CN110951860A - Method for detecting JAK2V617F mutation rate and special primer and probe thereof - Google Patents

Abstract

The invention relates to the technical field of gene mutation detection, in particular to a method for detecting JAK2V617F mutation rate and a special primer and a probe thereof. The special primers and the probes comprise: a JAK2 upstream wild primer, a JAK2 upstream mutant primer, a JAK2 common downstream primer, a JAK2 detection probe, a JAK2 wild blocking probe, and a JAK2 mutant blocking probe. The invention introduces the closed probe into the detection system, can effectively avoid non-specific amplification under high sample DNA concentration, and improve detection sensitivity; MGB marks are selected for designing the detection probe, the wild blocking probe and the mutation blocking probe, so that the Tm value difference between a matched template and a non-matched template is improved, the signal to noise ratio is improved, and the detection result is more accurate and the resolution ratio is higher.

Description

Method for detecting JAK2V617F mutation rate and special primer and probe thereof

Technical Field

The invention relates to the technical field of gene mutation detection, in particular to a method for detecting JAK2V617F mutation rate and a special primer and a probe thereof.

Background

In 2005, JAK2V617F mutations were found in Polycythemia Vera (PV), Essential Thrombocythemia (ET), and Primary Myelofibrosis (PMF). Valine-to-phenylalanine mutation of JAK2 exon14 changes the JH2 domain of JAK2 protein, and loss of negative downstream regulation of JH2 results in continuous activation of JAK2 pathway. In 2008, the World Health Organization (WHO) used JAK2V617F gene mutation positive as one of the diagnostic conditions for PV, ET, PMF. 93% -95% of PV patients can generate JAK2V617F gene mutation, so JAK2V617F is a sensitivity index for diagnosing PV. 53% -64% of ET patients carry JAK2V617F gene mutation, and 58% -65% of PMF patients carry JAK2V617F mutation. In addition, the targeted therapeutic drug against JAK2V617F mutation, namely the luccotinib, can obviously relieve intractable clinical symptoms which cannot be well controlled by traditional treatment, such as giant spleen, severe pruritus and the like of a patient, and can obviously prolong the life cycle of the patient. Therefore, the detection of the JAK2V617F mutation is of great importance for the accurate diagnosis of PV, ET and PMF.

In recent years, more and more researches show that different mutation ratios of JAK2V617F have important auxiliary values for prognosis judgment of PV, ET and PMF. The mutation load of JAK2V617F varies among different diseases, and the median mutation load of JAK2V617F in PV patients is around 50%, while the mutation load of JAK2V617F in most ET and PMF patients is less than 50%. PV patients with high JAK2V617F allelic burden have higher hemoglobin levels, higher white blood cell counts, and are accompanied by large spleen, itching, and increased risk of developing thrombosis. In the ET thrombosis international prognosis scoring system, the JAK2V617F mutation was selected as one of the scoring criteria. In ET patients, whose mutation burden is correlated with the clinical presentation and prognosis of the disease, older patients often have a higher mutation burden, and ET patients with a high mutation burden are more prone to develop megasplenic presentation with a higher incidence of arterial thrombosis. In addition, the different mutation ratios of JAK2V617F in PMF patients also have important implications for prognosis. Therefore, quantitative detection of the mutation load of JAK2V617F is also of great clinical significance.

The current major detection methods for the JAK2V617F mutation include first-generation sequencing, Restriction Fragment Length Polymorphism (RFLP), high resolution melting curve analysis (HRM), allele specific PCR (AS-PCR), single base extension, Single Strand Conformation Polymorphism (SSCP), and the like. The first-generation sequencing is a gold standard for SNP detection, but the detection process is long in time, complicated in operation and low in detection sensitivity, the lower limit of detection is only 20%, and quantification cannot be achieved; RFLP, HRM and SSCP are not suitable for wide clinical popularization due to complex operation and limitation of the technology and cannot be quantified. As a rapid, convenient and high-sensitivity method, AS-PCR becomes a main detection means for qualitatively detecting JAK2V617F mutation sites. However, the conventional AS-PCR method still causes non-specific amplification due to the limitation of primer design. Although by strict control of lower template DNA concentration (typically 10-15 ng/. mu.L), still can not completely eliminate the nonspecific amplification reaction, this needs through wild and mutant delta C_TThe range of values defines the negative and positive possibilities. Due to the technical limitation, the detection sensitivity of the common AS-PCR method is obviously limited and can only reach about 1 percent generally. However, with the continuous development of new drugs and the progress of treatment, it is expected that the demand for detecting the depth of the minute residual mutation of the JAK2V617F mutation will be higher in the near future. How to combine the technical advantages of the common AS-PCR method, under the condition of higher sample DNA concentration, eliminating non-specific amplification reaction and further improving the accuracy and sensitivity of JAK2V617F mutation becomes a problem to be solved urgently.

Disclosure of Invention

In view of the prior art, the invention aims to provide a method for detecting JAK2V617F mutation rate and a special primer and a probe thereof. The invention introduces the closed probe into the detection system, can effectively avoid non-specific amplification under high sample DNA concentration, and improve detection sensitivity; MGB marks are selected for designing the probe, so that the Tm value difference between paired templates and unpaired templates is improved, the signal to noise ratio is improved, and the detection result is more accurate and the resolution ratio is higher.

In order to achieve the purpose, the invention adopts the following technical scheme:

in a first aspect of the present invention, there is provided a primer-probe combination for detecting a mutation rate of JAK2V617F, the primer-probe combination comprising:

the sequence of the wild primer at the upstream of JAK2 is shown in SEQ ID NO. 1;

JAK2 upstream mutation primer, the sequence of which is shown in SEQ ID NO. 2;

a JAK2 downstream common primer, the sequence of which is shown in SEQ ID NO. 7;

a JAK2 detection probe, the sequence of which is shown in SEQ ID NO. 8;

a JAK2 wild blocking probe, the sequence of which is shown in SEQ ID NO. 9;

JAK2 mutation blocking probe, the sequence of which is shown in SEQ ID NO. 10;

wherein, FAM is marked at the 5 'end of the sequence shown in SEQ ID NO.8, and MGB is marked at the 3' end;

MGBs are marked at the 3' ends of the sequences shown in SEQ ID NO.9 and SEQ ID NO. 10.

In a second aspect, the present invention provides the use of the primer-probe combination described above in the preparation of a reagent and/or kit for detecting the mutation rate of JAK2V 617F.

In a third aspect of the present invention, there is provided a kit for detecting the mutation rate of JAK2V617F, wherein the kit comprises the primer-probe combination described above.

Further, the kit further comprises: the sequences of an upstream primer, a downstream primer and a Taqman probe of the internal reference gene are respectively shown as SEQ ID NO.11, SEQ ID NO.12 and SEQ ID NO. 13; HEX is marked at the 5 'end and TAMRA is marked at the 3' end of the nucleotide sequence shown in SEQ ID NO. 13.

Further, the kit further comprises: AceQ U + Probe Master Mix, ROX reference dye and ddH₂O。

Further, the kit further comprises: mutant plasmid references and wild plasmid references.

Preferably, in the kit, a wild primer at the upstream of JAK2, a common primer at the downstream of JAK2, a JAK2 detection probe and a JAK2 mutation blocking probe are coated in a PCR reaction tube in advance; the JAK2 upstream mutation primer, JAK2 downstream common primer, JAK2 detection probe and JAK2 wild blocking probe are coated in another PCR reaction tube in advance.

In a fourth aspect, the present invention provides a method for detecting the mutation rate of JAK2V617F for non-diagnostic purposes, comprising the steps of:

respectively constructing a wild type amplification system and a mutant type amplification system by adopting the kit, and respectively carrying out PCR amplification by using the wild type amplification system and the mutant type amplification system by taking the DNA of a sample to be detected as a template; and quantifying the mutant copy number of the sample to be detected by using the mutant plasmid reference product, quantifying the wild copy number of the sample to be detected by using the wild plasmid reference product, and calculating to obtain the JAK2V617F mutation rate.

Preferably, the wild-type amplification system comprises:

AceQ U + Probe Master Mix 10 mu L, ROX 0.4.4 mu L, JAK2 upstream wild primer 0.6 mu L, JAK2 downstream common primer 0.6 mu L, JAK2 detection Probe 0.4 mu L, JAK2 mutation blocking Probe 0.6 mu L, internal reference gene upstream primer 0.3 mu L, downstream primer 0.3 mu L, Taqman Probe 0.2 mu L and ddH₂O 1.6μL；

The mutant amplification system comprises:

AceQ U + Probe Master Mix 10 mu L, ROX 0.4.4 mu L, JAK2 upstream mutation primer 0.6 mu L, JAK2 downstream common primer 0.6 mu L, JAK2 detection Probe 0.4 mu L, JAK2 wild block Probe 0.6 mu L, internal reference gene upstream primer 0.3 mu L, downstream primer 0.3 mu L, Taqman Probe 0.2 mu L and ddH₂O 1.6μL。

Preferably, the conditions for PCR amplification are: 10min at 95 ℃; 30s at 95 ℃, 1min at 62 ℃ and 40 cycles.

The mutation rate of JAK2V617F was calculated as follows:

mutation rate ═ mutant copy number of samples/(mutant copy number of samples + wild copy number of samples) × 100%.

The invention has the beneficial effects that:

(1) the inventionThe kit can still completely eliminate non-specific amplification reaction under the condition of high sample DNA concentration (75 ng/. mu.L), so that the result interpretation does not need to refer to wild and mutant delta C_TThe value makes the result interpretation simpler and more accurate.

(2) The kit further improves the detection sensitivity of JAK2V617F mutation, the lowest detection limit usually reaches 25copies, and the mutation can be detected as low as 0.025 percent.

(3) The kit can be used for quantitatively detecting the JAK2V617F mutation rate, and has a wide linear range. Particularly, the linear range is good when the copy number is 50copies and the mutation rate of JAK2V617F is as low as 0.05 percent.

(4) The detection process of the invention is closed tube operation, can avoid pollution, has good specificity, high sensitivity and strong stability, has no special requirements on instruments and equipment, and is suitable for wide clinical development.

Drawings

FIG. 1: primer probe combination 1-positive sample mutant type detection hole amplification curve.

FIG. 2: primer probe combination 1-negative sample mutant type detection hole amplification curve.

FIG. 3: primer probe combination 2-positive sample mutant type detection hole amplification curve.

FIG. 4: primer probe combination 2-negative sample mutant type detection hole amplification curve.

FIG. 5: primer probe combination 3-positive sample mutant type detection hole amplification curve.

FIG. 6: primer probe combination 3-negative sample mutant type detection hole amplification curve.

FIG. 7: mutant reference amplification curves and linearity.

FIG. 8: wild reference amplification curves and linearity.

FIG. 9: negative quality control sample amplification curve.

FIG. 10: positive quality control sample amplification curve.

FIG. 11: repeat imprecision-80% mutant assay well amplification curves.

FIG. 12: repeat imprecision-20% mutant assay well amplification curves.

FIG. 13: and detecting a sample mutant linear curve.

FIG. 14: lowest detection limit amplification curve-50 copies/. mu.L.

FIG. 15: lowest detection limit amplification curve-25 copies/. mu.L.

Detailed Description

It should be noted that the following detailed description is exemplary and is intended to provide further explanation of the disclosure. Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this application belongs.

As described in the background section, quantitative detection of the JAK2V617F mutation load is of great clinical significance. At present, a plurality of methods are used for qualitatively or quantitatively detecting JAK2V617F mutation, wherein AS-PCR serves AS a rapid, convenient and high-sensitivity method to become a main detection means for qualitatively detecting JAK2V617F mutation sites. However, the conventional AS-PCR method still causes non-specific amplification due to the limitation of primer design.

The concentration of the sample DNA affects the specificity of PCR amplification, and an excessively high concentration of the sample DNA increases the non-specific amplification. Therefore, the concentration of the DNA of the sample for detecting JAK2V617F mutation by AS-PCR is generally 10-15 ng/. mu.L, and the highest concentration does not exceed 30 ng/. mu.L generally, and the nonspecific amplification reaction is inhibited by strictly controlling the concentration of the lower template DNA. Unfortunately, even at lower template DNA concentrations, non-specific amplification reactions cannot be completely avoided. Moreover, the low concentration of template DNA is not only unfavorable for the detection of the target substance, but also the requirement for PCR amplification reaction system is increased. Therefore, how to realize the specific detection of JAK2V617F mutation under high sample DNA concentration (75 ng/. mu.L) is the current technical difficulty.

The main innovation of the invention is that: by designing a blocking probe, under the condition of high sample concentration of 75 ng/. mu.L DNA, non-specific amplification reaction can be completely eliminated, and the sensitivity to JAK2V617F mutation can be further improved to 0.025 percent. This is not achieved by the current common AS-PCR method.

In order to make the technical solutions of the present application more clearly understood by those skilled in the art, the technical solutions of the present application will be described in detail below with reference to specific embodiments.

The test materials used in the examples of the present invention are all conventional in the art and commercially available. The experimental procedures, for which no detailed conditions are indicated, were carried out according to the usual experimental procedures or according to the instructions recommended by the supplier.

Example 1: primer probe design and screening

The invention designs specific primers and Taqman fluorescent probes for detecting JAK2 gene wild and V617F mutation sites, adopts a real-time fluorescent PCR method to quantitatively detect JAK2 gene wild and V617F mutation in human peripheral blood or bone marrow genome DNA, and calculates the percentage of wild type and mutant type. According to the invention, JAK2 upstream mutation and wild primers are firstly designed, and the previous base of a mutation site (G > T) is mutated to obtain better specific amplification, and the amplification efficiency is influenced by the combination of different mutation bases at the 3' end, so that the previous base of the mutation site is mutated into T, C, G in sequence to obtain three pairs of primer probe combinations. The two primers and the 3 'end common primer are respectively added to carry out two parallel PCRs, only the primer which is completely complementary to the DNA of the wild or mutation site (G/T) can be extended to obtain a PCR amplification product, and if the mismatch is positioned at the 3' end of the primer, the PCR cannot be extended. The JAK2 mutant blocking probe and JAK2 wild blocking probe use MGB probe, which can obviously improve Tm value and further shorten the length of the probe, so that the mismatch of 1 base can generate larger influence on annealing temperature, when detecting mutant, the wild blocking probe is added to be combined with a wild template, and the combination is kept during annealing, thereby inhibiting amplification and playing a blocking role; when detecting wild type, adding mutation blocking probe to combine with mutant template, and maintaining the combination during annealing to inhibit amplification, so as to play a blocking role, and the addition of blocking probe can raise the amplification specificity. The JAK2 downstream primer is used as a common downstream primer for amplification of JAK2 wild-type sequence and mutant sequence. Therefore, the invention designs three groups of primers and probes for detecting JAK2V617F mutation, which comprise: an upstream wild primer for amplifying a normal sequence of JAK2, an upstream mutant primer for amplifying a mutant sequence of JAK2, a downstream common primer for JAK2, a JAK2 detection probe, a JAK2 mutation blocking probe and a JAK2 wild blocking probe. And also comprises an upstream primer and a downstream primer for internal reference amplification and a probe. The specific sequence is shown in Table 1:

table 1: primer and probe sequence

Note: the positions in table 1 indicate the target regions to which the primers or probes are designed, where > gi |568815589 indicates the chromosome code number and the following numerical intervals indicate the chromosome specific position.

Three sets of primers and probes were used for reagent preparation, namely primer probe set 1 (i.e., JAK2 upstream wild primer 1, JAK2 upstream mutant primer 1, JAK2 downstream common primer, JAK2 detection probe, JAK2 mutant blocking probe, JAK2 wild blocking probe, GAPDH upstream primer, GAPDH downstream primer, and GAPDH probe), primer probe set 2 (i.e., JAK2 upstream wild primer 2, JAK2 upstream mutant primer 2, JAK2 downstream common primer, JAK2 detection probe, JAK2 mutant blocking probe, JAK2 wild blocking probe, GAPDH upstream primer, GAPDH downstream primer, and GAPDH probe set 3 (i.e., JAK2 upstream wild primer 3, JAK2 upstream mutant primer 3, JAK2 downstream common primer, JAK2 detection probe, JAK2 mutant blocking probe, JAK2 blocking, GAPDH upstream primer, GAPDH downstream primer, GAPDH probe).

4 positive samples and 4 negative samples are selected for experiments, and the results are shown in FIGS. 1-6, and the results show that the specificity of the primer probe combination 1 is better, the negative samples have no JAK2V617F mutation amplification curve, and the positive samples have typical mutation amplification curves. The specificity of the primer probe combination 2 and the primer probe combination 3 is poor, and the obvious JAK2V617F mutation amplification curves appear in negative samples. Thus, primer probe set 1 was selected for subsequent testing.

Example 2: construction of mutant and wild plasmid references

According to the upstream and downstream primers designed in the example 1, the amplified fragment and the upstream and downstream about 100bp of the amplified fragment are selected to respectively construct a mutant plasmid reference product and a wild plasmid reference product. The plasmid was constructed by Shanghai Czeri bioengineering, Inc. The sequence of the JAK2 gene fragment (> gi |568815589:5073611-5074001) inserted in the wild plasmid reference is shown as SEQ ID NO. 14; the sequence of the JAK2 gene fragment (> gi |568815589:5073611-5074001) inserted in the mutant plasmid reference is shown in SEQ ID NO. 15.

5’-GCATCTTTATTATGGCAGAGAGAATTTTCTGAACTATTTATGGACAACAGTCAAACAACAATTCTTTGTACTTTTTTTTTTCCTTAGTCTTTCTTTGAAGCAGCAAGTATGATGAGCAAGCTTTCTCACAAGCATTTGGTTTTAAATTATGGAGTATGTGTCTGTGGAGACGAGAGTAAGTAAAACTACAGGCTTTCTAATGCCTTTCTCAGAGCATCTGTTTTTGTTTATATAGAAAATTCAGTTTCAGGATCACAGCTAGGTGTCAGTGTAAACTATAATTTAACAGGAGTTAAGTATTTTTGAAACTGAAAACACTGTAGGACTATTCAGTTATATCTTGTGAAAAAGGAAAGCAATGAAGTTAAAAGTAGAAGGTTACAATGCCCAA-3’；(SEQ ID NO.14)

5’-GCATCTTTATTATGGCAGAGAGAATTTTCTGAACTATTTATGGACAACAGTCAAACAACAATTCTTTGTACTTTTTTTTTTCCTTAGTCTTTCTTTGAAGCAGCAAGTATGATGAGCAAGCTTTCTCACAAGCATTTGGTTTTAAATTATGGAGTATGTTTCTGTGGAGACGAGAGTAAGTAAAACTACAGGCTTTCTAATGCCTTTCTCAGAGCATCTGTTTTTGTTTATATAGAAAATTCAGTTTCAGGATCACAGCTAGGTGTCAGTGTAAACTATAATTTAACAGGAGTTAAGTATTTTTGAAACTGAAAACACTGTAGGACTATTCAGTTATATCTTGTGAAAAAGGAAAGCAATGAAGTTAAAAGTAGAAGGTTACAATGCCCAA-3’；(SEQ ID NO.15)

Diluting the mutant plasmid reference substance and the wild plasmid reference substance to 5 × 10 respectively⁵copies/μl、5×10⁴copies/μl、5×10³copies/μl、5×10²The primers and the probe combination 1 are used for amplifying the diluted reference substances, the linearity of the reference substances is verified, and the r of the mutant plasmid reference substances and the r of the wild plasmid reference substances can be known from the experimental results²1.000 and 0.998 respectively, and meets the linearity requirement (r)²Not less than 0.980). The results are shown in Table 2, and the amplification curves and linearity are shown in FIGS. 7 and 8.

Table 2: reference linearity

Example 3: kit for detecting JAK2V617F mutation rate

1. The kit comprises the following components:

(1) PCR reaction tube 1, comprising:

name (R)	Sequence of	Decoration
			JAK2 upstream wild primer	5’-AGCATTTGGTTTTAAATTATGGAGTATGAG-3’	—
JAK2 downstream common primer	5’-CTAGCTGTGATCCTGAAACTGAATT-3’	—
			JAK2 detection probe	TGCCTTTCTCAGAGCATCTGT	5’-FAM；3’-MGB
JAK2 mutation blocking probe	TGGAGTATGTTTCTGTGGAGA	3’-MGB
			GAPDH upstream primer	5’-CCCACTCCTCCACCTTTGAC-3’	—
GAPDH downstream primer	5’-CTGGCCCCAGCCACATAC-3’	—
			GAPDH probe	CATTGCCCTCAACGACCACTTTGTCAAGC	5’-HEX；3’-TAMRA

(2) A PCR reaction tube 2 comprising:

name (R)	Sequence of	Decoration
			JAK2 upstream mutation primer	5’-AGCATTTGGTTTTAAATTATGGAGTATGAT-3’	—
JAK2 downstream common primer	5’-CTAGCTGTGATCCTGAAACTGAATT-3’	—
			JAK2 detection probe	TGCCTTTCTCAGAGCATCTGT	5’-FAM；3’-MGB
JAK2 wild blocking probe	TGGAGTATGTGTCTGTGGAG	3’-MGB
			GAPDH upstream primer	5’-CCCACTCCTCCACCTTTGAC-3’	—
GAPDH downstream primer	5’-CTGGCCCCAGCCACATAC-3’	—
			GAPDH probe	CATTGCCCTCAACGACCACTTTGTCAAGC	5’-HEX；3’-TAMRA

(3) Mutant plasmid reference, wild plasmid reference, AceQ U + Probe Master Mix, ROX and ddH₂O。

2. The use method of the kit comprises the following steps:

(1) detecting a sample:

29 negative normal healthy human specimens, 21 JAK2V617F mutation positive clinical patient specimens determined by the reference method (Sanger generation sequencing).

(2) Extraction of sample DNA:

extracting human genome DNA with whole blood nucleic acid extraction kit (Qiagen), and detecting nucleic acid concentration and purity (OD) with spectrophotometer₂₆₀/OD₂₈₀Ratio between 1.8-2.0), and then diluting the experimental DNA template to 75 ng/. mu.L.

The method comprises the following specific steps:

1) a sufficient amount of 1.5mL of the tube was taken and labeled, and 20. mu.L of the Protease (or the Protease K) solution was added to the bottom of the tube.

2) After mixing the samples, 200. mu.L of the sample, if less than 200. mu.L of the sample, was added to each tube, and 200. mu.L of PBS was added to make up the sample.

3) Add 200. mu.L of buffer AL and vortex for 15 s.

4) The mixture is incubated at 56 ℃ for 10 minutes.

5) Centrifuge briefly to spin off the tube walls and cover with solution.

6) Add 200. mu.L of ethanol (96-100%) to each tube, vortex for 15s, and centrifuge briefly.

7) The liquid was carefully transferred to a QIAamp Mini spin column (placed in a 2mL collection tube). Centrifuge at 8,000rpm or more for 1min, place QIAamp Mini spin column into a clean 2mL collection tube, and discard the tube.

8) Add 500. mu.L of the rinse AW1 (not wetting the edge of the tube), centrifuge at 8,000rpm for 1min, place the QIAamp Minispin column into a clean 2mL collection tube, and discard the tube.

9) Add 500. mu.L of the rinse AW2 (not wetting the edge of the tube), centrifuge at maximum speed (13,200rpm) for 3min, place the QIAamp Mini spin column into a clean 2mL collection tube, and discard the tube.

10) The QIAamp Mini spin column was placed in a new tube (supplied by itself) and centrifuged at the highest speed (13,200rpm) for 1 min.

11) The QIAamp Mini spin column was transferred to a new EP tube (1.5 mL), 50-200. mu.L of elution buffer AE or distilled water was suspended in the center of the adsorption membrane, and the membrane was left at room temperature (15-25 ℃) for 5 minutes and centrifuged at 8,000rpm (. about.13,400 Xg) for 1 minute.

12) DNA concentration and OD measurement Using Nanodrop Instrument₂₆₀/OD₂₈₀The ratio, and the template DNA was diluted with AE to a concentration of 75 ng/. mu.L.

(3) And (3) PCR amplification:

the invention adopts ABI 7500 real-time fluorescent quantitative PCR system, the PCR amplification system uses Q113-02 AceQ U + Probe Master Mix of Nanjing Novozam biotechnology, and is suitable for high-sensitivity Probe method qPCR reaction, and a dUTP/UNG enzyme anti-pollution system is introduced, thereby eliminating the influence of the amplification product on the qPCR reaction.

A sample is divided into two tubes for amplification, one tube is used for detecting wild type, the other tube is used for detecting mutant type, and the specific preparation method and PCR amplification are shown in tables 3-5. Detection uses FAM and HEX channels.

Table 3: preparation of mutational reagent system

Table 4: preparation of wild reagent system

Table 5: PCR amplification procedure

(4) And (4) interpretation of results:

1) determining baseline and threshold values:

the section with smaller fluctuation and more stable fluorescence curve is selected as the baseline, and can be adjusted according to the needs. The threshold value should be set at the inflection point of the amplification curve and cover the highest point of the non-amplification curve, and the negative control is not detected.

2) And (3) judging the effectiveness:

at least one fluorescence signal is required to be arranged in a FAM or HEX channel of any detection hole of a sample to be detected; c of HEX signal of sample detection hole if FAM signal does not exist_TThe value is less than or equal to 30. If the above conditions are not satisfied, it is indicated that the DNA quality is not good or that the PCR reaction inhibitor is contained, and DNA is extracted again or sampling is required again.

3) Negative or positive determination of the result

FAM Signal C at the lowest concentration of all wild and mutant reference products under FAM channel_TThe value is less than or equal to 33, and the wild type detection holes of all samples are amplified; no amplification exists in the mutant detection hole of the JAK2V617F mutant negative quality control sample, and amplification exists in the mutant detection hole of the JAK2V617F mutant positive quality control sample.As shown in fig. 9 and 10. If the FAM signal of the sample mutant type detection hole is less than or equal to 38 under the condition of meeting the conditions, judging the sample mutant type detection hole to be positive; if the FAM signal is > 38, or "Undet" is indicated, it is judged to be negative.

4) Quantification and calculation of mutation rates:

the mutant plasmid reference is used to determine the mutant copy number of the sample and the wild plasmid reference is used to determine the wild copy number of the sample.

Mutation rate ═ mutant copy number of samples/(mutant copy number of samples + wild copy number of samples) × 100%.

Example 4: methodology validation

1. And (3) verifying the accuracy:

by using the kit of example 3, 29 samples of healthy subjects who were confirmed to be negative to JAK2V617F mutation by Sanger generation sequencing, and 21 samples of patients who were positive to JAK2V617F mutation were selected for detection, and the results are shown in table 6, and the two methods are 100% identical.

Table 6: correct comparison

2. And (3) precision verification:

(1) repeatability imprecision: each of the clinical specimens with mutation rates of JAK2V617F of approximately 80% and 20% was selected and the assay was repeated 20 times. Results As shown in tables 7 and 8 below, and FIGS. 11 and 12, the mutation rate of JAK2V617F was 80% and 20% for both samples of mutant and wild C_TThe coefficient of variation (CV,%) of the values is 0.67 percent and 0.82 percent, 0.55 percent and 0.80 percent respectively, and the requirement of repeatability imprecision is met (CV is less than or equal to 5 percent). The mutation rates of both samples were also very close to 80% and 20% of the original values, with only very small range fluctuations.

Table 7: repeatability imprecision-mutation Rate 80%

Test number	Mutation Cт	Wild type Cт	Mutant copy number	Number of wild copies	Mutation rate	Interpretation results
							H1	24.90	26.83	47203	9428	83.35％	Mutations
H2	25.10	26.93	41920	8899	82.49％	Mutations
							H3	24.79	26.48	50500	11775	81.09％	Mutations
H4	24.66	26.14	54511	14571	78.91％	Mutations
							H5	24.51	26.11	59904	14857	80.13％	Mutations
H6	24.63	26.30	55635	13168	80.86％	Mutations
							H7	24.66	26.49	54706	11699	82.38％	Mutations
H8	25.05	26.37	43066	12587	77.38％	Mutations
							H9	24.99	26.59	44661	10996	80.24％	Mutations
H10	24.89	26.26	47567	13519	77.87％	Mutations
							H11	24.71	26.59	52812	10978	82.79％	Mutations
H12	24.75	26.68	51785	10409	83.26％	Mutations
							H13	25.07	26.45	42749	12023	78.05％	Mutations
H14	25.05	26.65	43259	10576	80.36％	Mutations
							H15	25.05	26.62	43057	10754	80.02％	Mutations
H16	24.87	26.27	48022	13458	78.11％	Mutations
							H17	24.98	26.53	44894	11380	79.78％	Mutations
H18	24.85	26.61	48605	10877	81.71％	Mutations
							H19	24.87	26.69	48072	10302	82.35％	Mutations
H20	24.82	26.81	49441	9598	83.74％	Mutations
							Mean value of	24.865	26.531	/	/	/	/
SD	0.167	0.218	/	/	/	/
							CV	0.67％	0.82％	/	/	/	/

Table 8: repeatability imprecision-mutation Rate 20%

(2) Intermediate imprecision: clinical specimens with mutation rates of approximately 80% and 20% were selected. The test was performed once a day, and 4-5 tests were repeated for each concentration for 4 consecutive days. Results As shown in tables 9 and 10 below, JAK2V617F mutation rates were 80% and 20% of the mutant and wild C in the samples tested for 4 consecutive days_TThe CV value is far less than 5%, and meets the requirement of intermediate imprecision (CV is less than or equal to 5%). In addition, the mutation rates of both samples were very close to 80% and 20% of the original values, with only very small range fluctuations.

Table 9: intermediate imprecision-mutation Rate 20%

Table 10: intermediate imprecision-mutation Rate 80%

3. Linearity:

(1) sample linearity: a JAK2V617F mutant sample L0 is selected, and the average of JAK2V617F mutations is 53648 copies/ul in two consecutive detections. Performing 4 times of 10-fold gradient dilution to obtain L1, L2, L3 and L4, repeating the determination for 3 times for each dilution concentration, and calculating the logarithm of the average value and C_TThe linear correlation coefficient is calculated according to the value, and r2 is required to be more than or equal to 0.980. As shown in table 11 and fig. 13, this verification shows that r2 is 1.000, and linearity satisfies the requirement.

Table 11: sample linearity

4. Minimum detection limit:

50 and 100 copies/mu l of JAK2V617F mutant plasmids and 150 ng/mu l of genome DNA of peripheral blood of normal healthy people are selected and mixed according to the equal volume of 1:1 to prepare samples with the JAK2V617F mutant contents of 25 and 50 copies/mu l and the mutation rates of about 0.025 percent and 0.05 percent respectively. As shown in Table 12 and FIG. 14, and Table 13 and FIG. 15, since the samples with different concentrations were stably detected after 20 times of repeated measurement, the lower limit of detection in this method was set to 25 copies/. mu.l.

Table 12: minimum detection limit-50 copies/. mu.l

Table 13: minimum detection limit-25 copies/. mu.l

5. Detection range

The mutant plasmids and the wild plasmids with different concentrations are mixed to prepare the mixture with the mutation rate of 0.025 percent (the mutant plasmid is 50 copies/. mu.l + the wild plasmid is 2 multiplied by 10)⁵copies/. mu.l mixed in equal volumes), 0.05% (mutant plasmid 100 copies/. mu.l + wild plasmid 2X 10)⁵copies/. mu.l mixed in equal volumes), 0.1% (mutant plasmid 200 copies/. mu.l + wild plasmid 2X 10⁵copies/. mu.l mixed in equal volumes), 1% (mutant plasmid 2000 copies/. mu.l + wild plasmid 2X 10⁵copies/. mu.l mixed in equal volumes), 10% (mutant plasmid 2X 10)⁴copies/. mu.l + wild plasmid 1.8X 10⁵copies/. mu.l mixed in equal volumes), 50% (mutant plasmid 1X 10)⁵copies/. mu.l + wild plasmid 1X 10⁵copies/. mu.l mixed in equal volumes), 90% (mutant plasmid 1.8X 10)⁵copies/. mu.l + wild plasmid 2X 10⁴copies/. mu.l mixed in equal volumes) were assayed, with 3 replicates per mutation rate. The detection results are shown in Table 14, all mutation rates can be stably detected in 3 tests, and the JAK2V617F mutation and wild copy number logarithmic values meet the requirements, so that the minimum mutation rate detection limit of the invention to JAK2V617F is 0.025%.

Table 14: detection range

The above description is only a preferred embodiment of the present application and is not intended to limit the present application, and various modifications and changes may be made by those skilled in the art. Any modification, equivalent replacement, improvement and the like made within the spirit and principle of the present application shall be included in the protection scope of the present application.

SEQUENCE LISTING

<110> Jinan-Ji-Min-Lai-Korea medical inspection center, Inc

<120> method for detecting JAK2V617F mutation rate and special primer and probe thereof

<130>2019

<160>15

<170>PatentIn version 3.5

<210>1

<211>30

<212>DNA

<213> Artificial sequence

<400>1

agcatttggt tttaaattat ggagtatgag 30

<210>2

<211>30

<212>DNA

<213> Artificial sequence

<400>2

agcatttggt tttaaattat ggagtatgat 30

<210>3

<211>30

<212>DNA

<213> Artificial sequence

<400>3

agcatttggt tttaaattat ggagtatggg 30

<210>4

<211>30

<212>DNA

<213> Artificial sequence

<400>4

agcatttggt tttaaattat ggagtatggt 30

<210>5

<211>30

<212>DNA

<213> Artificial sequence

<400>5

agcatttggt tttaaattat ggagtatgcg 30

<210>6

<211>30

<212>DNA

<213> Artificial sequence

<400>6

agcatttggt tttaaattat ggagtatgct 30

<210>7

<211>25

<212>DNA

<213> Artificial sequence

<400>7

ctagctgtga tcctgaaact gaatt 25

<210>8

<211>21

<212>DNA

<213> Artificial sequence

<400>8

tgcctttctc agagcatctg t 21

<210>9

<211>20

<212>DNA

<213> Artificial sequence

<400>9

tggagtatgt gtctgtggag 20

<210>10

<211>21

<212>DNA

<213> Artificial sequence

<400>10

tggagtatgt ttctgtggag a 21

<210>11

<211>20

<212>DNA

<213> Artificial sequence

<400>11

cccactcctc cacctttgac 20

<210>12

<211>18

<212>DNA

<213> Artificial sequence

<400>12

ctggccccag ccacatac 18

<210>13

<211>29

<212>DNA

<213> Artificial sequence

<400>13

cattgccctc aacgaccact ttgtcaagc 29

<210>14

<211>391

<212>DNA

<213> Artificial sequence

<400>14

gcatctttat tatggcagag agaattttct gaactattta tggacaacag tcaaacaaca 60

attctttgta cttttttttt tccttagtct ttctttgaag cagcaagtat gatgagcaag 120

ctttctcaca agcatttggt tttaaattat ggagtatgtg tctgtggaga cgagagtaag 180

taaaactaca ggctttctaa tgcctttctc agagcatctg tttttgttta tatagaaaat 240

tcagtttcag gatcacagct aggtgtcagt gtaaactata atttaacagg agttaagtat 300

ttttgaaact gaaaacactg taggactatt cagttatatc ttgtgaaaaa ggaaagcaat 360

gaagttaaaa gtagaaggtt acaatgccca a 391

<210>15

<211>391

<212>DNA

<213> Artificial sequence

<400>15

gcatctttat tatggcagag agaattttct gaactattta tggacaacag tcaaacaaca 60

attctttgta cttttttttt tccttagtct ttctttgaag cagcaagtat gatgagcaag 120

ctttctcaca agcatttggt tttaaattat ggagtatgtt tctgtggaga cgagagtaag 180

taaaactaca ggctttctaa tgcctttctc agagcatctg tttttgttta tatagaaaat 240

tcagtttcag gatcacagct aggtgtcagt gtaaactata atttaacagg agttaagtat 300

ttttgaaact gaaaacactg taggactatt cagttatatc ttgtgaaaaa ggaaagcaat 360

gaagttaaaa gtagaaggtt acaatgccca a 391

Claims (10)

1. A primer-probe combination for detecting the mutation rate of JAK2V617F, wherein the primer-probe combination comprises:

the sequence of the wild primer at the upstream of JAK2 is shown in SEQ ID NO. 1;

JAK2 upstream mutation primer, the sequence of which is shown in SEQ ID NO. 2;

a JAK2 downstream common primer, the sequence of which is shown in SEQ ID NO. 7;

a JAK2 detection probe, the sequence of which is shown in SEQ ID NO. 8;

a JAK2 wild blocking probe, the sequence of which is shown in SEQ ID NO. 9;

JAK2 mutation blocking probe, the sequence of which is shown in SEQ ID NO. 10;

FAM is marked at the 5 'end and MGB is marked at the 3' end of the sequence shown in SEQ ID NO. 8;

MGB is marked at the 3' end of the sequences shown in SEQ ID NO.9 and SEQ ID NO. 10.

2. Use of the primer-probe combination of claim 1 for the preparation of a reagent and/or kit for detecting the mutation rate of JAK2V 617F.

3. A kit for detecting the mutation rate of JAK2V617F, wherein the kit comprises the primer-probe combination of claim 1.

4. The kit according to claim 3, further comprising: the sequences of an upstream primer, a downstream primer and a Taqman probe of the internal reference gene are respectively shown as SEQ ID NO.11, SEQ ID NO.12 and SEQ ID NO. 13; HEX is marked at the 5 'end of the sequence shown in SEQ ID NO.13, and TAMRA is marked at the 3' end.

5. The kit according to claim 3, further comprising: AceQ U + ProbeMaster Mix, ROX reference dye and ddH₂O。

6. The kit according to claim 3, further comprising: mutant plasmid references and wild plasmid references.

7. The kit according to any one of claims 3-6, wherein in the kit, a wild primer upstream of JAK2, a common primer downstream of JAK2, a JAK2 detection probe and a JAK2 mutation blocking probe are pre-coated in a PCR reaction tube; the JAK2 upstream mutation primer, JAK2 downstream common primer, JAK2 detection probe and JAK2 wild blocking probe are coated in another PCR reaction tube in advance.

8. A method for detecting the mutation rate of JAK2V617F for non-diagnostic purposes, comprising the steps of:

respectively constructing a wild type amplification system and a mutant type amplification system by adopting the kit, and respectively carrying out PCR amplification by using the wild type amplification system and the mutant type amplification system by taking the DNA of a sample to be detected as a template; and quantifying the mutant copy number of the sample to be detected by using the mutant plasmid reference product, quantifying the wild copy number of the sample to be detected by using the wild plasmid reference product, and calculating to obtain the JAK2V617F mutation rate.

9. The method of claim 8, wherein the wild-type amplification system comprises:

AceQ U + Probe Master Mix 10 mu L, ROX 0.4.4 mu L, JAK2 upstream wild primer 0.6 mu L, JAK2 downstream common primer 0.6 mu L, JAK2 detection Probe 0.4 mu L, JAK2 mutation blocking Probe 0.6 mu L, internal reference gene upstream primer 0.3 mu L, downstream primer 0.3 mu L, Taqman ProbeNeedle 0.2. mu.L and ddH₂O 1.6μL；

The mutant amplification system comprises:

AceQ U + Probe Master Mix 10 mu L, ROX 0.4.4 mu L, JAK2 upstream mutation primer 0.6 mu L, JAK2 downstream common primer 0.6 mu L, JAK2 detection Probe 0.4 mu L, JAK2 wild block Probe 0.6 mu L, internal reference gene upstream primer 0.3 mu L, downstream primer 0.3 mu L, Taqman Probe 0.2 mu L and ddH₂O 1.6μL。

10. The method of claim 8, wherein the PCR amplification conditions are: 10min at 95 ℃; 30s at 95 ℃, 1min at 62 ℃ and 40 cycles.

Images