GAPDH, The probe of 0.05pm-5pm detection house-keeping genes GAPDH, along with 1.5 units of Taq polymerase, 200 μM of dNTPs.

1）, cycling condition setting

To make fluorescence curve more beautiful, it is proposed that collect fluorescence signal since second step.

2）, instrument sense channel selection

Fluorescence signal acquisition temperature is set as 60 DEG C, and specific setting method please refers to corresponding instrument operation instructions.

3）, detection type setting：Blank control is set as " NTC ", and positive quality control product and sample to be checked are set as " Unknown ".

5. interpretation of result

If detection sample only has the amplification curve that saltant type reaction tube has logarithm to increase in FAM channels, while VIC channels The amplification curve for having logarithm to increase can determine that sample to be T-shaped, i.e. saltant type homozygote；It is anti-that if detection sample only has wild type Should pipe FAM channels have logarithm increase amplification curve, while VIC channels have logarithm increase amplification curve, can determine that sample For G types, i.e. wild-type homozygote；If detection sample saltant type and wild type reaction tube have what logarithm increased in FAM channels Amplification curve, while VIC channels have the amplification curve that logarithm increases, and can determine that sample as TG types, i.e. heterozygote；Due to this method The result is that " all or none ", as a result easily judges, which pipe has reaction, which pipe is exactly positive.

Specific embodiment

Below by taking the situation detected to JAK2 gene V617F polymorphic sites as an example, specifically the present invention is made further detailed Thin explanation.

Embodiment 1：The preparation of wild type and saltant type positive plasmid for JAK2 gene V617F polymorphic sites

JAK is a kind of non-receptor type tyrosine protein kinase, wherein JAK2 mutation and the close pass of myeloproliferative disease System, JAK2 genes V617F are mutated the abnormal activation that can lead to JAK-STAT signal paths, and bone marrow cell is caused to generate abnormal increase It grows, in 2008 World Health Organization of revision（WHO）In categorizing system, JAK2 mutation become Chronic Myeloid proliferative diseases （MPD）Main diagnosis index.

We recall the gene order before and after the V617F polymorphic sites of JAK2 genes from gene pool first, and will be more State property site is marked with double underline, in the upstream and downstream appropriate location of the V617F polymorphic sites of JAK2 genes（With boldface type and Underscore indicates）, a pair of of cloning primer, amplified fragments 228bp are designed, mutational site is included in it, and gene order is shown such as Under, SEQ No.1：

catgattcctgtaccactcttgctctctctcactttgatctccatattccaggcttacacaggggtttcctcagaac gttgatggcagttgcaggtccatataaagggaccaaagcacattgtatcctcatctatagtcatgctgaaagtagga gaaagtgcatctttattatggcagagagaattttctgaactatttatggacaacagtcaaacaacaattctttgtac ttttttttttccttagtctttctttgaagcagcaagtatgatgagcaagctttctcacaagcatttggttttaaatt atggagtatgtgtctgtggagacgagagtaagtaaaactacaggctttctaatgcctttctcagagcatctgttttt gtttatatagaaaattcagtttcaggatcacagctaggtgtcagtgtaaactataatttaacaggagttaagtattt ttgaaactgaaaacactgtaggactattcagttatatcttgtgaaaaaggaaagcaatgaagttaaaagtagaaggt tacaatgcccaaacaatagagtatt

Experimental procedure is as follows：

1）Extract genomic DNA

With the genome DNA extracting reagent kit of domestic Tiangeng company or Qiagen companies, genomic DNA is extracted, it is specific to grasp Make the progress of step by specification.Through ultraviolet specrophotometer measured concentration, its concentration is adjusted to for the DNA samples prepared 50ng/ μ l are stored in -20 DEG C or directly carry out following reaction.

2）AT clones obtain positive plasmid

Cloning primer is designed in catastrophe point upstream and downstream first, is shown in Table 1：

Table 1.JAK2 gene V617F polymorphic site Wild type clone primers

In the PCR amplification system of 2 × PCR Master Mix (Fermentas) of 12.5 μ l, add in 10 μM of upstreams and draw Object and 10 μM of downstream primers and genomic DNA 50ng add water to 25 μ l, PCR reaction conditions of total volume and are set as 95 DEG C of pre- changes Property 3min, 95 DEG C denaturation 10s, 60 DEG C annealing and extension 30s, in total 35 cycle, take 15 μ l reaction products after reaction, into The gel electrophoresis of row concentration 2.5% is observed after electrophoresis, and band is consistent with the size predicted, shows to expand successfully.Using U.S. The pCR2.0 TOPO carrier Ts of Life companies of state by its operating instruction, by way of TA clones, obtain JAK2 genes V617F Polymorphic site wild-type positive plasmid, specific gene order is as follows, and wherein polymorphic site is shown as G types, illustrates for open country Raw type, it is correct that sequencing proof obtains plasmid.

SEQNo.4：ggacaacagtcaaacaacaattctttgtacttttttttttccttagtctttctttgaagca gcaagtatgatgagcaagctttctcacaagcatttggttttaaattatggagtatgtgtctgtggagacgagagtaa gtaaaactacaggctttctaatgcctttctcagagcatctgtttttgtttatatagaaaattcagtttcaggatcac agctaggtgtcag

3）Rapid mutation method obtains mutant plasmid

Then, using the method for generating rapid mutation（Quickchange, QC）, mutant primer is designed, due to JAK2- V617F sites are the variation of g to t, and primer sequence is shown in Table 2.

Table 2. obtains JAK2 gene V617F polymorphic site mutant clones primers

According to（Stratagene companies）The reaction condition and step of Quickchange kits complete the structure of mutant It builds, obtained recombinant plasmid, specific gene order is as follows, and t is shown as through sequence verification wherein polymorphic site, for mutation Then saltant type is put -20 DEG C with wild plasmid and saved backup by type respectively.

SEQ No.7：ggacaacagtcaaacaacaattctttgtacttttttttttccttagtctttctttgaagc agcaagtatgatgagcaagctttctcacaagcatttggttttaaattatggagtatgtttctgtggagacgagagta agtaaaactacaggctttctaatgcctttctcagagcatctgtttttgtttatatagaaaattcagtttcaggatca cagctaggtgtcag

Embodiment 2：Allele-specific primers（ASP）Design and specificity screening

For JAK2-V617F, design wild type and a series of mutation Idiotype primers are as follows：

JAK2-V617F-WT-R：ttacttactctcgtctccacacac（SEQ No.8）

JAK2-V617F-mut-R：tttacttactctcgtctccacacaa（SEQ No.9）

JAK2-V617F-mut-R1: tacttactctcgtctccacacaa（SEQ No.10）

JAK2-V617F-mut-R2: acttactctcgtctccacacaa（SEQ No.11）

JAK2-V617F-mut-R3: ctttacttactctcgtctccacagga（SEQ No.12）

JAK2-V617F-mut-R4:cttacttactctcgtctccacagga（SEQ No.13）

JAK2-V617F-mut-R5:ctacttactctcgtctccacagga（SEQ No.14）

Synthesis Taqman specific probes are designed simultaneously：

SEQ No.15：FAM-tgaagcagcaagtatgatgagcaagc-BHQ1.

Relevant primer and probe are in raw work bioengineering（Shanghai）Co., Ltd is synthesized.

Then respectively with above-mentioned 7 primers and the common downstream primer JAK2-V617F-F of JAK2 genes:5’- ggacaacagtcaaacaacaattc-3’（SEQ No.16）Primer matches, in addition Taqman specific probes, add in aforementioned It is template to build obtained about 30,000 copies of wild type recombinant plasmid, and primer specificity sieve is carried out on fluorescence quantitative PCR instrument Choosing, reaction condition are set as 95 DEG C of 2min pre-degenerations of the first step, and 95 DEG C of 5s, 63 DEG C of 30s are recycled for 15 totally, do not collect fluorescence Signal, second step 95 DEG C of 5s, 60 DEG C of 30s are recycled for 40 totally, collect fluorescence signal, the result is shown in Figure 1.

Wherein, 1 ~ 7 curve represents JAK2-V617F-WT-R, JAK2-V617F-mut-R, JAK2-V617F- respectively in Fig. 1 mut-R1、JAK2-V617F-mut-R2、JAK2-V617F-mut-R3、JAK2-V617F-mut-R4、JAK2-V617F-mut- The PCR amplification curve of R5, we have observed that No. 1 wild primers generate amplified signal, the spy of 2-6 primers in 7 cycles from Fig. 1 The opposite sex is poor, generates non-specific amplification, same wild primers when recycling for 7.5-9 respectively（No. 1）Amplification efficiency difference is small In 19 cycles, No. 7 primer meets our requirement, when recycling for 40, does not still expand, and is expanded with wild primers Efficiency differs by more than 19 cycles.In order to have better comparativity with mutant primer, we are with reference to No. 7 Primer redesign open country The primer of raw type is：ctacttactctcgtctccacaggc（SEQ No.17）.

Embodiment 3：ASP sensitivity is screened

It is matched again with No. 7 mutant primers with the common downstream primer SEQ No.16 of JAK2 genes, matter is recombinated with saltant type Grain, according to 10⁶, 10⁵, 10⁴, 10³, 10², 10,0 make gradient dilution, in addition Taqman specific probes, in fluorescence quantitative PCR instrument Enterprising line sensitivity verification.This No. 7 mutation Idiotype primers can detect the mutant of 100 copies, therefore this primer is just It is the best primer for the V617F polymorphic sites that detection JAK2 genes are filtered out by our method, is shown in Table 3.

Embodiment 4：Prefabricated PCR of the present invention（Past-PCR）Reaction tube

According to the requirement of each two reaction tubes in mutational site, i.e. pipe detection wild type site, another pipe detection mutation The primed probe of suitable concentration is coated in the milky PCR reaction tubes of 0.2ML by site in advance.

There is false negative when detecting in order to prevent, be coated with detection house-keeping gene GAPDH in advance in each reaction tube Sense primer, downstream primer and probe, wherein, GAPDH gene orders are as follows：

cctccgggaaactgtggcgtgatggccgcggggctctccagaacatcatccctgcctctactggcgctgccaaggct gtgggcaaggtcatccctgagctgaacgggaagctcactggcatggccttccgtgtccccactgccaacgtgtcagt ggtggacctgacctgccgtctagaaaaacctgccaaatatgatgacatcaagaaggtggtgaagcaggcgtcggagg gccccctcaagggcatcctgggctacactgagcaccaggtggtctcctctgacttcaacagcgacacccactcctcc acctttgacgctggggctggcattgccctcaacg（SEQ No.18）

The upstream primer sequence of detection house-keeping gene GAPDH is：ggctgtgggcaaggtcatc（SEQ No.19）

The downstream primer sequence of detection house-keeping gene GAPDH is:ctccgacgcctgcttcaccac(SEQ No.20）

The probe sequence of detection house-keeping gene GAPDH is：ccttccgtgtccccactgccaacgt(SEQ No.21)

Wherein, the end of probe 5 ' the HEX fluorescent markers of detection house-keeping gene GAPDH, 3 ' ends are marked with BHQ, due to HEX and VIC belongs to same Air conduct measurement, and many instruments are often indicated using VIC, therefore are described in text with VIC.

Concrete details is shown in Table 3 in PCR reaction tubes.

The component and concentration of 3. prefabricated JAK2 genes V617F polymorphic site Past-PCR reaction tubes of table

Since we are in advance saltant type and wild type sense primer, probe and common downstream primer, detection house-keeping gene The upstream and downstream primer of GAPDH and the probe of detection house-keeping gene GAPDH are coated in the differential responses pipe for the number of finishing, and are effectively kept away Exempt from the operating error of user, while substantially increased operating efficiency, greatly facilitate actual use clinically.

Embodiment 5：The verification of sample

Acquire melanoma patient tissue specimen, and use the genome DNA extracting reagent kit of Qiagen companies, extraction base Because of a group DNA, concrete operation step by specification carries out.The DNA samples prepared, will through ultraviolet specrophotometer measured concentration It is spare that its concentration is adjusted to 100ng/ μ l.

We use this mutant-specific primers filtered out, while are compared with wild primers, anti-in same PCR It answers on plate, each two reaction tube detects a gene loci, one of them is mutational site, the other is wild type site.Often 10mM Tris-HCl pH8.3,50mM KCl, 0.1%Triton X-100,2.0mM are included in a 20 μ l reaction volumes of reaction tube MgCl₂, the DNA of 100ng melanoma patients, 100nM specificity T aqman probes, 500nM share specific downstream primer and The wild type-special primers of 500nM or mutation type-special primer, the sense primer of 5pm detection house-keeping genes GAPDH, 5pm inspections Survey the downstream primer of house-keeping gene GAPDH, the probe of 2.5pm detection house-keeping genes GAPDH, along with 1.5 unit Taq DNA gather Synthase, 200 μM of dNTPs, remaining is deionized water.

First step PCR reaction conditions are：37 DEG C of 2min, 95 DEG C of 2min pre-degenerations, then 95 DEG C of 5s, 63 DEG C of 30s, 15 Cycle, this step do not collect fluorescence；Second step PCR reaction conditions are：95 DEG C of 5s, 60 DEG C of 30s, totally 40 cycles, this step are collected glimmering Light.For convenience's sake, the V617F polymorphism normal locations of JAK2 genes are regarded as wild type by us（G sites）, and it is easy The site for causing the abnormal activation of JAK-STAT signal paths is then saltant type（T sites）If corresponding reaction tube has signal Increase, be judged as corresponding homozygous genotype, such as two pipes increase, then are heterozygous.

1st, it is detected following mutation type gene order according to the method described above：

SEQ No.22：tggagtatgtttctgtggaga

The FAM channel PCR amplification curve graphs being collected into, as shown in Fig. 2, wherein, it is anti-that a curves represent detection saltant type PCR Amplification curve that should be in pipe, b curves represent the amplification curve in detection wild type PCR reaction tubes.

2nd, it is detected following wildtype gene sequence according to the method described above：

SEQ No.23：tggagtatgtgtctgtggaga

The FAM channel PCR amplification curve graphs being collected into, as shown in figure 3, wherein, it is anti-that c curves represent detection wild type PCR Amplification curve that should be in pipe, d curves represent the amplification curve in detection saltant type PCR reaction tubes.

3rd, heterozygosis is carried out according to the method described above（TG types）Detection, specific gene order are：

SEQ No.24：tggagtatgttt/gtctgtggaga

The FAM channel PCR amplification curve graphs being collected into, as shown in figure 4, wherein, it is anti-that e curves represent detection wild type PCR Amplification curve that should be in pipe, f curves represent the amplification curve in detection saltant type PCR reaction tubes.

Meanwhile it is above-mentioned 3 detection case in, when VIC channel house-keeping genes GAPDH have logarithm increase amplification curve, such as Shown in Fig. 5, while FAM channels have the amplification curve that logarithm increases, then this time experimental result is effective.

Therefore, from above-mentioned detection experiment as it can be seen that the testing result of this kit is " all or none " as a result, even tested Sample is mutation allele homozygote, and in two PCR reaction tubes, only saltant type PCR reaction tubes are in FAM channels and VIC Channel has the amplification curve that logarithm increases, and wild type PCR reaction tubes have no the amplification curve of logarithm growth in FAM channels； If tested sample is wild allele genic homozygote, in two PCR reaction tubes, only wild type PCR reaction tubes are in FAM channels There is the amplification curve of logarithm growth with VIC channels, and saltant type PCR reaction tubes have no the amplification of logarithm growth in FAM channels Curve；If tested sample is heterozygote, have in two PCR reaction tubes has what logarithm increased in FAM channels and VIC channels Amplification curve.The testing result interpretation of the kit is simple, and reducing the testing result of previous kit needs to carry out Δ Ct etc. The process that a series of complex calculates reduces false determination ratio, while also effectively prevents existing in previous kit testing result false cloudy The generation of property false positive phenomenon.In addition kit provided by the invention can be used for the fluorescence quantitative PCR instrument of any model, detector Device is simple, at low cost, and strong tool is provided for scientific research and clinic JAK2 Genotypings and gene mutation analysis.

Sequence table

<110>Shenyang You Jinuo bio tech ltd

<120>Detect primer, kit and its PCR method of JAK2 gene V617F loci polymorphisms

<130> 2015

<160> 24

<170> PatentIn version 3.3

<210> 1

<211> 564

<212> DNA

<213>It is artificial synthesized

<400> 1

catgattcct gtaccactct tgctctctct cactttgatc tccatattcc aggcttacac 60

aggggtttcc tcagaacgtt gatggcagtt gcaggtccat ataaagggac caaagcacat 120

tgtatcctca tctatagtca tgctgaaagt aggagaaagt gcatctttat tatggcagag 180

agaattttct gaactattta tggacaacag tcaaacaaca attctttgta cttttttttt 240

tccttagtct ttctttgaag cagcaagtat gatgagcaag ctttctcaca agcatttggt 300

tttaaattat ggagtatgtg tctgtggaga cgagagtaag taaaactaca ggctttctaa 360

tgcctttctc agagcatctg tttttgttta tatagaaaat tcagtttcag gatcacagct 420

aggtgtcagt gtaaactata atttaacagg agttaagtat ttttgaaact gaaaacactg 480

taggactatt cagttatatc ttgtgaaaaa ggaaagcaat gaagttaaaa gtagaaggtt 540

acaatgccca aacaatagag tatt 564

<210> 2

<211> 23

<212> DNA

<213>It is artificial synthesized

<400> 2

ggacaacagt caaacaacaa ttc 23

<210> 3

<211> 22

<212> DNA

<213>It is artificial synthesized

<400> 3

ctgacaccta gctgtgatcc tg 22

<210> 4

<211> 228

<212> DNA

<213>It is artificial synthesized

<400> 4

ggacaacagt caaacaacaa ttctttgtac tttttttttt ccttagtctt tctttgaagc 60

agcaagtatg atgagcaagc tttctcacaa gcatttggtt ttaaattatg gagtatgtgt 120

ctgtggagac gagagtaagt aaaactacag gctttctaat gcctttctca gagcatctgt 180

ttttgtttat atagaaaatt cagtttcagg atcacagcta ggtgtcag 228

<210> 5

<211> 38

<212> DNA

<213>It is artificial synthesized

<400> 5

gttttaaatt atggagtatg tttctgtgga gacgagag 38

<210> 6

<211> 38

<212> DNA

<213>It is artificial synthesized

<400> 6

ctctcgtctc cacagaaaca tactccataa tttaaaac 38

<210> 7

<211> 228

<212> DNA

<213>It is artificial synthesized

<400> 7

ggacaacagt caaacaacaa ttctttgtac tttttttttt ccttagtctt tctttgaagc 60

agcaagtatg atgagcaagc tttctcacaa gcatttggtt ttaaattatg gagtatgttt 120

ctgtggagac gagagtaagt aaaactacag gctttctaat gcctttctca gagcatctgt 180

ttttgtttat atagaaaatt cagtttcagg atcacagcta ggtgtcag 228

<210> 8

<211> 24

<212> DNA

<213>It is artificial synthesized

<400> 8

ttacttactc tcgtctccac acac 24

<210> 9

<211> 25

<212> DNA

<213>It is artificial synthesized

<400> 9

tttacttact ctcgtctcca cacaa 25

<210> 10

<211> 23

<212> DNA

<213>It is artificial synthesized

<400> 10

tacttactct cgtctccaca caa 23

<210> 11

<211> 22

<212> DNA

<213>It is artificial synthesized

<400> 11

acttactctc gtctccacac aa 22

<210> 12

<211> 26

<212> DNA

<213>It is artificial synthesized

<400> 12

ctttacttac tctcgtctcc acagga 26

<210> 13

<211> 25

<212> DNA

<213>It is artificial synthesized

<400> 13

cttacttact ctcgtctcca cagga 25

<210> 14

<211> 24

<212> DNA

<213>It is artificial synthesized

<400> 14

ctacttactc tcgtctccac agga 24

<210> 15

<211> 26

<212> DNA

<213>It is artificial synthesized

<400> 15

tgaagcagca agtatgatga gcaagc 26

<210> 16

<211> 23

<212> DNA

<213>It is artificial synthesized

<400> 16

ggacaacagt caaacaacaa ttc 23

<210> 17

<211> 24

<212> DNA

<213>It is artificial synthesized

<400> 17

ctacttactc tcgtctccac aggc 24

<210> 18

<211> 342

<212> DNA

<213>It is artificial synthesized

<400> 18

cctccgggaa actgtggcgt gatggccgcg gggctctcca gaacatcatc cctgcctcta 60

ctggcgctgc caaggctgtg ggcaaggtca tccctgagct gaacgggaag ctcactggca 120

tggccttccg tgtccccact gccaacgtgt cagtggtgga cctgacctgc cgtctagaaa 180

aacctgccaa atatgatgac atcaagaagg tggtgaagca ggcgtcggag ggccccctca 240

agggcatcct gggctacact gagcaccagg tggtctcctc tgacttcaac agcgacaccc 300

actcctccac ctttgacgct ggggctggca ttgccctcaa cg 342

<210> 19

<211> 19

<212> DNA

<213>It is artificial synthesized

<400> 19

ggctgtgggc aaggtcatc 19

<210> 20

<211> 21

<212> DNA

<213>It is artificial synthesized

<400> 20

ctccgacgcc tgcttcacca c 21

<210> 21

<211> 25

<212> DNA

<213>It is artificial synthesized

<400> 21

ccttccgtgt ccccactgcc aacgt 25

<210> 22

<211> 21

<212> DNA

<213>It is artificial synthesized

<400> 22

tggagtatgt ttctgtggag a 21

<210> 23

<211> 21

<212> DNA

<213>It is artificial synthesized

<400> 23

tggagtatgt gtctgtggag a 21

<210> 24

<211> 23

<212> DNA

<213>It is artificial synthesized

<400> 24

tggagtatgt ttgtctgtgg aga 23

Claims

1. a kind of primer and probe for detecting JAK2 gene V617F loci polymorphisms, which is characterized in that the primer includes：It is wild Raw type specificity sense primer, saltant type specific forward primer and wild type specific forward primer are with being mutated on type specificity The downstream primer that trip primer shares；

And the wild type specific forward primer sequence is as shown in SEQ No.17, the saltant type specific forward primer sequence Row are as shown in SEQ No.14, and the shared downstream primer sequence is as shown in SEQ No.16；

The probe is Taqman probes, and sequence is as shown in SEQ No.15.

2. a kind of reagent for detecting JAK2 gene V617F loci polymorphisms, it is characterised in that：The reagent contains claim 1 The primer and probe.

3. a kind of kit for detecting JAK2 gene V617F loci polymorphisms, it is characterised in that：The kit is wanted containing having the right Seek the primer and probe described in 1.

4. according to the kit that JAK2 gene V617F loci polymorphisms are detected described in claim 3, it is characterised in that：The examination Agent box further include PCR reaction tubes, dNTPs and Taq enzyme mixed liquor, PCR buffer solutions, detection house-keeping gene GAPDH sense primer, Detect probe, positive quality control product and the blank control of the downstream primer, detection house-keeping gene GAPDH of house-keeping gene GAPDH；

The upstream primer sequence of the detection house-keeping gene GAPDH is as shown in SEQ No.19；The detection house-keeping gene GAPDH Downstream primer sequence as shown in SEQ No.20；The probe sequence of the detection house-keeping gene GAPDH is as shown in SEQ No.21.

5. according to the kit that JAK2 gene V617F loci polymorphisms are detected described in claim 4, it is characterised in that：It is described prominent Modification specific forward primer, the shared downstream primer, the probe, the upstream for detecting house-keeping gene GAPDH are drawn Object, the downstream primer of the detection house-keeping gene GAPDH, the probe for detecting house-keeping gene GAPDH are coated in T-shaped in advance In PCR reaction tubes；And with the wild type specific forward primer, the shared downstream primer, the probe, the inspection Survey the sense primer of house-keeping gene GAPDH, the downstream primer of the detection house-keeping gene GAPDH, the detection house-keeping gene The probe of GAPDH is coated in advance in G type PCR reaction tubes.

6. according to the kit that JAK2 gene V617F loci polymorphisms are detected described in claim 5, it is characterised in that：It is described T-shaped Saltant type specific forward primer, the shared downstream primer, the probe, the detection house-keeping gene in PCR reaction tubes The sense primer of GAPDH, the downstream primer of the detection house-keeping gene GAPDH, the probe of the detection house-keeping gene GAPDH are dense Degree is respectively 50nM-2 μm, 50nM-2 μm, 50nM-400nM, 1pm-20pm, 1pm-20pm, 0.05pm-5pm；And the G types Wild type specificity sense primer, the shared downstream primer, the probe, the detection house-keeping gene in PCR reaction tubes The sense primer of GAPDH, the downstream primer of the detection house-keeping gene GAPDH, the probe of the detection house-keeping gene GAPDH are dense Degree is respectively 50nM-2 μm, 50nM-2 μm, 50nM-400nM, 1pm-20pm, 1pm-20pm, 0.05pm-5pm.

7. according to the kit that JAK2 gene V617F loci polymorphisms are detected described in claim 6, it is characterised in that：It is described T-shaped Saltant type specific forward primer, the shared downstream primer, the probe, the detection house-keeping gene in PCR reaction tubes The sense primer of GAPDH, the downstream primer of the detection house-keeping gene GAPDH, the probe of the detection house-keeping gene GAPDH are dense Degree is respectively 500nM, 500nM, 100nM, 5pm, 5pm, 2.5pm；And in the G types PCR reaction tubes on wild type specificity Swim primer, the shared downstream primer, the probe, the sense primer of the detection house-keeping gene GAPDH, the detection pipe The downstream primer of family gene GAPDH, the concentration and probe concentration of the detection house-keeping gene GAPDH be respectively 500nM, 500nM, 100nM, 5pm、5pm、2.5pm。