CN104894256B - Detect primer, kit and its PCR method of aldehyde dehydrogenase 2 gene rs671 pleomorphism sites - Google Patents

Detect primer, kit and its PCR method of aldehyde dehydrogenase 2 gene rs671 pleomorphism sites Download PDF

Info

Publication number
CN104894256B
CN104894256B CN201510290613.8A CN201510290613A CN104894256B CN 104894256 B CN104894256 B CN 104894256B CN 201510290613 A CN201510290613 A CN 201510290613A CN 104894256 B CN104894256 B CN 104894256B
Authority
CN
China
Prior art keywords
primer
detection
probe
sense primer
gene gapdh
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Active
Application number
CN201510290613.8A
Other languages
Chinese (zh)
Other versions
CN104894256A (en
Inventor
高劲松
张英杰
李星颐
樊志美
于农
魏潇
魏奇
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
SHENYANG EUGENOM BIOLOGICAL TECHNOLOGY Co Ltd
Original Assignee
SHENYANG EUGENOM BIOLOGICAL TECHNOLOGY Co Ltd
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by SHENYANG EUGENOM BIOLOGICAL TECHNOLOGY Co Ltd filed Critical SHENYANG EUGENOM BIOLOGICAL TECHNOLOGY Co Ltd
Priority to CN201510290613.8A priority Critical patent/CN104894256B/en
Publication of CN104894256A publication Critical patent/CN104894256A/en
Application granted granted Critical
Publication of CN104894256B publication Critical patent/CN104894256B/en
Active legal-status Critical Current
Anticipated expiration legal-status Critical

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
    • C12Q1/6883—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00—Oligonucleotides characterized by their use
    • C12Q2600/106—Pharmacogenomics, i.e. genetic variability in individual responses to drugs and drug metabolism
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00—Oligonucleotides characterized by their use
    • C12Q2600/156—Polymorphic or mutational markers

Landscapes

  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Health & Medical Sciences (AREA)
  • Organic Chemistry (AREA)
  • Wood Science & Technology (AREA)
  • Analytical Chemistry (AREA)
  • Zoology (AREA)
  • Genetics & Genomics (AREA)
  • Engineering & Computer Science (AREA)
  • Pathology (AREA)
  • Immunology (AREA)
  • Microbiology (AREA)
  • Molecular Biology (AREA)
  • Biotechnology (AREA)
  • Biophysics (AREA)
  • Physics & Mathematics (AREA)
  • Biochemistry (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • General Engineering & Computer Science (AREA)
  • General Health & Medical Sciences (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)

Abstract

The invention discloses it is a kind of detect aldehyde dehydrogenase 2 gene rs671 pleomorphism sites primer, kit and its PCR method, including：The anti-sense primer that wild type specific forward primer, saltant type specific forward primer and wild type specific forward primer share with saltant type specific forward primer；And the wild type specific forward primer has SEQ No.17 sequences, the saltant type specific forward primer has SEQ No.14 sequences, and the shared anti-sense primer has SEQ No.16 sequences；Kit has the advantages that detection is simple, quick, accurate, cheap, and strong instrument is provided for scientific research and clinical aldehyde dehydrogenase 2 genotype and gene mutation analysis.

Description

Detect the primers of aldehyde dehydrogenase 2 gene rs671 pleomorphism sites, kit and its PCR method
Technical field
The present invention relates to molecular biology field of gene detection, and it is more to specifically provide a kind of detection aldehyde dehydrogenase 2 gene Primer, kit and its PCR method of state property, the quick detection for aldehyde dehydrogenase 2 gene rs671 polymorphic sites.
Background technology
It is by discharging nitric oxide that organic nitrates esters medicine, which is used to treat angina pectoris,（NO）Mediation, acetaldehyde dehydrogenase 2（ALDH2）With nitric acid esterase active, organic nitrates denitration can be formed nitric oxide, be organic nitrates medicine hair Wave the key of curative effect.If carry Glu504Lys in patient's ALDH2 genes（rs671）Mutation, the albumen of mutant gene coding Matter structure has difference, and ALDH2 nitric acid esterase active can reduce by more than 10 times, and saltant type ALDH2 * 2/2 are wild types The 6-7% of ALDH2*1/1 activity, saltant type ALDH2*1/2 is the 8-15% of wild type ALDH2*1/1 activity, therefore ALDH2 dashes forward Organic nitrates can not be converted into NO by modification enzyme Lys504 rapidly, cause myocardial ischemia situation to aggravate, it is difficult to play drug effect.Money Material display, asian population about 5%-30% individual all carry ALDH2*2/2 or ALDH2*1/2 mutation.Base is mutated for carrying Because of type（Risk genotype）Patient, then can not completely organic nitrates esters medicine as angina pectoris attacks when unique medicine Product, therefore, this kit are applicable crowd as the expected patient using organic nitrates esters medicine, and detection ALDH2 genotype can The risk of buccal organic nitrates esters medicine is predicted, reference is provided for doctor's reasonable employment organic nitrates esters medicine.
In addition, the rs671 G ＞ A types mutation of ALDH2 genes, directly results in ALDH2 acetaldehyde in alcohol metabolism approach and takes off Hydrogen makes acetaldehyde in alcohol user's body largely store up into the significantly decline of activity during acetic acid, person's headache that the toxicity of acetaldehyde can make drink, entirely Body is rubescent, aggravates burden of liver.Scientific research finds that this mutation can also increase human body and suffer from kinds of tumors especially cancer of the esophagus Risk, therefore, this kit could be applicable to understand the crowd of alcohol metabolism ability and alcohol to body harm degree.
It is common to have direct sequencing at present to gene mutation and the detection of gene pleiomorphism；Gene chip hybridization method；PCR- RFLP methods；Pcr amplification product capillary electrophoresis analysis method；PCR-SSCP；PCR high-resolution fusion curve analytical technologies；PCR- Taqman MGB（Minor Groove Binder）Sonde method；AS-PCR methods；Cast-PCR methods etc..These methods are more or less Instrument price height being also present, operation difficulty is big, certain false negative and false positive be present, and testing cost is high, and clinical popularity is low, The shortcomings of clinical samples can not be detected on a large scale simultaneously.
Such as：1）Direct sequencing is the goldstandard of mutation analysis, can find known and unknown mutation site, but the method detects The sensitivity of gene mutation is 20%（That is the mutator DNA profiling number of target gene accounts for the 20% of wild type DNA profiling number）.Together When complex operation also be present, cycle length, analyze speed is slow, often needs the time of 2 days, and the method is open pipe operation, is increased greatly Add the possibility of pollution, be not suitable for the detection to extensive sample, while also need to the instrument of costliness, exist and be not easy reality in basic unit The shortcomings of applying.
2）Regular-PCR-RFLP method and technologies are easy, cheap, the test in laboratory of suitable a small amount of sample, but RFLP is only The mutation for having restriction enzyme site can be detected, no restriction enzyme site can not be detected, wasted time and energy, and PCR primer pollution also be present causes false sun The risk of property, is shown in [the Jun 1 of Mol Diagn Ther. 2010;14(3):163-9, United States Patent 20120135406]。
3）Chip technology has the characteristics that high flux, miniaturization, automation compared with traditional instrument detection method, is applicable In full genome mutated scanning, it is not suitable for the mutational site detection of individual gene, and precision is low, it is expensive.
4）PCR high-resolution fusion curve analytical technologies, the catastrophe of energy high flux detection gene, reagent cost is relatively low, But because its fluorescence signal comes from dyestuff, specificity is affected, and detecting instrument is the fluorescent PCR instrument of upgrade version, and price is high High, popularization is limited, sees [the Nov 12 of Clin Chim ACqa. 2012;413(21-22):1781-5; United States Patent 20110045479]。
5）PCR-Taqman MGB sonde methods are adapted to known mutations site, it is often necessary to two probes, and Taqman MGB The synthesis price of probe is several times of general T aqman probes, sees [the Aug of J Clin Microbiol. 2010;48(8): 2909-15；United States Patent 20090311679], and can not detect the content in sample it is less (>=1, 1 in 000) allele or mutational site.
6）Although PCR-SSCP methods are simple, the method is open detecting system, easily causes the pollution of PCR primer, And operating procedure is more, waste time and energy.
7）Allele-specific primers PCR TRAPs (AS-PCR), this method are current detection gene mutation or SNP Most simple and quick method（Wu D Y, Ugozzoli L, Pal B K, Wallace R B., Proc Natl Acad Sci USA 1989; 86:2757-2760), its principle is the base mispairing of primer 3' terminal bases and template, its PCR effect Rate will decline 103-106.6(Chen, X., and Sullivan, P F, The Pharmacogeonomics again Journal 2003, 3, 77-96).Although the principle of this method is simple, the primer of mispairing, non-specificity can still occur Amplification, amplification situation regard type (Ayyadevara S, the Thaden J related to the base sequence around detection site of mutation J, Shmookler Reis R J., Anal Biochem 2000; 284:11-18), also with equipotential base present in sample The influence of dependent variable.In order to increase AS-PCR specificity, many scientists have done many effort.Largely it is demonstrated experimentally that should For method it is crucial that design and 3' terminal mutations site base complementrity or two special primers of mispairing, design of primers is bad, The intersection for causing high background is expanded, higher false positive can be caused.Although many people make great efforts to overcome this drawback, such as report TaqMAMA methods, in the upper specificity for introducing mutating alkali yl, reaction being increased really of 3 ' penultimates or the 3rd, But still false positive can not be completely eliminated, and in the judgement of homozygote and heterozygote, lack standard, it may appear that chaotic feelings Condition, see [the Nov of J Virol Methods. 2008;153(2):156-62;Genomics. 2004 Feb;83(2):311- 20].Simple AS-PCR, generally use PCR reaction carry out electrophoresis again after terminating, from there is reactionless band to carry out judged result, this Although the instrument that kind of method need not be expensive, electrophoretic procedures, PCR opportunities for contamination, and time and effort consuming are added.In spite of People is improved this method, using fluorescent quantitative PCR technique, but obtain be not " all or none " formula result, always have non- The generation of specific reaction, i.e., same primer pair wild type and saltant type site can all expand, simply its obtained Ct （Cycle threshold）It is different, therefore just introduce Δ Ct concept, i.e. Δ Ct=wild Ct- mutation Ct, but calculate Complexity, such as Δ Ct values are wanted to be judged to saltant type homozygote more than homozygote Ct values, Δ Ct values are less than heterozygote Ct values, are judged to heterozygosis Son, the introducing of Δ Ct values not only increase operating procedure, can also cause confusion, because the established standardses of Δ Ct values can not accurately be determined Position, the operating of different personnel, different samples and different detecting instruments can all have different numerals, be brought very to clinical practice Big difficulty, practical application are still limited, and are seen [Chinese patent CN101235415, CN101565742A].
8）LIFE companies of the U.S. are using a kind of method of MGB closing probes, referred to as Cast-PCR（ Competitive allele specific Taqman PCR）, the site do not detected is closed with MGB probes, then drawn with allele specific The method testing goal site of thing quantitative fluorescent PCR, although this improves the specificity of detection, due to adding a MGB more Probe is closed, cost certainly will be increased, how much interference can be brought to reaction efficiency, see [the Jun of Exp Mol Pathol. 2012;92 (3):275-80； United States Patent 20100221717；CN102428190A].Someone uses lock nucleic acid (LNA) (Plant Method 2007,3：2) or modification base (Anal Biochem.2005,340：PCR 287-294) Primer, AS-PCR detection sensitivities can be caused to improve.However, these approaches increases the overall cost of analysis, and need to be to anti- Depth optimization should be carried out.
At present, the domestic ALDH2 gene detecting kits for having listed registration certificate have following one kind：Hundred proud science and technology of Shanghai has " ALDH2 (Glu504Lys) gene detecting kit (DNA microarray chip method) " of limit company, state's food medicine prison tool (standard) word 2013 No. 3400244.
A kind of rs671 gene mutation fluorescence of ALDH2 genes of domestic Guangzhou Dajian Biotechnology Co., Ltd.'s application is determined Measure PCR parting detecting reagents and its detection method（The A of patent No. CN 102851368）, it is double using mutational site The fluorescence quantifying PCR method of Taqman-MGB probes；Detection kit disclosed in the A of Chinese patent CN 102533958, using normal PCR amplifications are advised with reference to the technology and high-resolution fusion curve analytical technology of Cold-PCR Enrichment Amplification products, complete paired samples The judgement of the rs671 Genotypings of ALDH2 genes；Xiamen Amoydx Bio-Pharmaceutical Technology Co., Ltd. then uses and utilizes bicyclic probe With the hybridization of specific primer, FAM the and HEX fluorescence intensities of reaction system are detected, are judged according to FAM and HEX fluorescence intensities As a result（The A of patent No. CN 102453765）；A kind of entitled ALDH2 genes of Guangzhou Yishan Biotechnology Co., Ltd.'s application The patent of rs671 gene mutation detection liquid-phase chips（The A of patent No. CN 102234685）, that is, employ liquid-phase chip technology pair The rs671 catastrophes of ALDH2 genes are detected.
Chip technology has the characteristics that high flux, miniaturization, automation compared with traditional instrument detection method, is applied to Full genome mutated scanning, it is not suitable for the mutational site detection of individual gene, and precision is low, it is expensive.And common fluorescence Quantitative PCR technique is designed the most key site-specific primer, also only carries out, does not have according to the rule of design of primers The screening objective indicator of one good special primer, the most key is that their result judges, still obscures, does not have " all or none " Concept, it is so non-specific the shortcomings that still can not overcome.The fluorescence quantifying PCR method of double probes, due to needing two spies Pin, and often Taqman-MGB probes, reagent cost is considerably increased, and the design and optimization of probe, condition are very high. Although high-resolution fusion curve analytical technology reagent cost is low, fluorescent dye is nonspecific display, reaction bar in advance Piece optimization, different instrument and operator costly experience often determination result success or failure.
Therefore, simple accurately detection how is carried out to ALDH2 gene rs671 pleomorphism sites, turns into people and urgently solves Certainly the problem of.
The content of the invention
In consideration of it, the invention provides a kind of primer, reagent for detecting aldehyde dehydrogenase 2 gene rs671 pleomorphism sites Box and its PCR method, at least to solve, result interpretation existing for conventional kit is complicated, detecting instrument price is high, operation difficulty Greatly, certain false negative and false positive be present, testing cost is high, and clinical popularity is low, it is impossible to while the clinical mark of extensive detection This grade one or more problem.
Scheme provided by the invention is specially：A kind of primer for detecting aldehyde dehydrogenase 2 gene rs671 pleomorphism sites, Characterized in that, the primer includes：Wild type specific forward primer, saltant type specific forward primer and wild type are special Property the anti-sense primer that shares of sense primer and saltant type specific forward primer；
And the wild type specific forward primer has SEQ No.17 sequences, the saltant type specific forward primer With SEQ No.14 sequences, the shared anti-sense primer has SEQ No.16 sequences.
One aspect of the present invention additionally provides a kind of reagent for detecting aldehyde dehydrogenase 2 gene rs671 pleomorphism sites, and it is special Sign is：The reagent contains above-mentioned primer.
Another aspect of the present invention additionally provides a kind of kit for detecting aldehyde dehydrogenase 2 gene rs671 pleomorphism sites, It is characterized in that：The kit also contains above-mentioned primer.
It is preferred that also include the probe being used cooperatively with the primer in the kit, wherein, the probe is Taqman Probe, there is SEQ No.15 sequences.
Further preferably, the kit also includes PCR reaction tubes, dNTPs and Taq enzyme mixed liquor, PCR buffer solutions, inspection Survey the spy of house-keeping gene GAPDH sense primer, detection house-keeping gene GAPDH anti-sense primer and detection house-keeping gene GAPDH Pin, positive quality control product and blank control；
The sense primer of the detection house-keeping gene GAPDH has SEQ No.19 sequences；The detection house-keeping gene GAPDH anti-sense primer has SEQ No.20 sequences；The probe of the detection house-keeping gene GAPDH has SEQ No.21 sequences Row.
Further preferably, the saltant type specific forward primer, the shared anti-sense primer, the probe, described Detect house-keeping gene GAPDH sense primer, the anti-sense primer of the detection house-keeping gene GAPDH and the detection house-keeping gene GAPDH probe is coated in A type PCR reaction tubes in advance；And with the wild type specific forward primer, it is described share Anti-sense primer, the probe, the sense primer of the detection house-keeping gene GAPDH, under the detection house-keeping gene GAPDH Trip primer and the detection house-keeping gene GAPDH probe are coated in G type PCR reaction tubes in advance.
Further preferably, saltant type specific forward primer in the A types PCR reaction tubes, the shared anti-sense primer, The probe, the sense primer of the detection house-keeping gene GAPDH, the anti-sense primer of the detection house-keeping gene GAPDH and institute The concentration and probe concentration for stating detection house-keeping gene GAPDH is respectively 50nM-2um, 50nM-2uM, 50nM-400nM, 1pm-20pm, 1pm- 20pm、0.05pm-5pm；And wild type specificity sense primer, the shared downstream are drawn in the G types PCR reaction tubes Thing, the probe, the sense primer of the detection house-keeping gene GAPDH, the detection house-keeping gene GAPDH anti-sense primer and The concentration and probe concentration of the detection house-keeping gene GAPDH be respectively 50nM-2um, 50nM-2uM, 50nM-400nM, 1pm-20pm, 1pm-20pm、0.05pm-5pm。
Still more preferably, saltant type specific forward primer, the shared downstream are drawn in the A types PCR reaction tubes Thing, the probe, the sense primer of the detection house-keeping gene GAPDH, the detection house-keeping gene GAPDH anti-sense primer and The concentration and probe concentration of the detection house-keeping gene GAPDH is respectively 500nM, 500nM, 100nM, 5pm, 5pm, 2.5pm；It is and described Wild type specificity sense primer, the shared anti-sense primer, the probe, detection house keeper's base in G type PCR reaction tubes Because of the spy of GAPDH sense primer, the anti-sense primer of the detection house-keeping gene GAPDH and the detection house-keeping gene GAPDH Pin concentration is respectively 500nM, 500nM, 100nM, 5pm, 5pm, 2.5pm.
Present invention also offers above-mentioned primer and the PCR method of kit, it is characterised in that：PCR reactions are expanded by two steps Cyclic program is carried out, and the period of first step amplification is less than the period of second step amplification, the annealing of the first step amplification Temperature is higher than the annealing temperature of second step amplification.
It is preferred that the condition of the PCR reactions is：37 DEG C of 2min, 95 DEG C of 2min pre-degenerations；The first step expands, 95 DEG C 5s is denatured, 55 DEG C ~ 68 DEG C annealing 32s, is circulated 10 ~ 15 times；Second step, 95 DEG C of denaturation 5s, 50 DEG C ~ 65 DEG C annealing, prolongs 32s is stretched, is circulated 30 ~ 50 times, collects fluorescence signal；Further preferably, the condition of the PCR reactions is：37 DEG C of 2min, 95 DEG C 2min pre-degenerations；The first step expands, and 95 DEG C of denaturation 5s, 63 DEG C of annealing 32s, circulates 15 times；Second step, 95 DEG C of denaturation 5s, 60 DEG C of annealing, extension 32s, circulates 40 times, collects fluorescence signal.
The primer and its kit of detection aldehyde dehydrogenase 2 gene rs671 pleomorphism sites provided by the invention, Neng Gou great Big increase allele-specific primers PCR sector divides the ability in not iso-allele site, makes the non-specificity between different loci The possibility for intersecting amplification is preferably minimized, and can accomplish the amplification of real " all or none " formula, only not good specificity, is also had There is extraordinary sensitivity, the genotype distribution situation in 1ng genomic DNAs can be detected.
It is provided by the invention detection aldehyde dehydrogenase 2 gene rs671 pleomorphism sites primer and its kit, have with Lower advantage：
1）Result " all or none " is judged by being truly realized testing result to the artificial change on primer sequence, significantly The difficulty of result interpretation is simplified, reduces the possibility of error, is provided convenience for scientific research and clinical practice.
2）The mixing of Taq enzyme and dNTPs, dNTPs stability is ensured, it is subjected to examining for multiple multigelation Test.
3）The buffer solution that can be used directly pre-assigned in advance, user are more convenient.
4）Primer and probe is coated in PCR reaction tubes in advance, avoids the possibility that site mismatch occurs in operator, and Also save a large amount of operating times.
5）Primer and kit have specific good in the present invention, and the high sensitivity of detection, detection speed is fast, whole process It can be completed in 20 minutes 1 hour.
6）Only probe is not closed such as without other, is reduced cost with a conventional Taqman probe in kit.
7）The kit has the advantages that detection is simple, quick, accurate, inexpensive.
Brief description of the drawings
PCR amplification curve diagrams when Fig. 1 is design wild type and mutant primers；
Fig. 2 is the PCR amplification curve diagrams in A sites；
Fig. 3 is the PCR amplification curve diagrams in G sites；
Fig. 4 is the PCR amplification curve diagrams in AG sites；
Fig. 5 is house-keeping gene GAPDH PCR amplification curve diagrams.
Embodiment
The present invention is further expalined with specific case below, but the protection model being not intended to limit the invention Enclose.
Unless otherwise specified, the conventional meanses that technological means used in embodiment is well known to those skilled in the art, Product used is purchased in market.
Defined below is the explanation of relational language in the present invention：
" allele " generally refers to DNA section, in the same, physical on homologue, controls relativity One pair of genes.In some cases, the replacement for the mononucleotide that allele can correspond on specific physics locus. In other situations, allele can correspond to (single or multiple) insertions of nucleotides or missing.
" allele-specific primers " refers to complementary with the sequence of target alleles, can extend completion in PCR Special PCR reactions.Allele-specific primers can be designed to detect in target sequence as little as 1 nucleotide difference ten The different primer of dtex, the primer can include allele-specific nucleotide part, 3 ' end target specificity parts and tail.
" MGB groups " refers to minor groove binding.When being conjugated with the 3 ' of oligonucleotides ends, MGB groups can be used as not Extendible enclosure portion plays a role.MGB is the molecule that can be incorporated into the ditch of double-stranded DNA, generally use DPI3（It is closed Into method referring to U.S. Patent number 6,084,102；With 6,727,356).
" detection probe " refers to：Indicate any one in the multi-signal transduction molecule of amplification.For example, SYBR Green All it is detection probe with other DNA binding dyes.Some detection probes can be sequence-specific, such as Taqman probes (U.S. Patent number 5,538,848), a variety of stem ring molecular beacons (U.S. Patent number 6,103,476 and 5,925,517 and Tyagi and Kramer, Nature Biotechnology, 1996,14：303-308), acaulescence or Linear Beacon (WO99/ 21881), PNA Molecular Beacons TM (U.S. Patent number 6,355,421 and 6,593,091), linear PNA beacons (Kubista et al., 2001, SPIE4264：53-58), non-FRET probes (U.S. Patent number 6,150,097), Sunrise/ Amplifluor probes (U.S. Patent number 6,548,250), stem ring and double-strand Scorpion TM probes (Solinas et al., 2001, NucleicAcidsResearch29：E96 and U.S. Patent number 6,589,743), the ring probe (U.S. Patent number heaved 6,590,091), false knot probe (U.S. Patent number 6,589,250), cyclicon (U.S. Patent number 6,383,752), MGB Eclipse TM probes (Epoch Biosciences), hairpin probe (U.S. Patent number 6,596,490), peptide nucleic acid (PNA) are visited Pin.Detection probe can include fluorescent reporter molecule, for example, 6- Fluoresceincarboxylic acids (6-FAM) or tetrachlorofluorescein (TET), and Quencher molecule part, such as tetramethylrhodamin (TAMRA), Black Hole QuencheRS (Biosearch), Iowa Black (IDT), QSY quenchers (Molecular Probes) and Dabsyl and Dabcel sulfonate/carboxylate quencher (Epoch)。
" shared specific primer " refers to the primer with allele-specific primers pairing in PCR reacts, and it can be same The allele-specific primers pairing of different loci uses.
" polymerase of heat endurance " refers to heat endurance or heat resistance enzyme, refers mainly to archaeal dna polymerase, the enzyme exists When PCR is expanded, it will not inactivate at an elevated temperature.
When " Tm " or " melting temperature " of oligonucleotides refers to 50% molecule and complementary sequence hybridization in section of DNA Temperature.Tm values can be calculated (see Maniatis, T. et al. using well known formula：Molecular cloning, Cold Spring Harbor, N.Y.：1982).
" sensitivity " is to refer to be detected the minimum (copy number) of template.
" specificity " refers to the ability for distinguishing matching template and mispairing template.Specificity is often expressed as Δ Ct=Ct mistakes Matched with-Ct.
" selectivity " refer to minority (typically be mutated) allele that AS-PCR measure can be used in measure mixture and Degree without the interference from most (often wild type) allele.Selectivity is often expressed as ratio or percentage.Example Such as, the measure that 1 mutagenesis template can be detected in the case where 100 wild-type templates be present is referred to as having 1: 100 or 1% Selectivity.
" Ct " value refers to cycle threshold, represents period when PCR amplification curves are changed into exponential increase flex point from baseline.
" Delta Ct " or " when Δ Ct " refers to that signal passes through fixed threshold, two different samples or reaction between circulation Number difference.Δ Ct is the period difference between two different samples or reaction when reaching exponential amplification.Δ Ct can be used for identifying Match the specificity between primer and mismatched primers.
The present invention relates to the primer and kit of quick detection ALDH2 gene rs671 pleomorphism sites.Specifically, originally Invention is to be based on Past-PCR（Perfect allele-specific Taqman PCR）On the basis of method, it is successfully applied to ALDH2 genes rs671 pleomorphism site detection.So-called Past-PCR is the Gao Te by detection gene polymorphism sites or mutation The Fluorescence PCR assay of different in nature AS-PCR methods and Taqman probes is combined into, and it is only with a Taqman probe, in majority In the case of, this probe is conventional Taqman probes, because of the special sequence rich in AT bases only in portion gene, is used The probes such as Taqman-MGB or LNA, in addition incited somebody to action without any extra closing probe or reporter probe, Past-PCR methods AS-PCR and Taqman fluorescent PCR two methods perfect adaptations, and make to have obtained the performance of extreme, specific manifestation the advantages of both In AS-PCR methods, in the case where not increasing any cost, successfully eliminated by design of primers and unique verification method Non-specific amplification so that result judgement shows " complete and nothing " mode, that is, having just has, and does not just have so that result is sentenced Disconnected simple and accurate, this is that have to the maximum improvement of past AS-PCR methods, and to AS-PCR methods for what This is what people generally disapprove of Effect makes up, ultimate attainment so as to which the advantages of AS-PCR methods performed to, and is the tidemark that this method can reach.Many institute's weeks Know, Taqman fluorescent PCRs have seal detection without reacting the processing after finishing, and not only save the time, and reduce The risk of PCR primer pollution, second of identification target sequence of probe have ensured the specificity and reliability of detection, it may also be used for right The quantitative detection of gene, the advantages that having reached criterion for clinical use.Past-PCR methods have AS-PCR methods and Taqman glimmering The two-fold advantage of light PCR method, and when being that both approaches are combined together, the most simplified structure that detection component can reach Into therefore, we are called it as perfect allele-specific Taqman PCR.
Based on Past-PCR methods, the kit for detecting Gene A LDH2 gene rs671 pleomorphism sites has been invented, It basic composition is：(a) allele-specific primers of high special；(b) fluorescent detection probe；(c) it is special with allele Another specific primer of specific primer pairing.
Wherein, the primer of detection aldehyde dehydrogenase 2 gene rs671 pleomorphism sites provided by the invention, including：Wild type Specific forward primer, saltant type specific forward primer and wild type specific forward primer and saltant type specific upstream draw The shared anti-sense primer of thing；
And the wild type specific forward primer has SEQ No.17 sequences, the saltant type specific forward primer With SEQ No.14 sequences, the shared anti-sense primer has SEQ No.16 sequences.
Detection reagent and kit containing above-mentioned primer are additionally provided simultaneously, to solve detection aldehyde dehydrogenase 2 in the past It is big operation difficulty to be present in gene rs671 pleomorphism sites, certain false negative and false positive be present, and testing cost is high, clinic popularization Degree is low, it is impossible to while the problems such as extensive detection clinical samples, realizing simple, quick, accurate, the cheap ideal of detection will Ask, strong instrument is provided for scientific research and clinical gene type and gene mutation analysis.
It is preferred that also include the probe being used cooperatively with the primer in the kit, wherein, the probe is Taqman Probe, there is SEQ No.15 sequences, a probe is used only in whole kit, does not close probe etc. without other, reduce The cost of kit.
Further preferably, the kit also includes PCR reaction tubes, dNTPs and Taq enzyme mixed liquor, PCR buffer solutions, inspection Survey the spy of house-keeping gene GAPDH sense primer, detection house-keeping gene GAPDH anti-sense primer and detection house-keeping gene GAPDH Pin, positive quality control product and blank control；
The sense primer of the detection house-keeping gene GAPDH has SEQ No.19 sequences；The detection house-keeping gene GAPDH anti-sense primer has SEQ No.20 sequences；The probe of the detection house-keeping gene GAPDH has SEQ No.21 sequences Row；Wherein, dNTPs and Taq enzyme are mixed, dNTPs stability can be ensured, it is subjected to examining for multiple multigelation Test；Detection house-keeping gene GAPDH sense primer, anti-sense primer and probe is for use as internal reference, to go out when preventing detection Existing false negative；Positive quality control product is AG type human gene group DNAs；Blank control is sterilizing ultra-pure water.
Further preferably, the saltant type specific forward primer, the shared anti-sense primer, the probe, described Detect house-keeping gene GAPDH sense primer, the anti-sense primer of the detection house-keeping gene GAPDH and the detection house-keeping gene GAPDH probe is coated in A type PCR reaction tubes in advance；And with the wild type specific forward primer, it is described share Anti-sense primer, the probe, the sense primer of the detection house-keeping gene GAPDH, under the detection house-keeping gene GAPDH Trip primer and the detection house-keeping gene GAPDH probe are coated in G type PCR reaction tubes in advance, are used by optimal reaction Amount is coated in PCR reaction tubes in advance, six oligonucleotides is actually coated with each reaction tube, i.e., one is directed to allele A kind of specific forward primer, a probe（Usually Taqman probes）, a shared specific Down Stream primer, an inspection Survey house-keeping gene GAPDH sense primer, an anti-sense primer for detecting house-keeping gene GAPDH and a detection house-keeping gene GAPDH probe.So in order to detect a different gene pleiomorphism in site, often need to be coated with respectively more than two pipes or two pipes PCR reaction tubes, their middle probes, share specific Down Stream primer, detection house-keeping gene GAPDH sense primer, detection pipe As family gene GAPDH anti-sense primer and detection house-keeping gene GAPDH probe be, different is only to identify allele The other specific forward primer of different shaped, so coating avoids the possibility that site mismatch occurs in operator in advance, and saves A large amount of operating times.
Further preferably, saltant type specific forward primer in the A types PCR reaction tubes, the shared anti-sense primer, The probe, the sense primer of the detection house-keeping gene GAPDH, the anti-sense primer of the detection house-keeping gene GAPDH and institute The concentration and probe concentration for stating detection house-keeping gene GAPDH be respectively 50nM-2um, 50nM-2uM and 50nM-400nM, 1pm-20pm, 1pm-20pm、0.05pm-5pm；And wild type specificity sense primer, the shared downstream in the G types PCR reaction tubes Primer, the probe, the sense primer of the detection house-keeping gene GAPDH, the anti-sense primer of the detection house-keeping gene GAPDH Concentration and probe concentration with the detection house-keeping gene GAPDH is respectively 50nM-2um, 50nM-2uM and 50nM-400nM, 1pm- 20pm、1pm-20pm、0.05pm-5pm.It is optimal to be, it is saltant type specific forward primer in the A types PCR reaction tubes, described common Anti-sense primer, the probe, the sense primer of the detection house-keeping gene GAPDH, the detection house-keeping gene GAPDH Anti-sense primer and the detection house-keeping gene GAPDH concentration and probe concentration be respectively 500nM, 500nM and 100nM, 5pm, 5pm, 2.5pm；And wild type specificity sense primer in the G types PCR reaction tubes, the shared anti-sense primer, the probe, The sense primer of the detection house-keeping gene GAPDH, the anti-sense primer of the detection house-keeping gene GAPDH and the detection house keeper Gene GAPDH concentration and probe concentration is respectively 500nM, 500nM and 100nM, 5pm, 5pm, 2.5pm.
Due to introducing the base of mispairing in allele-specific primers, decline its efficiency in reaction, no Same primer declines degree difference, generally to increase effects when 10 to 20 circulations can be only achieved no mispairing, ensure to detect Sensitivity, preferably PCR reaction by two step amplification cycles programs carry out, and the first step amplification period be less than second step amplification Period, the annealing temperature of first step amplification is higher than the annealing temperature of second step amplification, and first step amplification use is higher Annealing temperature, second step expand use compared with low temperature thermal oxidation, it is therefore an objective to specificity when increasing the first step amplification during primer annealing, So as to ensure the purpose of Past-PCR detection high degree of specificity；Specifically the condition of preferably described PCR reactions is：37℃ 2min, 95 DEG C of 2min pre-degenerations；The first step expands, and 95 DEG C of denaturation 5s, 55 DEG C ~ 68 DEG C annealing 32s, circulates 10 ~ 15 times； Second step, 95 DEG C of denaturation 5s, 50 DEG C ~ 65 DEG C annealing, extension 32s, circulates 30 ~ 50 times, collects fluorescence signal；It is more highly preferred to PCR reaction condition be：37 DEG C of 2min, 95 DEG C of 2min pre-degenerations；The first step expands, 95 DEG C of denaturation 5s, 63 DEG C of annealing 32s, circulate 15 times；Second step, 95 DEG C of denaturation 5s, 60 DEG C of annealing, extension 32s, circulates 40 times, collects fluorescence signal.
Specifically detection process is：
1）Detected sample is respectively put into and is coated with wild type special primer, shared anti-sense primer respectively in advance, visits Pin, detection house-keeping gene GAPDH sense primer, detection house-keeping gene GAPDH anti-sense primer and detection house-keeping gene GAPDH Probe and saltant type special primer, shared anti-sense primer, probe, detection house-keeping gene GAPDH sense primer, detection In house-keeping gene GAPDH anti-sense primer and detection house-keeping gene GAPDH two groups of PCR reaction tubes of probe, and add PCR bufferings Liquid, dNTPs and Taq enzyme mixed liquor, sterilizing ultra-pure water and genomic DNA, cover tightly lid, are carried out on quantitative real time PCR Instrument anti- Should, and collect fluorescence signal；
2）If detection sample only has the amplification curve that saltant type reaction tube has logarithm to increase in FAM passages, while VIC leads to There is the amplification curve that logarithm increases in road, and can determine that sample is A types, i.e. saltant type homozygote；
If detection sample only has the amplification curve that wild type reaction tube has logarithm to increase in FAM passages, while VIC passages There is the amplification curve that logarithm increases, can determine that sample is G types, i.e. wild-type homozygote；
If detection sample saltant type and wild type reaction tube have the amplification curve of logarithm growth in FAM passages, simultaneously VIC passages have the amplification curve that logarithm increases, and can determine that sample is AG types, i.e. heterozygote；
, may if detecting the amplification curve that sample saltant type and wild type reaction tube increase in FAM passages without logarithm There is problem in sample or operation, or sample DNA concentration is too low, should extract sample DNA again and be tested.
Each component introduction in detection process is explained in detail below：
（One）Allele-specific primers：
The allele-specific nucleotide partial complementarity of allele-specific primers is in an allele of gene Site, but another allele site of the gene is not complementary to.Typically, the equipotential base of allele-specific primers Because specific nucleotide acid moieties are located at the last bit base at 3 ' ends of allele-specific primers.In some cases, equipotential base Because specific nucleotide acid moieties may be alternatively located at other base positions of the end of allele-specific primers 3 '.
In some cases, allele-specific primers is in addition to 3 ' termini-complementaries are varied from allele site, We are often required to introduce the base of mispairing in the other positions of primer, such as hold penultimate or the 3rd introducing alkali in primer 3 ' Base mispairing, or second and the continuous mispairing of the 3rd；For different SNP or mutational site, penultimate is held in primer 3 ' Or on the basis of the 3rd introducing base mispairing, also it can meet atopic in other sites of primer increase base mispairing Requirement, further away from 3 ' ends, it is more to increase the base number of mispairing, at 5 ' ends up at most.The length of allele-specific primers Its T of degree Main BasissmValue determines, typically its TmValue is lower than the annealing temperature of PCR cycle about 5-20 DEG C.
The allele-specific sense primer of the corresponding gene pleiomorphism of two detections, except its base of site of 3 ' end detections Different outer, remaining sequence is as identical as possible, the T of two primersmValue is also as consistent as possible.
Low TmAllele-specific primers (ASP) have higher specificity.Generally, allele-specific Primer is short oligonucleotide, and its length is about 15-30, its TmIt it is about 40 DEG C to 60 DEG C, than the PCR used in amplification procedure Annealing/elongating temperature of cycling condition is low about 5 DEG C to 20 DEG C.
Because the design and screening of allele-specific primers are particularly significant, good primer needs to draw from numerous to be selected Selected in thing, therefore we establish a method screened, the specific screening process of its allele-specific primers is as follows：
(1) peripheral primer and PCR amplification is designed：First in gene mutation point to be checked or the upstream and downstream of SNP site, design one To pcr amplification primer thing, this is then used to carry out conventional PCR to target gene and react primer, wherein expanding fragment length can be Tens to many kilobases pair, and preferred length is 200 to 500 base-pairs；
(2) clone PCR products：Common carrier T matter is arrived in the PCR primer that will be amplified, the method cloned using AT, restructuring In grain, recombinant plasmid is obtained, wherein obtained recombinant plasmid can carry out sequence verification, so that it is guaranteed that the correctness of PCR primer；
(3) recombinant mutant is built：The information provided according to bioinformatics, using molecule clone technology, by mutant Sequence, build into recombinant plasmid obtained above, the recombinant mutant of structure be subjected to sequence verification sequence, so that it is guaranteed that Its correctness；
(4) design and screen specific primer on the mutated site：Two allele-specific primerses are designed, primer 3 ' ends are complementary with mutant nucleotide sequence, and 3 ' ends of another primer are complementary with normal sequence；Then drawn respectively with allele-specific Thing and the common anti-sense primer pairing of corresponding Standard PCR, it is glimmering using the above-mentioned recombinant mutant built as reaction template, utilization Fluorescent Quantitative PCR instrument, to reaction system, screened；Wherein, reaction can use fluorescent dye, such as SYBR GREEN, can also use Specific Taqman fluorescence probe, screened according to added sample size for the standard of 0.1 microgram complete genome DNA, it has The screening content of body is as follows：
（a）Set PCR reaction conditions：First set PCR reaction annealing temperature it is completely the same, actual temp be 55 DEG C~ 68 DEG C, PCR cycle number is 40 times, and the enzyme and buffer system that PCR reacts immobilize after optimizing, the setting of this reaction condition Be for convenience and meanwhile detect several genes be mutated；
（b）Specificity screening：The primer of saltant type is used using the recombinant plasmid of wild type as template, the primer filtered out its Ct is more than 40；
The determination reason of wherein cycle threshold is as follows, and in wild-type template non-specific amplification occurs for mutant primers than wild In wild-type template 19 circulations more than specific amplification occur for raw type primer, and when being detected according to clinical practice, added sample size is The standard of 0.1 microgram complete genome DNA, we pass through following equation, copy number=(amount of DNA ng × 6.022 × 1023)/(length bp×109× 660), the wherein length of complete genome DNA is 3,000,000,000 pairs of bases, therefore the copy of 0.1 microgram complete genome DNA Number is：3.09×104, it is reflected in the Ct of quantitative fluorescent PCR（Quantitative cycle threshold）About 21, so we obtain second Screening index, i.e., with the primer of saltant type, when the recombinant plasmid of wild type is template, the Ct of gained should be more than 40, can It is not in false positive to ensure detection, and both amplification efficiency differences circulate for 40-21=19, i.e., amplification efficiency differs 19 More than circulation, the objective indicator of allele-specific primers specificity quality will be judged as us.It is understood that work as primer When 3 ' ends are with template mispairing, extension efficiency will decline 103-106.6Times, it is converted into reaction cycle number and then declines about 13 to 27 and follows Ring, here it is the theoretical foundation that we can filter out preferable primer, because without primer screening, 19-13=6 circulation certainly will False positive is produced, the specificity of the primer is just bad, and 19-27=- 8, it is impossible to produces false positive, the scope for there are 8 periods Primer is screened for us.According to this requirement, we design a series of allele-specific primerses, from length, Set about from being artificially introduced close to 3 ' ends on base mispairing, plus the anti-sense primer of its pairing, using the wild type built and dash forward Modification recombinant plasmid, the intersection screening of quantitative fluorescent PCR reaction is carried out respectively, i.e., is entered when with the template of mutant primer and wild type During row amplification, with to be used more than 19 periods with the reaction of wild-type template with wild primers, vice versa, then this The primer of sample just possesses the specificity of height.
（c）Sensitiveness is screened：The specific primer filtered out is made into sensitivity tests with recombination mutation type plasmid, will be examined The specific primer that sensitivity is surveyed less than 10-1000 copy screens, as required mutant-specific primers.
By the screening of above several respects, resulting allele-specific primers will be provided with high degree of specificity and height Sensitive preferable primer.
（Two）Detection probe：
In some cases, the T of detection probemValue is about 60 DEG C to 70 DEG C, and most preferably 65 DEG C, probe length is according to it TmValue determines.It is available in spite of a variety of various forms of probes, Taqman probes (Applied Biosystems, Foster City) it is often preferred.In some special cases, such as AT too high levels in detection sequence, it can use and improve TmThe probe of the types such as the Taqman-MGB of value.
Shared specific primer, in some cases, the T of shared specific primermValue is about 50 DEG C to 70 DEG C, Most preferably 60 DEG C, its length is by its TmValue determines, typically between 15-25 bases.
（Three）Other compositions：
The archaeal dna polymerase that the present invention uses is Taq enzyme, and its mutant, derivative or fragment or other heat-resisting Archaeal dna polymerase, in some cases, Hotstart Taq enzymes can be also used, with the special and high efficiency of increase reaction.
The primer and kit that are there is provided for ALDH2 genes provided in the present invention, primarily directed to allele The shortcomings that specific primer PCR TRAPs, using molecule clone technology, structure contains gene wild type to be checked and mutation respectively in advance The recombinant plasmid of type, using this recombinant plasmid as positive template, screening determine specifically respectively with 3' terminal mutations site or wild Two special primers of site base complementrity, once the specific primer sequences filtered out, will be the key members of our detection architectures Element.The said goods of the present invention, available for the quantitative real time PCR Instrument of any model, reagent cost is the same as fluorescence nowadays on the market Quantitative PCR reagent is suitable, therefore preferably overcomes other deficiencies for using allele-specific primers PCR TRAPs.
The advantage of the invention is that：Described kit has simple to operate, and cost is low, and it is simple easy as a result to judge, spirit Sensitivity is high, and the detection gene mutation sensitivity of this kit can reach 1%（That is the mutator DNA template numbers of target gene account for The 1% of wild type DNA profiling number）；And the sensitivity that gene mutation is detected in direct Sequencing is 20%（That is the mutation base of target gene Because DNA template numbers account for the 20% of wild type DNA template numbers）；Taqman probe techniques ensured kit to be detected as stopped pipe anti- Should, the generation of false positive is effectively avoided, it detects specificity and is also fully guaranteed, and detection is quick and convenient, entirely Detection process only has 80 minutes, and direct Sequencing then needs the time of 2 days, and is open pipe operation, PCR primer pollution Possibility increases.
PCR in the present invention（Past-PCR）Implementation steps：
1. the structure of positive plasmid
One couple of PCR primers is designed in the upstream and downstream of ALDH2 gene rs671 pleomorphism sites to be detected, its amplified fragments Length can be template with gDNA in the range of 500bp, using conventional PCR method, amplify this fragment, pass through AT grams Grand mode, the fragment is cloned into the plasmid of sequencing, generally uses Invitrogen pCR2.1 Topo carrier T reagents Box, operation by specification are carried out, it is also possible to the carrier T kit of other producers, or even can use the carrier T plasmid oneself prepared. Obtained positive colony, through sequence verification, it was demonstrated that the correctness of sequence, then using Stratagene companies Quickchange kits, another genotyping primer in corresponding site is designed, by Quickchange method, is somebody's turn to do The other positive colony of saltant type, operation by specification are carried out, and resulting positive plasmid all must be correct side through sequence verification The use of next step can be entered.The quantitative plasmids of Taqman, and it is used as template to verify the sensitivity of given determination method, linearly move State scope, specificity.
2. the design and screening of allele-specific primers (ASP)
In the termini-complementary of primer 3 ' in corresponding gene mutation base position, and in the end of primer 3 ' penultimate or Three introducing base mispairings, or second and the continuous mispairing of the 3rd；For different SNP or mutational site, held in primer 3 ' On the basis of penultimate or the 3rd introducing base mispairing, it can also meet in other sites of primer increase base mispairing The requirement of atopic, further away from 3 ' ends, increase that the base number of mispairing is more, it is special up to most allele 1 at 5 ' ends Specific primer.
ASP screening is using the wild type and saltant type recombinant plasmid built, carries out quantitative fluorescent PCR reaction respectively Intersection screening, i.e., when being expanded with the template of mutant primer and wild type, and with the same wild-type template of wild primers Reaction to use more than 19 periods, vice versa, then such primer just possesses the specificity of height.It will filter out Specific primer make sensitivity tests with corresponding recombinant plasmid, detection sensitivity is less than the 10-1000 primer copied Reach the sensitivity requirement of detection, the primer for meeting above-mentioned two condition is exactly the ASP primers that we select, and can be carried out next The detection of step.
3. amplifing reagent prepares and added to be detected sample
（1）Take out each constituent from kit, room temperature slowly melt PCR buffer solutions, dNTPs and Taq enzyme mixed liquor, Positive quality control product, blank control, it is reverse to shake up.Each reaction tube need to add PCR buffer solutions, Taq enzyme（dNTPs）, sterilizing it is ultrapure Water and DNA sample.Lid is covered tightly, PCR amplification regions are transferred to after brief centrifugation.
（2）It is recommended that each PCR reactions carry out sample, positive quality control product, the analysis of blank control, positive quality control product simultaneously Loading methods with blank control are the same as sample Adding Way.
4. reaction condition
(scope of reaction final volume can be in 10-50 μ l, most preferably in 20-25 μ l reaction volumes) is included in each reaction tube PCR buffer solutions（10mM Tris-HCl pH8.3,50mM KCl, 0.1%Triton X-100,2.0mM MgCl2）, 10- 100ng DNA or 1, the DNA of 000,000 copy, mono- common general specificity T aqman of 50nM-400nM are visited Pin, general reversely specific Down Stream primer common a 50nM-2uM, 50nM-2uM difference allele-specifics upstream is drawn Thing, 1pm-20pm detection house-keeping genes GAPDH sense primer, 1pm-20pm detection house-keeping genes GAPDH anti-sense primer, 0.05pm-5pm detection house-keeping genes GAPDH probe, along with 1.5 units of Taq polymerase, 200 μM of dNTPs.
1）, cycling condition set
To make fluorescence curve more attractive in appearance, it is proposed that collect fluorescence signal since second step.
2）, instrument sense channel selection
Fluorescence signal acquisition temperature is set to 60 DEG C, and specific method to set up refer to corresponding instrument operation instructions.
3）, detection type setting：Blank control is set to " NTC ", and positive quality control product and sample to be checked are set to " Unknown ".
5. interpretation of result
If detection sample only has the amplification curve that saltant type reaction tube has logarithm to increase in FAM passages, while VIC passages There is the amplification curve that logarithm increases, can determine that sample is A types, i.e. saltant type homozygote；It is anti-that if detection sample only has wild type Should pipe FAM passages have logarithm increase amplification curve, while VIC passages have logarithm increase amplification curve, can determine that sample For G types, i.e. wild-type homozygote；If detection sample saltant type and wild type reaction tube have what logarithm increased in FAM passages Amplification curve, while VIC passages have the amplification curve that logarithm increases, can determine that sample is AG types, i.e. heterozygote；Due to this method Result is " all or none ", is as a result easily judged, which pipe has reaction, and which pipe is exactly positive.
Specific embodiment
Below with to ALDH2（Aldehyde dehydrogenase 2）Exemplified by the situation of gene rs671 polymorphic position point mutation detections, specifically The present invention is further detailed explanation.
Embodiment 1：For ALDH2（Aldehyde dehydrogenase 2）The wild type and saltant type of gene rs671 polymorphic detections are positive The preparation of plasmid
We recall the gene order before and after ALDH2 gene rs671 pleomorphism sites from gene pool first, and will be more State property site is marked with double underline, in the upstream and downstream appropriate location of ALDH2 gene rs671 pleomorphism sites（With boldface type and Underscore indicates）, a pair of cloning primers, amplified fragments 274bp are designed, mutational site is included in it, and gene order is shown such as Under, SEQ No.1：
gggcaacagagaaagattctatctcaaaaaaaaaaatttttttttaagttaaaaataaaataaagactttggggcaa tacagggggtcctgggagtgtaacccataacccccaagagtgatttctgcaatctcgtttcaaattacagggtcaac tgctatgatgtgtttggagcccagtcaccctttggtggctacaagatgtcggggagtggccgggagttgggcgagta cgggctgcaggcatacactgaagtgaaaactgtgagtgtgggacctgctgggggctcagggcctgttggggcttgag ggtctgctggtggctcggagcctgctgggggattggggtctgttgggggctcggggcctgccagaggttcaggacct gccggggactcagggcctgctggaagttcaggacctgctggggatcagggcctgccagggatttagggtct
Experimental procedure is as follows：
1）Extract genomic DNA
With the genome DNA extracting reagent kit of domestic Tiangeng company or Qiagen companies, genomic DNA, specific behaviour are extracted Make the progress of step by specification.The DNA samples prepared, concentration is determined through ultraviolet specrophotometer, its concentration is adjusted to 50ng/ μ l, -20 DEG C are stored in, or directly carry out following reaction.
2）AT clones obtain positive plasmid
Cloning primer is designed in catastrophe point upstream and downstream first, is shown in Table 1：
Table 1.ALDH2 gene rs671 pleomorphism site Wild type clone primers
In 12.5 μ l 2 × PCR Master Mix (Fermentas) PCR amplification system, add 10 μM of upstreams and draw Thing and 10 μM of anti-sense primers, and genomic DNA 50ng, add water to μ l, the PCR reaction conditions of cumulative volume 25 and be set as 95 DEG C of pre- changes Property 3min, 95 DEG C denaturation 10s, 60 DEG C annealing and extension 30s, altogether 35 circulation, reaction terminate after take 15 μ l reaction products, enter The gel electrophoresis of row concentration 2.5%, electrophoresis are observed after terminating, and band is consistent with the size predicted, shows to expand successfully.Using U.S. The pCR2.0 TOPO carrier Ts of Life companies of state, by its operating instruction, by way of TA clones, obtain ALDH2 genes Rs671 sites wild-type positive plasmid, specific gene order is as follows, and wherein pleomorphism site is shown as G types, illustrates to be wild Type, it is correct that sequencing proof obtains plasmid.
SEQNo.4：gggggtcctgggagtgtaacccataacccccaagagtgatttctgcaatctcgtttcaaat tacagggtcaactgctatgatgtgtttggagcccagtcaccctttggtggctacaagatgtcggggagtggccggga gttgggcgagtacgggctgcaggcatacactgaagtgaaaactgtgagtgtgggacctgctgggggctcagggcctg ttggggcttgagggtctgctggtggctcggagcctgctgggggattggggtctgttggg
3）Rapid mutation method obtains mutant plasmid
Then, using the method for producing rapid mutation（Quickchange,QC）, mutant primer is designed, primer sequence is shown in Table 2.
Table 2. obtains the rs671 pleomorphism site mutant clones primers of ALDH2 genes
According to（Stratagene companies）The reaction condition and step of Quickchange kits, complete the structure of mutant Build, resulting recombinant plasmid, specific gene order is as follows, is shown as A types through sequence verification wherein pleomorphism site, is prominent Modification, saltant type is then put -20 DEG C with wild plasmid respectively and saved backup.
SEQ No.7：gggggtcctgggagtgtaacccataacccccaagagtgatttctgcaatctcgtttcaaa ttacagggtcaactgctatgatgtgtttggagcccagtcaccctttggtggctacaagatgtcggggagtggccggg agttgggcgagtacgggctgcaggcatacactaaagtgaaaactgtgagtgtgggacctgctgggggctcagggcct gttggggcttgagggtctgctggtggctcggagcctgctgggggattggggtctgttggg
Embodiment 2：Allele-specific primers（ASP）Design and specificity screening
For ALDH2 gene rs671 pleomorphism sites, design wild type and a series of mutation Idiotype primers are as follows：
The rs671-WT-F of ALDH2 genes: gggctgcaggcatacagtg（SEQ No.8）
The rs671-mut-F of ALDH2 genes: gggctgcaggcatacagta（SEQ No.9）
The rs671-mut-F1 of ALDH2 genes: ggctgcaggcatacagta（SEQ No.10）
The rs671-mut-F2 of ALDH2 genes: gctgcaggcatacagta（SEQ No.11）
The rs671-mut-F3 of ALDH2 genes: gctgcaggcatacacaa（SEQ No.12）
The rs671-mut-F4 of ALDH2 genes: ggctgcaggcatacacaa（SEQ No.13）
The rs671-mut-F5 of ALDH2 genes: gggctgcaggcatacacaa（SEQ No.14）
Synthesis Taqman specific probes are designed simultaneously：
SEQ No.15：FAM-cctgttggggcttgagggtc-BHQ1.
Relevant primer and probe are in raw work bioengineering（Shanghai）Co., Ltd is synthesized.
Then respectively with above-mentioned 7 primers and the common anti-sense primer rs671-R of ALDH2 genes: 5’- cccaacagaccccaatc-3’（SEQ No.16）Primer matches, and plus Taqman specific probes, adds foregoing structure institute About 30,000 copies of obtained wild type recombinant plasmid are template, primer specificity screening are carried out on quantitative real time PCR Instrument, instead Answer condition to be set as 95 DEG C of 2min pre-degenerations of the first step, 95 DEG C of 5s, 63 DEG C of 30s totally 15 circulations, do not collect fluorescence signal, Second step 95 DEG C of 5s, 60 DEG C of 30s totally 40 circulations, collect fluorescence signal, as a result see Fig. 1.
Wherein, 1 ~ 7 curve represents rs671-WT-F, rs671-mut-F, rs671-mut-F1, rs671- respectively in Fig. 1 Mut-F2, rs671-mut-F3, rs671-mut-F4, rs671-mut-F5 PCR amplification curves, we have observed that No. 1 from Fig. 2 Wild primers 15.5 circulation produce amplified signals, 2-6 primers it is specific poor, respectively 17-19 circulate a left side Right generation non-specific amplification, same to wild primers（No. 1）Amplification efficiency difference is less than 19 circulations, and No. 7 primer meets me Requirement, 40 circulate when, still do not expand, 19 circulations differed by more than with wild primers amplification efficiency.In order to There is more preferable comparativity with mutant primer, we are with reference to the primer of No. 7 Primer redesign wild type： gggctgcaggcatacacag（SEQ No.17）.
That is the primer of final design screening：
Wild type sense primer： gggctgcaggcatacacag（SEQ No.17）
Saltant type sense primer：gggctgcaggcatacacaa（SEQ No.14）
Embodiment 3：ASP sensitivity is screened
Again with mutant primers respectively with the common anti-sense primer SEQ No.16 of ALDH2 gene rs671 pleomorphism sites Pairing, with saltant type recombinant plasmid, according to 106, 105, 104, 103, 102, 10,0 make gradient dilution, plus Taqman specificity Probe, in the enterprising line sensitivity checking of quantitative real time PCR Instrument.Mutation Idiotype primer can detect the mutant of 100 copies, Therefore this primer is exactly the optimal primer that detection ALDH2 gene rs671 pleomorphism sites are filtered out by our method, is shown in Table Shown in 3.
Embodiment 4：Prefabricated PCR of the present invention（Past-PCR）Reaction tube
According to the requirement of each two reaction tubes in mutational site, i.e. pipe detection wild type site, another pipe detection mutation Site, the primed probe of suitable concentration is coated in the milky PCR reaction tubes of 0.2ML in advance.
In order to false negative occur when preventing detection, detection house-keeping gene GAPDH is coated with advance in each reaction tube Sense primer, anti-sense primer and probe, wherein, GAPDH gene orders are as follows：
cctccgggaaactgtggcgtgatggccgcggggctctccagaacatcatccctgcctctactggcgctgccaaggct gtgggcaaggtcatccctgagctgaacgggaagctcactggcatggccttccgtgtccccactgccaacgtgtcagt ggtggacctgacctgccgtctagaaaaacctgccaaatatgatgacatcaagaaggtggtgaagcaggcgtcggagg gccccctcaagggcatcctgggctacactgagcaccaggtggtctcctctgacttcaacagcgacacccactcctcc acctttgacgctggggctggcattgccctcaacg（SEQ No.18）
Detection house-keeping gene GAPDH upstream primer sequence is：ggctgtgggcaaggtcatc（SEQ No.19）
Detection house-keeping gene GAPDH downstream primer sequence is:ctccgacgcctgcttcaccac(SEQ No.20）
Detection house-keeping gene GAPDH probe sequence is：ccttccgtgtccccactgccaacgt(SEQ No.21)
Wherein, the house-keeping gene GAPDH end of probe 5 ' HEX fluorescence labelings are detected, 3 ' ends are marked with BHQ, due to HEX with VIC belongs to same Air conduct measurement, and many instruments are often indicated using VIC, therefore is described in text with VIC.
Concrete details is shown in Table 3 in PCR reaction tubes.
The component and concentration of the prefabricated ALDH2 genes rs671 pleomorphism sites Past-PCR reaction tubes of table 3.
Because we are in advance saltant type and wild type sense primer, probe, common anti-sense primer, detection house-keeping gene GAPDH upstream and downstream primer and detection house-keeping gene GAPDH probe are coated in the differential responses pipe for the number of finishing, and are effectively kept away Exempt from the operating error of user, while substantially increased operating efficiency, greatly facilitate actual use clinically.
Embodiment 5：The checking of sample
The peripheral blood or mouth desquamated cells sample of normal population are gathered, and with the extracting genome DNA of Qiagen companies Kit, extracts genomic DNA, and concrete operation step by specification is carried out.The DNA samples prepared, through uv-spectrophotometric Meter measure concentration, it is standby to be adjusted to 100ng/ μ l by its concentration.
We use this mutant-specific primers filtered out, while are compared with wild primers, anti-in same PCR Answer on plate, each two reaction tube detects a gene loci, and one of them is mutational site, and another is wild type site.Often 10mM Tris-HCl pH8.3,50mM KCl, 0.1%Triton X-100,2.0mM are included in the individual μ l reaction volumes of reaction tube 20 MgCl2, 100ng human gene group DNAs, 100nM specificity T aqman probes, the shared specific Down Stream primers of 500nM, 500nM open countries Raw type specificity sense primer or saltant type specific forward primer, 5pm detection house-keeping genes GAPDH sense primer, 5pm inspections Survey house-keeping gene GAPDH anti-sense primer, 2.5pm detection house-keeping genes GAPDH probe, along with 1.5 unit Taq DNA gather Synthase, 200 μM of dNTPs, remaining is deionized water.
First step PCR reaction conditions are：37 DEG C of 2min, 95 DEG C of 2min pre-degenerations, then 95 DEG C of 5s, 63 DEG C of 30s, 15 Circulation, this step do not collect fluorescence；Second step PCR reaction conditions are：95 DEG C of 5s, 60 DEG C of 30s, totally 40 circulations, this step are collected glimmering Light.For convenience's sake, ALDH2 gene rs671 polymorphism normal locations are regarded as wild type by us（G sites）, and it is easy The site for causing ALDH2 enzymatic activitys to decline is then saltant type（A sites）If corresponding reaction tube has logarithm increasing in FAM passages Long amplification curve, while VIC passages have the amplification curve that logarithm increases, and are judged as corresponding homozygous genotype；Such as two pipes There is the amplification curve of logarithm growth in FAM passages, while VIC passages have the amplification curve that logarithm increases, then are heterozygous.
1st, mutation allele homozygote is carried out according to the method described above（A sites）Detection, its specific gene order are：
SEQ No.22：ggcatacactaaagtgaaaac
The FAM passage PCR amplification curve diagrams being collected into, as shown in Fig. 2 wherein, it is anti-that a curves represent detection saltant type PCR Amplification curve that should be in pipe, b curves represent the amplification curve in detection wild type PCR reaction tubes.
2nd, wild allele genic homozygote is carried out according to the method described above（G sites）Detection, its specific gene order are：
SEQ No.23：ggcatacactgaagtgaaaac
The FAM passage PCR amplification curve diagrams being collected into, as shown in figure 3, wherein, it is anti-that c curves represent detection wild type PCR Amplification curve that should be in pipe, d curves represent the amplification curve in detection saltant type PCR reaction tubes.
3rd, heterozygosis is carried out according to the method described above（AG types）Detection, its specific gene order are：
SEQ No.24：ggcatacacta/gaagtgaaaac
The FAM passage PCR amplification curve diagrams being collected into, as shown in figure 4, wherein, it is anti-that e curves represent detection wild type PCR Amplification curve that should be in pipe, f curves represent the amplification curve in detection saltant type PCR reaction tubes.
Meanwhile it is above-mentioned 3 detection case in, when VIC passage house-keeping genes GAPDH have logarithm increase amplification curve, such as Shown in Fig. 5, while FAM passages have the amplification curve that logarithm increases, then this time experimental result is effective.
Therefore, tested from above-mentioned detection, the testing result of this kit is the result of " all or none ", even tested Test sample product are mutation allele homozygote, and in two PCR reaction tubes, only saltant type PCR reaction tubes are in FAM passages and VIC Passage has the amplification curve that logarithm increases, and wild type PCR reaction tubes have no amplification curve in FAM passages；If tested test sample Product are wild allele genic homozygote, and in two PCR reaction tubes, only wild type PCR reaction tubes are in FAM passages and VIC passages There is the amplification curve that logarithm increases, and saltant type PCR reaction tubes have no amplification curve in FAM passages；It is if being detected sample Heterozygote, two PCR reaction tubes have the fluorescence signal of logarithm growth in FAM passages and VIC passages.The detection knot of the kit Fruit interpretation is simple, and reducing the testing result of conventional kit needs to carry out the process that a series of complex such as Δ Ct calculate, and reduces False determination ratio, while also effectively prevent the generation that false negative false positive phenomenon in conventional kit testing result be present.In addition originally The kit that invention provides can be used for the quantitative real time PCR Instrument of any model, and detecting instrument is simple, and cost is low, for scientific research and face Bed aldehyde dehydrogenase 2 gene rs671 pleomorphism sites parting and gene mutation analysis provide strong instrument.
Sequence table
<110>Shenyang You Jinuo bio tech ltd
<120>Detect primer, kit and its PCR method of aldehyde dehydrogenase 2 gene rs671 pleomorphism sites
<130> 2015
<160> 24
<170> PatentIn version 3.3
<210> 1
<211> 456
<212> DNA
<213>It is artificial synthesized
<400> 1
gggcaacaga gaaagattct atctcaaaaa aaaaaatttt tttttaagtt aaaaataaaa 60
taaagacttt ggggcaatac agggggtcct gggagtgtaa cccataaccc ccaagagtga 120
tttctgcaat ctcgtttcaa attacagggt caactgctat gatgtgtttg gagcccagtc 180
accctttggt ggctacaaga tgtcggggag tggccgggag ttgggcgagt acgggctgca 240
ggcatacact gaagtgaaaa ctgtgagtgt gggacctgct gggggctcag ggcctgttgg 300
ggcttgaggg tctgctggtg gctcggagcc tgctggggga ttggggtctg ttgggggctc 360
ggggcctgcc agaggttcag gacctgccgg ggactcaggg cctgctggaa gttcaggacc 420
tgctggggat cagggcctgc cagggattta gggtct 456
<210> 2
<211> 16
<212> DNA
<213>It is artificial synthesized
<400> 2
gggggtcctg ggagtg 16
<210> 3
<211> 17
<212> DNA
<213>It is artificial synthesized
<400> 3
cccaacagac cccaatc 17
<210> 4
<211> 274
<212> DNA
<213>It is artificial synthesized
<400> 4
gggggtcctg ggagtgtaac ccataacccc caagagtgat ttctgcaatc tcgtttcaaa 60
ttacagggtc aactgctatg atgtgtttgg agcccagtca ccctttggtg gctacaagat 120
gtcggggagt ggccgggagt tgggcgagta cgggctgcag gcatacactg aagtgaaaac 180
tgtgagtgtg ggacctgctg ggggctcagg gcctgttggg gcttgagggt ctgctggtgg 240
ctcggagcct gctgggggat tggggtctgt tggg 274
<210> 5
<211> 30
<212> DNA
<213>It is artificial synthesized
<400> 5
gcaggcatac actaaagtga aaactgtgag 30
<210> 6
<211> 30
<212> DNA
<213>It is artificial synthesized
<400> 6
ctcacagttt tcactttagt gtatgcctgc 30
<210> 7
<211> 274
<212> DNA
<213>It is artificial synthesized
<400> 7
gggggtcctg ggagtgtaac ccataacccc caagagtgat ttctgcaatc tcgtttcaaa 60
ttacagggtc aactgctatg atgtgtttgg agcccagtca ccctttggtg gctacaagat 120
gtcggggagt ggccgggagt tgggcgagta cgggctgcag gcatacacta aagtgaaaac 180
tgtgagtgtg ggacctgctg ggggctcagg gcctgttggg gcttgagggt ctgctggtgg 240
ctcggagcct gctgggggat tggggtctgt tggg 274
<210> 8
<211> 19
<212> DNA
<213>It is artificial synthesized
<400> 8
gggctgcagg catacagtg 19
<210> 9
<211> 19
<212> DNA
<213>It is artificial synthesized
<400> 9
gggctgcagg catacagta 19
<210> 10
<211> 18
<212> DNA
<213>It is artificial synthesized
<400> 10
ggctgcaggc atacagta 18
<210> 11
<211> 17
<212> DNA
<213>It is artificial synthesized
<400> 11
gctgcaggca tacagta 17
<210> 12
<211> 17
<212> DNA
<213>It is artificial synthesized
<400> 12
gctgcaggca tacacaa 17
<210> 13
<211> 18
<212> DNA
<213>It is artificial synthesized
<400> 13
ggctgcaggc atacacaa 18
<210> 14
<211> 19
<212> DNA
<213>It is artificial synthesized
<400> 14
gggctgcagg catacacaa 19
<210> 15
<211> 20
<212> DNA
<213>It is artificial synthesized
<400> 15
cctgttgggg cttgagggtc 20
<210> 16
<211> 17
<212> DNA
<213>It is artificial synthesized
<400> 16
cccaacagac cccaatc 17
<210> 17
<211> 19
<212> DNA
<213>It is artificial synthesized
<400> 17
gggctgcagg catacacag 19
<210> 18
<211> 342
<212> DNA
<213>It is artificial synthesized
<400> 18
cctccgggaa actgtggcgt gatggccgcg gggctctcca gaacatcatc cctgcctcta 60
ctggcgctgc caaggctgtg ggcaaggtca tccctgagct gaacgggaag ctcactggca 120
tggccttccg tgtccccact gccaacgtgt cagtggtgga cctgacctgc cgtctagaaa 180
aacctgccaa atatgatgac atcaagaagg tggtgaagca ggcgtcggag ggccccctca 240
agggcatcct gggctacact gagcaccagg tggtctcctc tgacttcaac agcgacaccc 300
actcctccac ctttgacgct ggggctggca ttgccctcaa cg 342
<210> 19
<211> 19
<212> DNA
<213>It is artificial synthesized
<400> 19
ggctgtgggc aaggtcatc 19
<210> 20
<211> 21
<212> DNA
<213>It is artificial synthesized
<400> 20
ctccgacgcc tgcttcacca c 21
<210> 21
<211> 25
<212> DNA
<213>It is artificial synthesized
<400> 21
ccttccgtgt ccccactgcc aacgt 25
<210> 22
<211> 21
<212> DNA
<213>It is artificial synthesized
<400> 22
ggcatacact aaagtgaaaa c 21
<210> 23
<211> 21
<212> DNA
<213>It is artificial synthesized
<400> 23
ggcatacact gaagtgaaaa c 21
<210> 24
<211> 22
<212> DNA
<213>It is artificial synthesized
<400> 24
ggcatacact agaagtgaaa ac 22

Claims (5)

  1. A kind of 1. kit for detecting aldehyde dehydrogenase 2 gene rs671 pleomorphism sites, it is characterised in that：The kit contains Have for detecting the wild type specific forward primer of aldehyde dehydrogenase 2 gene rs671 pleomorphism sites, mutation type specificity Swim anti-sense primer and probe that primer and wild type specific forward primer share with saltant type specific forward primer；
    And the sequence of the wild type specific forward primer is as shown in SEQ No.17, the saltant type specific forward primer Sequence as shown in SEQ No.14, the sequence of the shared anti-sense primer is as shown in SEQ No.16；
    The probe is Taqman probes, and the sequence of the probe is as shown in SEQ No.15.
  2. 2. according to the kit that aldehyde dehydrogenase 2 gene rs671 pleomorphism sites are detected described in claim 1, it is characterised in that： The kit also includes PCR reaction tubes, dNTPs and Taq enzyme mixed liquor, PCR buffer solutions, detects the upper of house-keeping gene GAPDH Swim probe, positive quality control product and the blank of primer, detection house-keeping gene GAPDH anti-sense primer and detection house-keeping gene GAPDH Control；
    The upstream primer sequence of the detection house-keeping gene GAPDH is as shown in SEQ No.19；The detection house-keeping gene GAPDH Downstream primer sequence as shown in SEQ No.20；The probe sequence of the detection house-keeping gene GAPDH is as shown in SEQ No.21.
  3. 3. according to the kit that aldehyde dehydrogenase 2 gene rs671 pleomorphism sites are detected described in claim 2, it is characterised in that： The saltant type specific forward primer, the shared anti-sense primer, the probe, the detection house-keeping gene GAPDH The probe of sense primer, the anti-sense primer of the detection house-keeping gene GAPDH and the detection house-keeping gene GAPDH is wrapped in advance By in A type PCR reaction tubes；And with the wild type specific forward primer, the shared anti-sense primer, the spy Pin, the sense primer of the detection house-keeping gene GAPDH, the anti-sense primer of the detection house-keeping gene GAPDH and the detection House-keeping gene GAPDH probe is coated in G type PCR reaction tubes in advance.
  4. 4. according to the kit that aldehyde dehydrogenase 2 gene rs671 pleomorphism sites are detected described in claim 3, it is characterised in that： Saltant type specific forward primer, the shared anti-sense primer, the probe, the detection pipe in the A types PCR reaction tubes Family gene GAPDH sense primer, the anti-sense primer of the detection house-keeping gene GAPDH and the detection house-keeping gene GAPDH Concentration and probe concentration be respectively 50nM-2 μm, 50nM-2 μm, 50nM-400nM, 1pm-20pm, 1pm-20pm, 0.05pm-5pm；With And wild type specificity sense primer, the shared anti-sense primer, the probe, the detection in the G types PCR reaction tubes House-keeping gene GAPDH sense primer, the anti-sense primer of the detection house-keeping gene GAPDH and the detection house-keeping gene GAPDH concentration and probe concentration is respectively 50nM-2 μm, 50nM-2 μm, 50nM-400nM, 1pm-20pm, 1pm-20pm, 0.05pm- 5pm。
  5. 5. according to the kit that aldehyde dehydrogenase 2 gene rs671 pleomorphism sites are detected described in claim 4, it is characterised in that： Saltant type specific forward primer, the shared anti-sense primer, the probe, the detection pipe in the A types PCR reaction tubes Family gene GAPDH sense primer, the anti-sense primer of the detection house-keeping gene GAPDH and the detection house-keeping gene GAPDH Concentration and probe concentration be respectively 500nM, 500nM, 100nM, 5pm, 5pm, 2.5pm；And wild type in the G types PCR reaction tubes Specific forward primer, the shared anti-sense primer, the probe, the sense primer of the detection house-keeping gene GAPDH, institute The concentration and probe concentration of the anti-sense primer and the detection house-keeping gene GAPDH of stating detection house-keeping gene GAPDH be respectively 500nM, 500nM、100nM、5pm、5pm、2.5pm。
CN201510290613.8A 2015-05-29 2015-05-29 Detect primer, kit and its PCR method of aldehyde dehydrogenase 2 gene rs671 pleomorphism sites Active CN104894256B (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
CN201510290613.8A CN104894256B (en) 2015-05-29 2015-05-29 Detect primer, kit and its PCR method of aldehyde dehydrogenase 2 gene rs671 pleomorphism sites

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CN201510290613.8A CN104894256B (en) 2015-05-29 2015-05-29 Detect primer, kit and its PCR method of aldehyde dehydrogenase 2 gene rs671 pleomorphism sites

Publications (2)

Publication Number Publication Date
CN104894256A CN104894256A (en) 2015-09-09
CN104894256B true CN104894256B (en) 2018-01-26

Family

ID=54027207

Family Applications (1)

Application Number Title Priority Date Filing Date
CN201510290613.8A Active CN104894256B (en) 2015-05-29 2015-05-29 Detect primer, kit and its PCR method of aldehyde dehydrogenase 2 gene rs671 pleomorphism sites

Country Status (1)

Country Link
CN (1) CN104894256B (en)

Families Citing this family (7)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN106834518A (en) * 2017-03-27 2017-06-13 杭州迪安医学检验中心有限公司 Primer and its application of a kind of detection ADH1B genes and ALDH2 gene pleiomorphisms
CN107227372A (en) * 2017-07-25 2017-10-03 重庆京因生物科技有限责任公司 Primer, molecular beacon, kit and its detection method of ALDH2 gene pleiomorphism quick detections
CN108315408A (en) * 2018-04-26 2018-07-24 宁波美丽人生医学检验所有限公司 Primer composition and kit for detecting nitroglycerin pharmaceutical relevant gene
CN109022429A (en) * 2018-07-27 2018-12-18 山东德诺生物科技有限公司 For detecting the primed probe group and its application of rs671
CN108977530A (en) * 2018-08-17 2018-12-11 青岛大学 For detecting primer sets, reagent, kit and the detection method and application of aldehyde dehydrogenase 2 Genotyping
CN110283900A (en) * 2019-07-12 2019-09-27 西南医科大学附属医院 It is a kind of detect ALDH2 gene rs671 polymorphism primer and its application
CN116676383A (en) * 2023-07-28 2023-09-01 北京旌准医疗科技有限公司 Artificial simulated nucleic acid molecular beacon for detecting polymorphism of rs671 locus of ALDH2 gene and application thereof

Family Cites Families (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN103361432A (en) * 2013-07-26 2013-10-23 天津市秀鹏生物技术开发有限公司 Primer group and kit for detecting genetic typing of human aldehyde dehydrogenase 2 (ALDH2)

Also Published As

Publication number Publication date
CN104894256A (en) 2015-09-09

Similar Documents

Publication Publication Date Title
CN104862402B (en) Detect primer, kit and its PCR method of ApoE gene pleiomorphisms
CN104894256B (en) Detect primer, kit and its PCR method of aldehyde dehydrogenase 2 gene rs671 pleomorphism sites
CN104962609B (en) Detect primer, kit and its PCR method of CYP2C9 and VKORC1 gene pleiomorphisms
CN107488711B (en) Method for detecting genotype of point mutation and kit thereof
CN104846106B (en) Detect primer, kit and its PCR method in BRAF gene V600E mutational sites
CN104862401B (en) Detect primer, kit and its PCR method of KRAS gene hot mutant sites
CN107058538B (en) Primer composition, kit composed of primer composition and application of kit
CN104789672B (en) A kind of bar code magnetic bead liquid-phase chip detection kit of thalassemia gene
CN101343658A (en) Gene chip for detection of hyperpiesis individual medicine correlated gene mutation and uses thereof
CN111235272B (en) Composition for once detecting multiple gene mutation of lung cancer and application thereof
Etlik et al. Development and validation of a cost-effective in-house method, tetra-primer ARMS PCR assay, in genotyping of seven clinically important point mutations
CN104830992B (en) Detect primer, kit and its PCR method of methylenetetrahydrofolate reductase C677T polymorphic sites
CN104830991B (en) Detect primer, kit and its PCR method of PDGFRA gene D842V polymorphic sites
CA2598455A1 (en) Multiplex assays for inferring ancestry
CN104818340B (en) Detect primer, kit and its PCR method of JAK2 gene V617F loci polymorphisms
CN104450869B (en) Dideoxynucleoside modified primer method, reaction system and application thereof in mutation detection
CN104846108B (en) Detect primer, kit and its PCR method in C-KIT gene D816V mutational sites
CN110846408A (en) Primer combination for detecting TTN gene mutation and application thereof
US9305137B1 (en) Methods of identifying the genetic basis of a disease by a combinatorial genomics approach, biological pathway approach, and sequential approach
WO2021239081A1 (en) Reagent capable of being used for detecting npc1l1 mutant genotyping, kit, usage method therfor and application thereof
CN109234370A (en) MUT gene mutation detection kit
CN104846107B (en) Detect primer, kit and its PCR method of RET gene M 918T site mutations
JP2014535050A (en) Method for identifying or detecting genomic rearrangements in biological samples
CN114790484B (en) MNP (MNP) marking site of xanthomonas oryzae, primer composition, kit and application of MNP marking site
Bigler et al. Determination of human NAT2 acetylator genotype by oligonucleotide ligation assay

Legal Events

Date Code Title Description
C06 Publication
PB01 Publication
C10 Entry into substantive examination
SE01 Entry into force of request for substantive examination
GR01 Patent grant
GR01 Patent grant