CN109112189A - The a variety of hot spot mutation kits of 19 exon of Multiple detection EGFR gene - Google Patents
The a variety of hot spot mutation kits of 19 exon of Multiple detection EGFR gene Download PDFInfo
- Publication number
- CN109112189A CN109112189A CN201811055079.2A CN201811055079A CN109112189A CN 109112189 A CN109112189 A CN 109112189A CN 201811055079 A CN201811055079 A CN 201811055079A CN 109112189 A CN109112189 A CN 109112189A
- Authority
- CN
- China
- Prior art keywords
- seq
- probe
- exon
- variety
- hot spot
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6844—Nucleic acid amplification reactions
- C12Q1/6858—Allele-specific amplification
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Organic Chemistry (AREA)
- Engineering & Computer Science (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Health & Medical Sciences (AREA)
- Biophysics (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Immunology (AREA)
- Microbiology (AREA)
- Molecular Biology (AREA)
- Analytical Chemistry (AREA)
- Physics & Mathematics (AREA)
- Biotechnology (AREA)
- Biochemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
This application discloses a kind of a variety of hot spot mutation kits of 19 exon of Multiple detection EGFR gene, it includes the primer and probe for a variety of hot spot mutations on 19 exon of EGFR gene, the probe is SEQ ID NO.3 and selected from least one of SEQ ID NO.4-SEQ ID NO.23, or is the reverse complementary sequence of above-mentioned probe sequence；The primer includes interior label primer and mutant primer to be checked, and interior label primer is identical as mutant primer to be checked, and internal standard probe design is in the same region to be checked of EGFR gene wild-type sequence.Primer and assist probes are designed as sharing sequence by the present invention, the difficulty of 19del detection architecture design can not only be reduced, late phase reaction system optimization and the interactional defect of primed probe can also be reduced, increases the practicability of this method, and reduce detection reagent cost.
Description
Technical field
The invention belongs to molecular biotechnology and genetic test field, it is specifically related to a kind of highly sensitive more of novel single tube
The kit in many types of other mutational site of 19 exon of re-detection EGFR gene.
Background technique
EGFR is a kind of transmembrane tyrosine kinase receptor, the activation of this receptor kinase domain and cancer cell multiplication, transfer and apoptosis
Equal multi-signals conduction path is related.Patients with lung adenocarcinoma EGFR gene sensitizing mutation asian ancestry crowd's positive rate is higher than Caucasian
Group.EGFR mutation occurs mainly on the first four exon in the region tyrosine kinase intracellular (TK) (18~21), has now been found that
TK region mutagenesis have more than 30 kinds.Deletion mutation occurs mainly on exons 19, most commonly del E746-A750, and
Mutation type is more, and common deletion mutation reaches 19 kinds or so, therefore detection difficulty is very big, is presently mainly based on ARMS-PCR
Or the detection method of the foundation such as digitlization PCR, such method entirely designs and optimization process is cumbersome, and it is with high costs, need one kind
It more simply and effectively can be realized many types of other mutational site detection mode arranged side by side of 19 exon of EGFR gene.
Summary of the invention
Based on this, an object of the present invention is to provide Multiple detection EGFR that is a kind of simple, flexible, sensitive and can quantifying
The a variety of hot spot mutation kits of 19 exon of gene solve a variety of hot spot mutation single tube Multiple detections of 19 exon of EGFR gene
Problem.
Realize that the technical solution of above-mentioned purpose is as follows.
A kind of a variety of hot spot mutation kits of 19 exon of Multiple detection EGFR gene, include for EGFR gene 19
Probe described in the primer and probe of a variety of hot spot mutations is SEQ ID NO.3 and is selected from SEQ ID NO.4-SEQ on exon
At least one of ID NO.23, or primer described in reverse complementary sequence for above-mentioned probe sequence include interior label primer with it is to be checked
Mutant primer, interior label primer is identical as mutant primer to be checked, and internal standard probe design is in the same of EGFR gene wild-type sequence
Region to be checked.
The primer is SEQ ID NO.1 and SEQ ID NO.2 in one of the embodiments,.
Any one or a few probe in probe SEQ ID NO.4-SEQ ID NO.23 can respectively with this kit
In primer SEQ ID NO.1 and SEQ ID NO.2 and probe SEQ ID NO.3 detect corresponding 19 exon of EGFR gene
On hot spot mutation.
It is a further object of the present invention to provide a kind of probes of a variety of hot spots of 19 exon of Multiple detection EGFR gene.
A kind of probe of a variety of hot spots of 19 exon of Multiple detection EGFR gene, the probe be SEQ ID NO.3 and
It selected from least one of SEQ ID NO.4-SEQ ID NO.23, or is the reverse complementary sequence of above-mentioned probe sequence.
The present invention has given full play to PCR amplification and nucleic acid intrusion reaction technology advantage, and has further developed multiple
Nucleic acid invades reaction technology, and concrete principle is: by designing one couple of PCR primers to a variety of hot spot mutations of 19 exon of EGFR gene
Target area is expanded, to expand target region to be checked.The characteristics of relatively being concentrated for a variety of hot spot mutations of 19 exons, needle
To one shared assist probes of design of property, and the detection probe for each hot spot mutation is separately designed, and mark fluorescent
Group and quenching group.In reaction, assist probes, detection probe can hybridize with amplification target template annealing, form a list
Base overlapping intrusion structure, which can be identified by Afu enzyme spcificity, to cut detection probe first alkali complementary with template
The chemical bond of base generates signaling molecule.Since the detection probe of design and the Tm value of template bound fraction are close to reaction temperature, newly
Complete detection probe the cutting of a new round can be formed, to realize the amplification of signaling molecule, so again with template annealing
Realize the detection to object.
The invention has the following advantages:
Primer and assist probes are designed as sharing sequence by the present invention, can not only reduce the design of 19del detection architecture
Difficulty can also reduce late phase reaction system optimization and the interactional defect of primed probe, increase the practicability of this method, and
Reduce detection reagent cost.
Kit of the present invention is realized aobvious outside EGFR gene 19 by combining general primer probe and specific probe
The flexible detection of a variety of hot spot mutations on son both can realize multiple 19 exon of single tube EGFR gene by multiprobe monomer
The detection of upper a variety of hot spot mutations, can also be combined or the corresponding EGFR base of combine detection according to actual needs by Single probe
Because of a variety of hot spot mutations on 19 exons.
Kit of the present invention, which can also be realized, carries out definite value to clinical sample gene mutation abundance, different by setting
The reference material for being mutated percentage makes standard curve, demarcates the mutation abundance contained in sample by standard curve.
Pattern detection can be completed by means of conventional fluorescent PCR equipment in kit of the present invention, and detection sensitivity is remote
Higher than current conventional method, it can be achieved that down in 0.5ng sample size at least 10% even lower gene mutation target molecules inspection
It surveys, while increasing sample size and can detecte gene mutation template down to 0.02% to 50ng or more, this is conventional fluorescent PCR inspection
Survey method is incomparable.
The short time can be realized using a variety of hot spot mutation kits of 19 exon of Multiple detection EGFR gene in the present invention
Highly sensitive stopped pipe detection in Gene Mutation, additionally it is possible to effectively avoid the cross contamination of amplified production.
Detailed description of the invention
Following drawings is not used in for illustrating specific embodiments of the present invention and defines this hair that claim is defined
Bright range.
Fig. 1 is the testing principle of a variety of hot spot mutation kits of 19 exon of Multiple detection EGFR gene in embodiment 1.
Fig. 2 is the sensitivity of a variety of hot spot mutation kits of 19 exon of Multiple detection EGFR gene in embodiment 2.
Fig. 3-Fig. 4 is different groups of a variety of hot spot mutation kits of 19 exon of Multiple detection EGFR gene in embodiment 3
Close probe system verification result.
Fig. 5 is the clinical detection knot of a variety of hot spot mutation kits of 19 exon of Multiple detection EGFR gene in embodiment 4
Fruit.
Fig. 6 is the quantitative detection knot of a variety of hot spot mutation kits of 19 exon of Multiple detection EGFR gene in embodiment 5
Fruit.
Fig. 7 is the testing result of Quantabio company digitlization PCR in embodiment 5.
Specific embodiment
Unless otherwise defined, all technical and scientific terms used in the present invention and belong to technical field of the invention
The normally understood meaning of technical staff it is identical.Term used in the description of the invention is intended merely to describe specific reality
The purpose for applying example is not used in the limitation present invention.Term "and/or" used in the present invention includes one or more relevant institutes
Any and all combinations of list of items.
In the following examples, the experimental methods for specific conditions are not specified, usually according to normal condition, such as Sambrook etc.
People, molecular cloning: institute in laboratory manual (New York:Cold Spring Harbor Laboratory Press, 1989)
The condition stated, or according to the normal condition proposed by manufacturer.Used various common chemical reagent, are commercially available in embodiment
Product.
To facilitate the understanding of the present invention, a more comprehensive description of the invention is given in the following sections with reference to the relevant attached drawings.In attached drawing
Give presently preferred embodiments of the present invention.But the invention can be realized in many different forms, however it is not limited to this paper institute
The embodiment of description.On the contrary, purpose of providing these embodiments is keeps the understanding to the disclosure more thorough
Comprehensively.
One embodiment of the invention provides a kind of a variety of hot spot mutation kits of 19 exon of Multiple detection EGFR gene, packet
Include the primer and probe for a variety of hot spot mutations on 19 exon of EGFR gene, the probe be SEQ ID NO.3 and
Selected from least one of SEQ ID NO.4-SEQ ID NO.23, wherein SEQ ID NO.3 can respectively with SEQ ID
NO.4-SEQ ID NO.23 forms intrusion structure and constitutes the probe assembly of nucleic acid intrusion reaction；The primer includes interior index
Object and mutant primer to be checked, interior label primer is identical as mutant primer to be checked, and internal standard probe design is in EGFR gene wild type sequence
The same region to be checked of column.
The probe may be the reverse complementary sequence of SEQ ID NO.3 and be selected from one of the embodiments,
The reverse complementary sequence of at least one of SEQ ID NO.4-SEQ ID NO.23.
The primer is SEQ ID NO.1 and SEQ ID NO.2 in one of the embodiments,；The probe is SEQ
It is one or two kinds of or three kinds or four kinds and any group more kinds of in ID NO.3 and SEQ ID NO.4-SEQ ID NO.23
It closes.A kind of detection for sporting site can be thus achieved, the detection arranged side by side in a variety of sites also may be implemented.
In a specific example, label has and quenches on the probe SEQ ID NO.4-SEQ ID NO.23
Go out group, and further, the fluorophor label has been held in the 6th base in 5 ' ends, the quenching group label 5 '.
Kit of the present invention, respectively for mutation type design different in 19 exon sequences in EGFR gene
Probe, at the same according to 19del mutated site concentrate the characteristics of, by primer and assist probes be designed as share sequence, so into one
Step has developed Multiple detection technology, can not only reduce the difficulty of 19del detection architecture design, can also reduce late phase reaction body
System's optimization and the interactional defect of primed probe, increase the practicability of this method.In addition, the kit can also be realized pair
Clinical sample gene mutation abundance carries out definite value, and when definite value is arranged the reference materials production standard curves of different mutation percentages, leads to
Cross the mutation abundance contained in standard curve calibration sample.It can also flexibly detect, for example need simultaneously for this kind design
When not detected to 19del gene mutation typing, it is only necessary to using general primer probe and the probe of specific mutation type as one kind
Combination, without carrying out suboptimization and design again, this embodies the advantage of this method, is 19 exons in EGFR gene
Sequence related locus abrupt climatic change provides a kind of flexible selection.
The testing principle of a variety of hot spot mutation kits of 1 Multiple detection EGFR gene of embodiment, 19 exon
The a variety of hot spot mutation target areas of 19 exon of EGFR gene are expanded by designing one couple of PCR primers, are used
It is specific as shown in Figure 1 to expand target region to be checked.The characteristics of relatively being concentrated for a variety of hot spot mutations of 19 exons, targetedly
Design a shared assist probes, and separately design the detection probe for each hot spot mutation, and mark fluorescent group and
Quenching group.In reaction, assist probes, detection probe can hybridize with amplification target template annealing, form a single base weight
Folded intrusion structure, which can be identified by Afu enzyme spcificity, to cut detection probe first base complementary with template
Chemical bond generates signaling molecule.Since the detection probe of design and the Tm value of template bound fraction are close to reaction temperature, new is complete
Whole detection probe can form the cutting of a new round again with template annealing, to realize the amplification of signaling molecule, so realize
Detection to object.
By taking hot spot mutation in table 1 as an example, a variety of hot spot mutation kits of 19 exon of Multiple detection EGFR gene, packet
Containing 2 primers, 21 probes, reaction solution, amplification enzyme, restriction endonucleases etc., the restriction endonuclease is Afu enzyme, and the amplification enzyme is Taq
Archaeal dna polymerase.
The common 19 exon hot spot mutation type of EGFR gene of table 1.
Primer, probe sequence such as primer 1- primer 2, probe 1- probe 21, or be the complementary series of above-mentioned sequence: 5 ' ends
It is held to 3 ':
Primer 1:TGTCATAGGGACTCTGGATCCCAGA, SEQ ID NO.1；
Primer 2: GCAGAAACTCACATCGAGGATTTCCTTGT, SEQ ID NO.2；
Probe 1:GAAAGTTAAAATTCCCGTCGCTATCAT, SEQ ID NO.3；
Probe 2:VIC-CG AGGA (BHQ) ATTAAGAGTAGCAACA, SEQ ID NO.4；
Probe 3:FAM-AG AAAC (BHQ) ATCTCCGTAAGCC, SEQ ID NO.5；
Probe 4:FAM-AG AGAG (BHQ) ACATCTCCGTAAGC, SEQ ID NO.6；
Probe 5:FAM-AG AGAG (BHQ) GAATCGTAAGCCAAC, SEQ ID NO.7；
Probe 6:FAM-AG AGAA (BHQ) ATATCTCCGTAAGCCAA, SEQ ID NO.8；
Probe 7:FAM-AG AGAG (BHQ) TCTCCGTAAGCCA, SEQ ID NO.9；
Probe 8:FAM-AG AGAG (BHQ) GCATCTCCGTAAG, SEQ ID NO.10；
Probe 9:FAM-AG AGAG (BHQ) GCTCCGTAAGCC, SEQ ID NO.11；
Probe 10:FAM-AG AGAG (BHQ) GTTCCGTAAGCCA, SEQ ID NO.12；
Probe 11:FAM-AG AGAG (BHQ) GATCCGTAAGCCA, SEQ ID NO.13；
Probe 12:FAM-AG AGAG (BHQ) GAGCCTACATCTCC, SEQ ID NO.14；
Probe 13:FAM-AG AGAG (BHQ) GAAGCTACATCTCC, SEQ ID NO.15；
Probe 14:FAM-AG AGAG (BHQ) GAATCTCCGTAAGC, SEQ ID NO.16；
Probe 15:FAM-AG AGAG (BHQ) GAACCGTAAGCCA, SEQ ID NO.17；
Probe 16:FAM-AG AGAG (BHQ) GAACCTACATCTCC, SEQ ID NO.18；
Probe 17:FAM-AG AGAG (BHQ) GAACAGTAAGCCAAC, SEQ ID NO.19；
Probe 18:FAM-AG AGAG (BHQ) GAATCTCCGTAAGC, SEQ ID NO.20；
Probe 19:FAM-AG AGAG (BHQ) GAGCAATCTCCGT, SEQ ID NO.21；
Probe 20:FAM-AG AGAG (BHQ) GAATCATCTCCGTAAG, SEQ ID NO.22；
Probe 21:FAM-AG AGAG (BHQ) GAACCATCTCCGTAAG, SEQ ID NO.23.
The sensitivity of a variety of hot spot mutation kits of 2 Multiple detection EGFR gene of embodiment, 19 exon
The present embodiment has detected not using a variety of hot spot mutation kits of 19 exon of Multiple detection EGFR gene
With 19 exon hot spot mutation DNA profiling of concentration and the EGFR gene of gene mutation percentage, stated for verifying the present invention
The sensitivity of kit, with detected hot spot mutation EX19-mutant-1 (mutation type E746_A750del, 2235_
It is verified for 2249del15).
Reaction condition:
40 μ L amplification systems include: 4 μ L 10 × buffer, 200-500 μm of ol/L dNTP, 200-500nmol/L PCR
Upstream and downstream primer (SEQ ID NO.1 to SEQ ID NO.2), 200-500nmol/L probe (SEQ ID NO.3 to SEQ ID
NO.23), 2U Taq archaeal dna polymerase, 42U Afu enzyme and template DNA.By taking hot spot mutation EX19-mutant-1 as an example, it is added
Template be that the kit reference material of concentration is determined by ultraviolet specrophotometer, mutation percentage respectively by determine concentration pair
Mutant plasmids and human gene group DNA is answered to mix referring to copy number ratio；The genomic DNA matrix of addition is respectively as follows:
200ng, 50ng, 10ng, 2.5ng, 0.5ng, mutated gene percentage (mutant DNA and wild type DNA ratio) are respectively
50%, 10%, 0.2%, 0.05%, 0.02% and 0%, add water to be supplemented to 40 μ L.Amplified reaction program: 95 DEG C, 3min；95
DEG C 10s, 70 DEG C, 20s, 10 circulations of pre- amplification；95 DEG C of 10s, expand 30 circulations, each follow by 63 DEG C, 40s, 70 DEG C, 20s
Ring terminates to read first order fluorescence signal.
As a result shown in Figure 2, as the result is shown under not same amount genome matrix, 19 exon of Multiple detection EGFR gene
A variety of hot spot mutation kit minimum gene mutation percentages that can be detected difference is minimum to examine in 50-250ng
Survey the gene mutation down to 0.02%；When down to 2.5ng, the gene mutation down to 0.2% can be detected；When down to 0.5ng,
The gene mutation down to 10% can be detected, but signal still can achieve bracket signal intensity at this time.Show the examination of the application
Agent box has very high detection sensitivity.
The various combination probe system of a variety of hot spot mutation kits of 3 Multiple detection EGFR gene of embodiment, 19 exon is tested
Demonstrate,prove result
The present embodiment is that the verifying a variety of hot spot mutation kits of 19 exon of Multiple detection EGFR gene can be with flexible combination
Specific 19 exon of EGFR gene is detected, is combined for hot mutant site shown in the table 2 respectively, sixfold system is verified
Under the conditions of as a result, separately verify simultaneously substance detect with the detection accuracy of determination kit of the present invention.
Reaction condition:
40 μ L amplification systems include: 4 μ L 10 × buffer, 200-500 μm of ol/L dNTP, 200-500nmol/L PCR
Upstream and downstream primer (SEQ ID NO.1 to SEQ ID NO.2), 200-500nmol/L probe (SEQ ID NO.3 and SEQ ID
NO.4), 200-500nmol/L probe (SEQ ID NO.5 to SEQ ID NO.10, or be added one by one respectively), 5U Taq DNA
Polymerase, 42U Afu enzyme and template DNA.For detecting sixfold hot mutant site shown in table 2, the template of addition is warp
The kit reference material that ultraviolet specrophotometer determines concentration is crossed, mutation percentage is respectively by the correspondence saltant type matter of determining concentration
Grain and human gene group DNA mix referring to copy number ratio；The genomic DNA matrix of addition is 2.5ng, gene mutation
Percentage (mutant DNA and wild type DNA ratio) is respectively 0.2% and 0%, and water is added to be supplemented to 40 μ L.Amplified reaction program:
95 DEG C, 3min；95 DEG C of 10s, 70 DEG C, 20s, 10 circulations of pre- amplification；95 DEG C of 10s, expand 30 by 63 DEG C, 40s, 70 DEG C, 20s
Circulation, each circulation terminate to read first order fluorescence signal.
2. example combinations of table detect 19 exon hot spot mutation type site of EGFR gene
| Site title | Mutation | Base variation | Exon |
| EX19-mutant-1 | E746_A750del(1) | 2235_2249del15 | 19 |
| EX19-mutant-2 | E746_A750del(2) | 2236_2250del15 | 19 |
| EX19-mutant-3 | L747_P753>S | 2240_2257del18 | 19 |
| EX19-mutant-4 | E746_T751>I | 2235_2252>AAT(complex) | 19 |
| EX19-mutant-5 | E746_T751del | 2236_2253del18 | 19 |
| EX19-mutant-6 | E746_T751>A | 2237_2251del15 | 19 |
As a result it is shown in Fig. 3 and Fig. 4, when not changing the combination sixfold detection of system other conditions, result and six kinds of lists
Weight system testing result is consistent, can detect 0.2% gene mutation percentage in the case where genomic DNA matrix is 2.5ng.
The clinical detection result of a variety of hot spot mutation kits of 4 Multiple detection EGFR gene of embodiment, 19 exon
The present embodiment is that a variety of hot spot mutation kits of 19 exon of Multiple detection EGFR gene detect outside 4 patients with lung cancer
All blood clinical sample DNA (the EGFR genetic mutation result of its sample confirms through clinical detection reagent), to determine reagent of the present invention
Box can complete pattern detection.
Reaction condition:
40 μ L amplification systems include: 4 μ L 10 × buffer, 200-500 μm of ol/L dNTP, 200-500nmol/L PCR
Upstream and downstream primer (SEQ ID NO.1 to SEQ ID NO.2), 200-500nmol/L probe (SEQ ID NO.1 to SEQ ID
NO.23), the genomic DNA that corresponding clinical sample extracts is added in 5U Taq archaeal dna polymerase, 42U Afu enzyme and template DNA,
And water is added to be supplemented to 40 μ L.Amplified reaction program: 95 DEG C, 3min；95 DEG C of 10s, 70 DEG C, 20s, 10 circulations of pre- amplification；95℃
10s, expands 30 circulations by 63 DEG C, 40s, 70 DEG C, 20s, and each circulation terminates to read first order fluorescence signal.
According to Fig. 5 as a result, wild type (VIC) signal is internal standard signal, indicate whether entire reaction process is normal；Saltant type
(FAM) signal is jump signal, whether contains mutagenesis template in Indicator Reaction template.As a result the wild type of middle sample 1- sample 4
Signal is normal, illustrates that detection process is effective, and mutant signal sample 2- sample 4 lifts, and 1 no signal of sample is lifted, and is said
3 positives (sample 2, sample 3, sample 4) in bright 4 pattern detection results, 1 feminine gender (sample 1), this result and clinical inspection
Survey result is consistent, this illustrates that kit of the present invention can be used in the accurate detection of clinical sample DNA.
The quantitative performance of a variety of hot spot mutation kits of 5 Multiple detection EGFR gene of embodiment, 19 exon
The present embodiment is to be tested using a variety of hot spot mutation kit detections of 19 exon of Multiple detection EGFR gene
The clinical sample genomic DNA of card, and percentage (mutant DNA and wild type DNA ratio) gradient is mutated using different genes
Qualitative reference product do standard curve its testing result quantified, to confirm the quantitative detection of kit of the present invention
Ability.
Reaction condition:
40 μ L amplification systems include: 4 μ L 10 × buffer, 200-500 μm of ol/L dNTP, 200-500nmol/L PCR
Upstream and downstream primer (SEQ ID NO.1 to SEQ ID NO.2), 200-500nmol/L probe (SEQ ID NO.1 to SEQ ID
NO.23), 5U Taq archaeal dna polymerase, 42U Afu enzyme and template DNA, are added clinical sample genomic DNA and one group is quantitatively joined
It examines product (respectively 5%, 1%, 0.2%, 0.04%), and water is added to be supplemented to 40 μ L.Amplified reaction program: 95 DEG C, 3min；95℃
10s, 70 DEG C, 20s, 10 circulations of pre- amplification；95 DEG C of 10s, expand 30 circulations, each circulation knot by 63 DEG C, 40s, 70 DEG C, 20s
Beam reads first order fluorescence signal.
Digitize PCR experiment system: 20 μ L amplification systems include: 2 μ L 10 × buffer, 200-500 μm of ol/L dNTP,
200-500nmol/L PCR upstream and downstream primer (upstream primer: CAG AAG GTG AGA AAG TTA A；Downstream primer: AGA
GCC ATG GAC CCC CAC ACA), 200-500nmol/L probe (wild probe: CY5-CAA GGA ATT AAG AGA
AGC AAC AT-BHQ and total probe VIC-AAA GCC AAC AAG GAA ATC-BHQ), 10U thermal starting archaeal dna polymerase and 2
μ L sample, sample are clinical sample DNA to be detected.The digitlization PCR detecting instrument used is STILLA company of France
Naica Crystal DigitalTMPCR System, reagent are the Perfecta Multiplex of Quantabio company exploitation
qScript ToughMix.Amplified reaction program: 95 DEG C, 10min；95 DEG C of 20 s, expands 45 circulations by 60 DEG C, 40s, reaction
Terminate post analysis result.According to as a result, using the definite value reference material result such as table 3 and figure using detection kit of the present invention detection
It shown in 6, is analyzed by calculating, the mutant proportion definite value result of sample DNA to be detected is 0.11%；Meanwhile using STILLA public affairs
The digitlization PCR testing result of department is 0.18%, as a result as shown in fig. 7, this display this method may be implemented to gene in sample
It is mutated the accurate definite value of percentage.
3 reference material definite value pattern detection result of table
Each technical characteristic of embodiment described above can be combined arbitrarily, for simplicity of description, not to above-mentioned reality
It applies all possible combination of each technical characteristic in example to be all described, as long as however, the combination of these technical characteristics is not deposited
In contradiction, all should be considered as described in this specification.
The embodiments described above only express several embodiments of the present invention, and the description thereof is more specific and detailed, but simultaneously
It cannot therefore be construed as limiting the scope of the patent.It should be pointed out that coming for those of ordinary skill in the art
It says, without departing from the inventive concept of the premise, various modifications and improvements can be made, these belong to protection of the invention
Range.Therefore, the scope of protection of the patent of the invention shall be subject to the appended claims.
Sequence table
<110>Guangzhou Bao Chuan Bioisystech Co., Ltd
<120>a variety of hot spot mutation kits of 19 exon of Multiple detection EGFR gene
<160> 23
<170> SIPOSequenceListing 1.0
<210> 1
<211> 25
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 1
tgtcataggg actctggatc ccaga 25
<210> 2
<211> 29
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 2
gcagaaactc acatcgagga tttccttgt 29
<210> 3
<211> 27
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 3
gaaagttaaa attcccgtcg ctatcat 27
<210> 4
<211> 22
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 4
cgaggaatta agagtagcaa ca 22
<210> 5
<211> 19
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 5
agaaacatct ccgtaagcc 19
<210> 6
<211> 20
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 6
agagagacat ctccgtaagc 20
<210> 7
<211> 21
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 7
agagaggaat cgtaagccaa c 21
<210> 8
<211> 23
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 8
agagaaatat ctccgtaagc caa 23
<210> 9
<211> 19
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 9
agagagtctc cgtaagcca 19
<210> 10
<211> 19
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 10
agagaggcat ctccgtaag 19
<210> 11
<211> 18
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 11
agagaggctc cgtaagcc 18
<210> 12
<211> 19
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 12
agagaggttc cgtaagcca 19
<210> 13
<211> 19
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 13
agagaggatc cgtaagcca 19
<210> 14
<211> 20
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 14
agagaggagc ctacatctcc 20
<210> 15
<211> 20
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 15
agagaggaag ctacatctcc 20
<210> 16
<211> 20
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 16
agagaggaat ctccgtaagc 20
<210> 17
<211> 19
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 17
agagaggaac cgtaagcca 19
<210> 18
<211> 20
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 18
agagaggaac ctacatctcc 20
<210> 19
<211> 21
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 19
agagaggaac agtaagccaa c 21
<210> 20
<211> 20
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 20
agagaggaat ctccgtaagc 20
<210> 21
<211> 19
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 21
agagaggagc aatctccgt 19
<210> 22
<211> 22
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 22
agagaggaat catctccgta ag 22
<210> 23
<211> 22
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 23
agagaggaac catctccgta ag 22
Claims (10)
1. a kind of a variety of hot spot mutation kits of 19 exon of Multiple detection EGFR gene, which is characterized in that include to be directed to
The primer and probe of a variety of hot spot mutations on 19 exon of EGFR gene, the probe are SEQ ID NO.3 and are selected from SEQ
At least one of ID NO.4-SEQ ID NO.23, or be the reverse complementary sequence of above-mentioned probe sequence；
The primer includes interior label primer and mutant primer to be checked, and interior label primer is identical as mutant primer to be checked, and internal standard probe
Design is in the same region to be checked of EGFR gene wild-type sequence.
2. a variety of hot spot mutation kits of 19 exon of Multiple detection EGFR gene according to claim 1, feature exist
In the primer is SEQ ID NO.1 and SEQ ID NO.2.
3. a variety of hot spot mutation kits of 19 exon of Multiple detection EGFR gene according to claim 1, feature exist
In the probe is SEQ ID NO.3 and selected from least one of SEQ ID NO.4-SEQ ID NO.23.
4. a variety of hot spot mutation kits of 19 exon of Multiple detection EGFR gene according to claim 3, feature exist
In the probe is SEQ ID NO.3 and SEQ ID NO.4-SEQ ID NO.23.
5. a variety of hot spot mutation kits of 19 exon of Multiple detection EGFR gene according to claim 1-4,
It is characterized in that, label has and quenching group on the probe SEQ ID NO.4-SEQ ID NO.23.
6. a variety of hot spot mutation kits of 19 exon of Multiple detection EGFR gene according to claim 5, feature exist
In the fluorophor label has been held in the 6th base in 5 ' ends, the quenching group label 5 '.
7. a variety of hot spot mutation kits of 19 exon of Multiple detection EGFR gene according to claim 1-4,
It is characterized in that, further including having reaction buffer, amplification enzyme, restriction endonuclease and dNTPs.
8. a kind of probe of a variety of hot spot mutations of 19 exon of Multiple detection EGFR gene, which is characterized in that the probe is SEQ
ID NO.3 and at least one of selected from SEQ ID NO.4-SEQ ID NO.23, or be the reverse mutual of above-mentioned probe sequence
Complementary series.
9. the probe of a variety of hot spot mutations of 19 exon of Multiple detection EGFR gene according to claim 8, feature exist
In the probe is SEQ ID NO.3 and selected from least one of SEQ ID NO.4-SEQ ID NO.23.
10. the probe of a variety of hot spot mutations of 19 exon of Multiple detection EGFR gene according to claim 9, feature exist
In the probe is SEQ ID NO.3 and SEQ ID NO.4-SEQ ID NO.23.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201811055079.2A CN109112189A (en) | 2018-09-11 | 2018-09-11 | The a variety of hot spot mutation kits of 19 exon of Multiple detection EGFR gene |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201811055079.2A CN109112189A (en) | 2018-09-11 | 2018-09-11 | The a variety of hot spot mutation kits of 19 exon of Multiple detection EGFR gene |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN109112189A true CN109112189A (en) | 2019-01-01 |
Family
ID=64859069
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201811055079.2A Pending CN109112189A (en) | 2018-09-11 | 2018-09-11 | The a variety of hot spot mutation kits of 19 exon of Multiple detection EGFR gene |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN109112189A (en) |
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN110835644A (en) * | 2019-12-16 | 2020-02-25 | 广州市宝创生物技术有限公司 | K-ras gene mutation site detection kit |
| CN113088573A (en) * | 2021-04-13 | 2021-07-09 | 人和未来生物科技（长沙）有限公司 | Reagent for detecting mutation of EGFR gene L858R and Del E746-A750 and application thereof |
Citations (6)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102827922A (en) * | 2011-06-16 | 2012-12-19 | 华东医学生物技术研究所 | Cascade intrusion signal amplification reaction combined nanogold-oligonucleotide probe visual nucleic acid detection method |
| CN103180464A (en) * | 2010-11-15 | 2013-06-26 | 精密科学公司 | Real time cleavage assay |
| US20150218651A1 (en) * | 2012-08-17 | 2015-08-06 | Cornell University | Use of dna in circulating exosomes as a diagnostic marker for metastatic disease |
| CN106801110A (en) * | 2017-04-13 | 2017-06-06 | 广州市宝创生物技术有限公司 | Highly sensitive hbv nucleic acid immue quantitative detection reagent box |
| KR101775953B1 (en) * | 2016-03-22 | 2017-09-07 | (주) 제노텍 | Detection methods of mutation and the kits |
| CN107523630A (en) * | 2017-09-26 | 2017-12-29 | 周国华 | A kind of gene mutation multiple detection method based on signal amplification DNA gates |
-
2018
- 2018-09-11 CN CN201811055079.2A patent/CN109112189A/en active Pending
Patent Citations (6)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN103180464A (en) * | 2010-11-15 | 2013-06-26 | 精密科学公司 | Real time cleavage assay |
| CN102827922A (en) * | 2011-06-16 | 2012-12-19 | 华东医学生物技术研究所 | Cascade intrusion signal amplification reaction combined nanogold-oligonucleotide probe visual nucleic acid detection method |
| US20150218651A1 (en) * | 2012-08-17 | 2015-08-06 | Cornell University | Use of dna in circulating exosomes as a diagnostic marker for metastatic disease |
| KR101775953B1 (en) * | 2016-03-22 | 2017-09-07 | (주) 제노텍 | Detection methods of mutation and the kits |
| CN106801110A (en) * | 2017-04-13 | 2017-06-06 | 广州市宝创生物技术有限公司 | Highly sensitive hbv nucleic acid immue quantitative detection reagent box |
| CN107523630A (en) * | 2017-09-26 | 2017-12-29 | 周国华 | A kind of gene mutation multiple detection method based on signal amplification DNA gates |
Non-Patent Citations (6)
| Title |
|---|
| GEORGE M. YOUSEF等: "《Molecular Testing in Cancer》", 31 December 2014, SPRINGER * |
| KATSUHIKO NAOKI等: "The PCR-invader method (structure-specific 5" nuclease-based method), a sensitive method for detecting egfr gene mutations in lung cancer specimens; comparison with direct sequencing", 《INT J CLIN ONCOL》 * |
| MICHAEL OLIVER: "The Invader assay for SNP genotyping", 《MUTAT RES.》 * |
| MIYAKO TAKATA等: "A new rapid method for detecting epidermal growth factor receptor mutations in non-small cell lung cancer", 《ONCOLOGY REPORTS》 * |
| 邹秉杰等: "基于核酸侵入反应的基因突变检测方法研究进展", 《药学进展》 * |
| 项铮等: "高灵敏定量检测循环肿瘤DNA中EGFR基因突变", 《中国化学会第30届学术年会摘要集》 * |
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN110835644A (en) * | 2019-12-16 | 2020-02-25 | 广州市宝创生物技术有限公司 | K-ras gene mutation site detection kit |
| CN113088573A (en) * | 2021-04-13 | 2021-07-09 | 人和未来生物科技（长沙）有限公司 | Reagent for detecting mutation of EGFR gene L858R and Del E746-A750 and application thereof |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| EP1866438B1 (en) | Polynucleotide primers | |
| CN107227361A (en) | Primer, probe and detection kit for detecting CYP2C19 gene pleiomorphisms | |
| CN107488711A (en) | The method and its kit of the genotype detection of point mutation | |
| CN104805206A (en) | Kit for detecting TERT (telomerase reverse transcriptase) gene promoter mutation, and detection method of kit | |
| CN107988369A (en) | Kit that is a kind of while detecting 45 mutational sites of Human epidermal growth factor receptor gene | |
| CN104862401B (en) | Detect primer, kit and its PCR method of KRAS gene hot mutant sites | |
| CN109112189A (en) | The a variety of hot spot mutation kits of 19 exon of Multiple detection EGFR gene | |
| CN107513577A (en) | A kind of method of efficient detection EGFRT790M mutant and probe and kit for detection | |
| Tang et al. | Determination of low-abundance single-base point mutations based on endonuclease IV and branch migration system | |
| CN104818340B (en) | Detect primer, kit and its PCR method of JAK2 gene V617F loci polymorphisms | |
| CN104694622A (en) | Probe for detecting K-ras gene mutation, primer, kit and method | |
| Scholl et al. | Rapid screening and sensitive detection of NPM1 (nucleophosmin) exon 12 mutations in acute myeloid leukaemia | |
| CN110846408A (en) | Primer combination for detecting TTN gene mutation and application thereof | |
| Ghaissani et al. | Design and characterization of a SYBR Green I-based melting curve method for investigation of HER2I655V polymorphism in breast cancer | |
| CN108060213A (en) | Isothermal duplication method detection SNP site probe and kit based on the recombinase-mediated that probe is oriented to | |
| JP5025489B2 (en) | Specific and sensitive amplification of target sequences | |
| CN109136367B (en) | Method for improving diagnosis efficiency of BRAF gene V600E mutation | |
| CN107090508B (en) | Novel kit for detecting gene mutation | |
| CN114592054A (en) | Amplification primer group, probe, detection kit and use method for gene detection of asthma personalized medicine | |
| CN108998535B (en) | KRAS gene multiple mutation site detection kit | |
| CN113574180A (en) | Single nucleic acid for real-time detection of genetic variation of single target gene and detection method using same | |
| CN109652539A (en) | A kind of kit detected for EGFR T790M site mutation | |
| CN110172506A (en) | A kind of kit and its application for quantitative detection Leber hereditary optic neuropathy mutant | |
| CN116640854B (en) | Marker, method and primer probe composition for analyzing microsatellite instability | |
| Marková et al. | A new allelic discrimination assay using locked nucleic acid-modified nucleotides (LNA) probes for detection of JAK2 V617F mutation |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| CB03 | Change of inventor or designer information |
Inventor after: Wang Jianping Inventor after: Pan Tengfei Inventor before: Wang Jianping Inventor before: Zou Bingjie Inventor before: Pan Tengfei |
|
| CB03 | Change of inventor or designer information | ||
| RJ01 | Rejection of invention patent application after publication |
Application publication date: 20190101 |
|
| RJ01 | Rejection of invention patent application after publication |