CN105349681A - BCR-ABL fusion gene T315I mutation fluorescent PCR detection kit - Google Patents
BCR-ABL fusion gene T315I mutation fluorescent PCR detection kit Download PDFInfo
- Publication number
- CN105349681A CN105349681A CN201510888491.2A CN201510888491A CN105349681A CN 105349681 A CN105349681 A CN 105349681A CN 201510888491 A CN201510888491 A CN 201510888491A CN 105349681 A CN105349681 A CN 105349681A
- Authority
- CN
- China
- Prior art keywords
- bcr
- fusion gene
- abl fusion
- sudden change
- detection reagent
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6844—Nucleic acid amplification reactions
- C12Q1/6858—Allele-specific amplification
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Organic Chemistry (AREA)
- Engineering & Computer Science (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Health & Medical Sciences (AREA)
- Biophysics (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Immunology (AREA)
- Microbiology (AREA)
- Molecular Biology (AREA)
- Analytical Chemistry (AREA)
- Physics & Mathematics (AREA)
- Biotechnology (AREA)
- Biochemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
- Investigating Or Analysing Materials By The Use Of Chemical Reactions (AREA)
Abstract
The invention provides a BCR-ABL fusion gene T315I mutation fluorescent PCR detection kit which comprises a T315I mutation detection reaction liquid. The T315I mutation detection reaction liquid comprises a 10*PCR buffer solution, deoxyribonucleoside triphosphate, a forward primer and a reverse primer which are used for amplification of target polynucleotide, and a probe used for detection of target polynucleotide. The BCR-ABL fusion gene T315I mutation fluorescent PCR detection kit provided by the invention is a detection kit based on a real-time fluorescent quantitative PCR technology and an ARMS-PCR technology, is very high in specificity, quick to operate, simple and convenient in method, and high in detection precision, and can effectively prevent false-negative results due to an internal standard added in a reaction system.
Description
Technical field
The present invention relates to technical field of medical detection, more specifically, relate to a kind of BCR-ABL fusion gene T315I sudden change fluorescence PCR detection reagent kit.
Background technology
CML (chronicmyelogenousleukemia, i.e. chronic myelocytic leukemia) account for all leukemic 15 ~ 20%, be the Malignancy that the mankind first of finding is relevant to gene unconventionality, more than 90% patient can detect distinctive Ph karyomit(e) and molecular marker BCR-ABL fusion gene thereof.At present, the antitumor drug for CML is mainly tyrosine kinase inhibitor (Tyrosinekinaseinhibitor, TKI).The sudden change of BCR-ABL fusion gene can cause the generation of tumor cell drug resistance, point mutation can cause the amino acid in ABL kinases district to change, block the formation of the kinase whose combination of TKI and ABL or obstruction ABL kinase-dead conformation, thus the combination of interference medicament and target site, finally cause the generation of resistance.The recall rate of ABL kinases district's point mutation is about 30 ~ 90% in resistance patient, and the patient of nearly all CML acute transformation phase and the CML of 15 ~ 20% recurrence after IM treatment all can produce resistance to IM.When the dosage of TKI increases or changes s-generation signal transduction inhibitor, most saltant type CML is effective to above-mentioned change clinically, but the CML with BCR/ABLT315I sudden change is all invalid to said medicine, and therefore conditions of patients worsens rapidly, finally dead.
In the CML patient of TKI resistance or recurrence, find the sudden change of more than 100 kind of BCR-ABL gene, the drug-resistant intensity that the sudden change in different genes site causes is different.The T315I mutant drug-resistant being positioned at abl gene the 6th exon in Tyrosylprotein kinase (ABL) ATP-binding domain territory is the most obvious.The mutation frequency of T315I sudden change in BCR-ABL fusion gene is about 30%, far away higher than the mutation frequency of other mutant form.Resistance caused by T315I sudden change is the most difficult to be overcome, and is height resistance.T315I sudden change is the sudden change occurring in medicine and ABL kinases district point of contact, by the 315th Threonine (Thr) being positioned at abl gene the 6th exon substitute by Isoleucine (Ile), base becomes ATT from ACT.After sudden change occurs, Ile315 can not form hydrogen bond with TKI, and the extra C-H bond on Ile side chain after substituting can produce interference spatially, is unfavorable for the combination of Ile and TKI, just can produces resistance thus.The ABLT315I sudden change of BCR-ABL fusion gene is used as the main pointer that CML pharmacological agent is instructed clinically, has important directive significance to the examination of CML resistance and clinical science medication.
Research shows, due to the difference of patient gene's background, the validity of medicine metabolism in vivo, pharmacological agent and the prognosis of side reaction, even patient all exist individual difference.Therefore, to the detection of drug effect genes involved, doctor can be instructed the accurate dispenser of patient, evade drug side effect, improve the medical expense efficiency of patient and even society simultaneously.
At present, the method of suddenling change for detecting people BCR-ABL fusion gene T315I mainly comprises direct sequencing, high performance liquid chromatography and FQ-PCR (fluorescencequantitative-PolymeraseChainReaction, i.e. fluorescent quantitative poly chain reaction) etc.And along with the development of FQ-PCR technology, it is more and more extensive in the application of people BCR-ABL fusion gene T315I sudden change diagnostic field, also be more and more held in esteem and look, in the laboratory diagnosis that people BCR-ABL fusion gene T315I suddenlys change, real-time fluorescence PCR technology shows the superiority of its clinical diagnosis by feat of the advantage such as quick, responsive, special.
Summary of the invention
The object of this invention is to provide a kind of BCR-ABL fusion gene T315I sudden change fluorescence PCR detection reagent kit, operate the people BCR-ABL fusion gene T315I mutation detection kit quick, method is easy, detection sensitivity is high, sensing range is wide to provide a kind of.
The invention provides following technical scheme:
A kind of BCR-ABL fusion gene T315I sudden change fluorescence PCR detection reagent kit, described detection kit comprises T315I abrupt climatic change reaction solution, and described T315I abrupt climatic change reaction solution comprise 10 × PCR damping fluid, deoxyribonucleoside triphosphate, for the upstream primer of amplified target polynucleotide and downstream primer and the probe for detecting target polynucleotide; The base-pair sequence of the described probe for detecting target polynucleotide is:
5’FAM-TTCATGACCTACGGGAACCTCCTGGA-BHQ13’。
Preferably, the base-pair sequence of the described upstream primer for amplified target polynucleotide and downstream primer is:
Upstream primer: 5 '-GAGCCCCCGTTCTATATCATGAT-3 ';
Downstream primer: 5 '-AGCACCACGGCGTTCACC-3 '.
Preferably, described detection kit also comprises interior mark, is designated as abl gene 4 exon in BCR-ABL fusion gene in described, and described interior target sequence is:
5’-GCCGAGTTGGTTCATCATCATTCAACGGTGGCCGACGGGCTCATCACCACGCTCCATTATCCAGCCCCAAAGCGCAACAAGCCCACTGTCTATGGTGTGTCCCCCAACTACGACAAGTGG-3’。
Preferably, described T315I abrupt climatic change reaction solution also comprises for detecting interior target probe, and in described detection, the base-pair sequence of target probe is: 5 ' HEX-CACGCTCCATTATCCAGCCCCAAA-BHQ13 '.
Preferably, described T315I abrupt climatic change reaction solution also comprises upstream primer for amplification interior label and downstream primer; The base-pair sequence of described upstream primer and downstream primer is:
Upstream primer: 5 '-GCCGAGTTGGTTCATCATCATT-3 ';
Downstream primer: 5 '-ATAGACAGTGGGCTTGTTGCG-3 '.
Preferably, the Klorvess Liquid that the magnesium chloride solution that described 10 × PCR damping fluid comprises Tri(Hydroxymethyl) Amino Methane Hydrochloride solution that pH value is the 200mmol/L of 7.5, concentration is 30mmol/L, concentration are 500mmol/L, volume ratio be 0.2% Triton solution and volume ratio be the formamide soln of 10%.
Preferably, described deoxyribonucleoside triphosphate is dATP, dCTP, dGTP, dUTP or dTTP.
Preferably, described detection kit also comprises enzyme mixation, and described enzyme mixation comprises hot resistant DNA polymerase and 0.05U/ μ l ~ 0.2U/ μ l uracil dna glycosylase of 1U/ μ l ~ 5U/ μ l.
Preferably, described detection kit also comprises positive control, and described positive control is the plasmid of the sequence fragment comprising interior heading and the mixture of region, BCR-ABL fusion gene T315I mutational site fragment of plasmid.
Preferably, described detection kit also comprises negative control, and described negative control is the plasmid of the sequence fragment of the water-reducible interior heading of sterilizing.
The BCR-ABL fusion gene T315I provided by the present invention fluorescence PCR detection reagent kit that suddenlys change comprises T315I abrupt climatic change reaction solution, and described T315I abrupt climatic change reaction solution comprise 10 × PCR damping fluid, deoxyribonucleoside triphosphate, for the upstream primer of amplified target polynucleotide and downstream primer and the probe for detecting target polynucleotide.BCR-ABL fusion gene T315I sudden change fluorescence PCR detection reagent kit provided by the present invention is the detection kit based on Real-Time Fluorescent Quantitative PCR Technique and ARMS-PCR technology, this detection kit has good specificity, and operation is quick, method is easy, accuracy of detection is high.
Accompanying drawing explanation
In order to be illustrated more clearly in the technical scheme in the embodiment of the present invention, below the accompanying drawing used required in describing embodiment is briefly described, apparently, for those of ordinary skills, under the prerequisite not paying creative work, other accompanying drawing can also be obtained according to these accompanying drawings.
Fig. 1 is that the BCR-ABL fusion gene T315I that provides of the embodiment of the present invention suddenlys change the amplification curve diagram of fluorescence PCR detection reagent kit to weak positive precision reference material test;
Fig. 2 is that the BCR-ABL fusion gene T315I that provides of the embodiment of the present invention suddenlys change the amplification curve diagram that fluorescence PCR detection reagent kit tests strong positive precision reference material;
Fig. 3 is that the BCR-ABL fusion gene T315I that the embodiment of the present invention provides suddenlys change fluorescence PCR detection reagent kit to the amplification curve diagram of wild type human DNA tests;
Fig. 4 is that the BCR-ABL fusion gene T315I that provides of the embodiment of the present invention suddenlys change the amplification curve diagram of fluorescence PCR detection reagent kit to the people's DNA tests containing 1%T315I transgenation.
Embodiment
The BCR-ABL fusion gene T315I sudden change fluorescence PCR detection reagent kit that the embodiment of the present invention provides, operates the BCR-ABL gene mutation detection kit quick, method is easy, detection sensitivity is high, sensing range is wide to provide a kind of.
Technical scheme in the embodiment of the present invention is understood better in order to make those skilled in the art person, and enable the above-mentioned purpose of the embodiment of the present invention, feature and advantage become apparent more, below in conjunction with accompanying drawing, the technical scheme in the embodiment of the present invention is described in further detail.
BCR-ABL fusion gene T315I that the embodiment of the present invention the provides fluorescence PCR detection reagent kit that suddenlys change comprises T315I abrupt climatic change reaction solution, and described T315I abrupt climatic change reaction solution comprises the probe for detecting target polynucleotide of 10 × PCR damping fluid of 5 μ L, the deoxyribonucleoside triphosphate of 0.2mmol/L, the upstream primer for amplified target polynucleotide of 0.2 μm of ol/L ~ 0.4 μm ol/L and downstream primer and 0.2 μm of ol/L ~ 0.4 μm ol/L.
The present invention by SeqMan and the MegAlign software in application DNAStar software package to the abl gene sequence retrieved in Genbank, tetraploid rice is carried out in BCR-ABL fusion gene T315I position, and devise 2 covers for this mutated site and respectively include an Auele Specific Primer ARMS primer, , a primed probe combination for downstream primer and a probe, through optimizing, relatively good a pair probe for amplified target polynucleotide of expanding effect and upstream and downstream primer are filtered out, this probe and primer come from people BCR-ABL fusion gene T315I sudden change place exon region.
Wherein, the base-pair sequence of this probe is: 5 ' FAM-TTCATGACCTACGGGAACCTCCTGGA-BHQ13 ';
For the upstream primer of amplified target polynucleotide and the base-pair sequence of downstream primer be:
Upstream primer: 5 '-GAGCCCCCGTTCTATATCATGAT-3 ';
Downstream primer: 5 '-AGCACCACGGCGTTCACC-3 '.
BCR-ABL fusion gene T315I that the embodiment of the present invention the provides particular location that gene is being detected in mutational site that fluorescence PCR detection reagent kit detects that suddenlys change is codon 315 place, and base be changed to ACT > ATT.Owing to have employed above-mentioned probe and upstream and downstream primer, 1% mutant human BCR-ABL fusion gene 100% can be realized under the wild-type DNA background of 50ng/ reaction to detect and wild type human BCR-ABL fusion gene zero detects, illustrate that test kit of the present invention has good specificity and extremely strong immunity from interference, greatly reduce false positive rate.
BCR-ABL fusion gene T315I that the embodiment of the present invention the provides fluorescence PCR detection reagent kit that suddenlys change comprises interior mark further, namely comprises positive internal reference, and this is interior is designated as abl gene 4 exon in BCR-ABL fusion gene.In this detection kit, this interior mark can monitor DNA extraction and PCR reaction process, and whether monitoring reaction system is effective, and then prevents the inhibition Interference Detection that may exist in sample, and makes detected result be false negative.Wherein, this interior target base-pair sequence is:
5’-GCCGAGTTGGTTCATCATCATTCAACGGTGGCCGACGGGCTCATCACCACGCTCCATTATCCAGCCCCAAAGCGCAACAAGCCCACTGTCTATGGTGTGTCCCCCAACTACGACAAGTGG-3’。
The T315I abrupt climatic change reaction solution that the embodiment of the present invention provides also comprises for detecting interior target probe, and the base-pair sequence of this probe is: 5 ' HEX-CACGCTCCATTATCCAGCCCCAAA-BHQ13 '.
Meanwhile, the embodiment of the present invention additionally provides the upstream and downstream primer for amplification interior label, and the base-pair sequence of this upstream and downstream primer is:
Upstream primer: 5 '-GCCGAGTTGGTTCATCATCATT-3 ';
Downstream primer: 5 '-ATAGACAGTGGGCTTGTTGCG-3 '.
Further, the Klorvess Liquid that the magnesium chloride solution that 10 × PCR damping fluid in the detection kit that the embodiment of the present invention provides comprises Tris-HCl (Trishydroxymethylaminomethane, i.e. Tri(Hydroxymethyl) Amino Methane Hydrochloride solution) that pH value is the 200mmol/L of 7.5, concentration is 30mmol/L, concentration are 500mmol/L, volume ratio be 0.2% Triton solution and volume ratio be the formamide soln of 10%.
Further, the deoxyribonucleoside triphosphate in the detection kit that provides of the embodiment of the present invention is dATP, dCTP, dGTP, dUTP or dTTP.
The BCR-ABL fusion gene T315I sudden change fluorescence PCR detection reagent kit that the embodiment of the present invention provides also comprises enzyme mixation, and described enzyme mixation comprises hot resistant DNA polymerase (Taq enzyme) and 0.05U/ μ l ~ 0.2U/ μ l uracil dna glycosylase (UNG enzyme) of 1U/ μ l ~ 5U/ μ l.UNG enzyme in enzyme mixation can be degraded containing the DNA chain of dU, and dUTP and UNG enzyme combinationally use the pollution that can prevent previous PCR product, prevent pattern detection false positive.
Preferably, the BCR-ABL fusion gene T315I sudden change fluorescence PCR detection reagent kit that the embodiment of the present invention provides also comprises positive control, and this positive control is the plasmid of the sequence fragment comprising interior heading and the mixture of region, BCR-ABL fusion gene T315I mutational site fragment of plasmid.
Preferably, the BCR-ABL fusion gene T315I sudden change fluorescence PCR detection reagent kit that the embodiment of the present invention provides also comprises negative control, and this negative control is the plasmid of the sequence fragment of the water-reducible interior heading of sterilizing.
BCR-ABL fusion gene T315I that the embodiment of the present invention the provides fluorescence PCR detection reagent kit that suddenlys change for the operation steps of the BCR-ABL fusion gene catastrophe in the sample of nucleic acid that detects paraffin section and extract is:
S01: take out each component in packing box, room temperature is placed, and after its temperature equilibrium to room temperature, each component is mixed respectively, for subsequent use;
S02: according to the quantity of sample to be tested, negative control, positive control, gets T315I abrupt climatic change reaction solution and enzyme mixation that volume ratio is 43:2, is fully mixed evenly and forms PCR-mix, for subsequent use after brief centrifugation;
S03: use business-like paraffin section nucleic acid extraction kit to extract DNA, for subsequent use;
S04: the PCR-mix adding 45 μ l according to the quantity of sample to be tested, negative control, positive control in each reaction tubes, and get step S03 for subsequent use sample DNA, negative control, each 5 μ l of positive control join in above-mentioned PCR-mix, build pipe lid, form testing sample;
S05: testing sample is placed on fluorescent quantitative PCR instrument and tests.
Further, testing sample is placed on and fluorescent quantitative PCR instrument (for ABI7500 instrument) carries out test pack draws together following steps:
(1) PCR reaction tubes is put into amplification instrument sample cell, sample to be tested title concentration is set by correspondence order;
(2) fluorescence detection channel is selected: select FAM passage (Reporter:FAM, Quencher:None); Interior mark selects HEX or VIC passage (Reporter:VIC, Quencher:None).Reference fluorescent (PassiveReference) is set to ROX.
(3) quantitative fluorescent PCR reaction conditions refers to table 1.
Table 1: quantitative fluorescent PCR reaction conditions
(4) setting completed, preserves file, runs response procedures.
Interpretation of result
After reaction terminates, the automatic saving result of instrument, the software that instrument can be utilized to carry carries out automatic analysis (also can the starting value of manual regulation baseline, end value and threshold line value analyze), then records sample Ct value and result.The intersection point of amplification curve and threshold line, is called Ct (i.e. cyclethreshold, the cycling numerical value experienced when the fluorescent signal referring in PCR reaction tubes reaches the threshold value of setting); Instrument software, according to each sample Ct value size, can judge detected result.If sample amplification curve is S-type, there is Ct value and Ct value≤39, can the positive be judged as; If sample amplification curve is straight, and without Ct value display (Undet) display, feminine gender can be judged to.
(1) specific test
The detection kit that theres is provided of the embodiment of the present invention is used to detect yin and yang attribute enterprise work reference material, in this test, the wild type human DNA of negative operating reference product to be concentration be 25ng/ μ L; Positive operating reference product are T315I mutant plasmids that concentration is respectively 6000copies/ μ L, 1500copies/ μ L and 112.5copies/ μ L.The detected result obtained by above-mentioned test is yin and yang attribute reference material coincidence rate is 100%, meets quality standard, and this illustrates that the detection kit that the embodiment of the present invention provides has good specificity.
(2) precision test
The detection kit that the embodiment of the present invention provides carries out Fluorescence PCR test respectively to weak positive precision reference material and strong positive precision reference material, and this test often organizes repetition 10 times, and the test result of reaction please refer to accompanying drawing 1 and accompanying drawing 2.In this test, weak positive precision reference material is the mixture of wild type human DNA and T315I mutant plasmid, and the percentage of wherein T315I sudden change is 1.5%; Strong positive precision reference material is the mixture of wild type human DNA and T315I mutant plasmid, and the percentage wherein containing T315I sudden change is 80%.Can find out from accompanying drawing 1 and accompanying drawing 2, all there is Ct value in twice test, and the Ct value in accompanying drawing 1 has good amplification curve from 33-45, Ct value in accompanying drawing 2 has good amplification curve from 25-45, and linearity range is good, batch in and batch between reproducible, the equal <5% of the variation coefficient of Ct value, it can be said that bright detection kit has good precision.
(3) sensitivity and wild-type tolerance
Please refer to accompanying drawing 3 and accompanying drawing 4, accompanying drawing 3 and the BCR-ABL fusion gene T315I fig. 4 illustrating the embodiment of the present invention and provide suddenly change fluorescence PCR detection reagent kit to wild type human DNA and the amplification curve diagram carrying out Fluorescence PCR test containing the people DNA of 1%T315I sudden change.
As can be seen from accompanying drawing 3, have no amplification curve the detection kit that the embodiment of the present invention provides is by carrying out Fluorescence PCR test during to wild type human DNA, and coincidence rate is 100%.As can be seen from accompanying drawing 4, occur obvious amplification curve when the detection kit that the embodiment of the present invention provides is by carrying out Fluorescence PCR test to the people DNA containing 1%T315I sudden change, and the repeatability of amplification curve is fine, and coincidence rate is 100%.By relatively can drawing of above-mentioned two tests, the detection kit that the embodiment of the present invention provides can not detect wild type human DNA, and still can detect when the T315I sudden change concentration of people DNA is very little, and there is amplification curve, it can be said that bright detection kit provided by the present invention has higher sensitivity and extremely strong immunity from interference, greatly reduce false positive rate, thus reach the object directly distinguishing saltant type and wild type gene.
BCR-ABL fusion gene T315I that the embodiment of the present invention the provides fluorescence PCR detection reagent kit that suddenlys change comprises T315I abrupt climatic change reaction solution, and described T315I abrupt climatic change reaction solution comprise 10 × PCR damping fluid, deoxyribonucleoside triphosphate, for the upstream primer of the Auele Specific Primer ARMS of amplified target polynucleotide and downstream primer and the probe for detecting target polynucleotide.BCR-ABL fusion gene T315I sudden change fluorescence PCR detection reagent kit provided by the present invention is the detection kit based on Real-Time Fluorescent Quantitative PCR Technique and ARMS-PCR technology, this detection kit can realize 1% mutant human T315I gene 100% and to detect and wild type human abl gene zero detects under the wild-type DNA background of 50ng/ reaction, thus illustrate that this detection kit has good specificity and extremely strong immunity from interference, greatly reduce false positive rate, and operation fast, method is easy, accuracy of detection is high, in increasing in reaction system, mark can effectively prevent from detecting in false negative simultaneously.BCR-ABL fusion gene T315I that the embodiment of the present invention provides suddenly change fluorescence PCR detection reagent kit batch in and reproducible between criticizing, and the variation coefficient <5% of Ct value.
Above-described embodiment of the present invention, does not form limiting the scope of the present invention.Any amendment done within the spirit and principles in the present invention, equivalent replacement and improvement etc., all should be included within protection scope of the present invention.
Claims (10)
1. a BCR-ABL fusion gene T315I sudden change fluorescence PCR detection reagent kit, it is characterized in that, described detection kit comprises T315I abrupt climatic change reaction solution, and described T315I abrupt climatic change reaction solution comprise 10 × PCR damping fluid, deoxyribonucleoside triphosphate, for the upstream primer of amplified target polynucleotide and downstream primer and the probe for detecting target polynucleotide;
The base-pair sequence of the described probe for detecting target polynucleotide is:
5’FAM-TTCATGACCTACGGGAACCTCCTGGA-BHQ13’。
2. BCR-ABL fusion gene T315I sudden change fluorescence PCR detection reagent kit according to claim 1, it is characterized in that, the base-pair sequence of the described upstream primer for amplified target polynucleotide and downstream primer is:
Upstream primer: 5 '-GAGCCCCCGTTCTATATCATGAT-3 ';
Downstream primer: 5 '-AGCACCACGGCGTTCACC-3 '.
3. BCR-ABL fusion gene T315I sudden change fluorescence PCR detection reagent kit according to claim 2, it is characterized in that, described detection kit also comprises interior mark, is designated as abl gene 4 exon in BCR-ABL fusion gene in described, and described interior target sequence is:
5’-GCCGAGTTGGTTCATCATCATTCAACGGTGGCCGACGGGCTCATCACCACGCTCCATTATCCAGCCCCAAAGCGCAACAAGCCCACTGTCTATGGTGTGTCCCCCAACTACGACAAGTGG-3’。
4. BCR-ABL fusion gene T315I sudden change fluorescence PCR detection reagent kit according to claim 3, it is characterized in that, described T315I abrupt climatic change reaction solution also comprises for detecting interior target probe, and in described detection, the base-pair sequence of target probe is:
5’HEX-CACGCTCCATTATCCAGCCCCAAA-BHQ13’。
5. BCR-ABL fusion gene T315I according to claim 4 suddenlys change fluorescence PCR detection reagent kit, it is characterized in that, described T315I abrupt climatic change reaction solution also comprises upstream primer for amplification interior label and downstream primer; The base-pair sequence of described upstream primer and downstream primer is:
Upstream primer: 5 '-GCCGAGTTGGTTCATCATCATT-3 ';
Downstream primer: 5 '-ATAGACAGTGGGCTTGTTGCG-3 '.
6. BCR-ABL fusion gene T315I sudden change fluorescence PCR detection reagent kit according to claim 5, it is characterized in that, described 10 × PCR damping fluid comprises Tri(Hydroxymethyl) Amino Methane Hydrochloride solution that pH value is the 200mmol/L of 7.5, Klorvess Liquid that magnesium chloride solution that concentration is 30mmol/L, concentration are 500mmol/L, volume ratio be 0.2% Triton solution and volume ratio be the formamide soln of 10%.
7. BCR-ABL fusion gene T315I sudden change fluorescence PCR detection reagent kit according to claim 5, it is characterized in that, described deoxyribonucleoside triphosphate is dATP, dCTP, dGTP, dUTP or dTTP.
8. according to the BCR-ABL fusion gene T315I sudden change fluorescence PCR detection reagent kit in claim 1-7 described in any one, it is characterized in that, described detection kit also comprises enzyme mixation, and described enzyme mixation comprises hot resistant DNA polymerase and 0.05U/ μ l ~ 0.2U/ μ l uracil dna glycosylase of 1U/ μ l ~ 5U/ μ l.
9. BCR-ABL fusion gene T315I sudden change fluorescence PCR detection reagent kit according to claim 8, it is characterized in that, described detection kit also comprises positive control, and described positive control is the plasmid of the sequence fragment comprising interior heading and the mixture of region, BCR-ABL fusion gene T315I mutational site fragment of plasmid.
10. BCR-ABL fusion gene T315I sudden change fluorescence PCR detection reagent kit according to claim 8, it is characterized in that, described detection kit also comprises negative control, and described negative control is the plasmid of the sequence fragment of the water-reducible interior heading of sterilizing.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201510888491.2A CN105349681A (en) | 2015-12-07 | 2015-12-07 | BCR-ABL fusion gene T315I mutation fluorescent PCR detection kit |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201510888491.2A CN105349681A (en) | 2015-12-07 | 2015-12-07 | BCR-ABL fusion gene T315I mutation fluorescent PCR detection kit |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN105349681A true CN105349681A (en) | 2016-02-24 |
Family
ID=55325741
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201510888491.2A Pending CN105349681A (en) | 2015-12-07 | 2015-12-07 | BCR-ABL fusion gene T315I mutation fluorescent PCR detection kit |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN105349681A (en) |
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN110997938A (en) * | 2017-04-26 | 2020-04-10 | 大塚制药株式会社 | Method for determining expression level of ABL 1T 315I mutation |
| CN113151459A (en) * | 2021-01-27 | 2021-07-23 | 青岛大学附属医院 | Fluorescence detection method of BCR-ABL1 mutant gene T315I and application thereof |
Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101984071A (en) * | 2010-09-21 | 2011-03-09 | 广州益善生物技术有限公司 | Bcr-Abl gene mutation detection liquid-phase chip |
| CN104372095A (en) * | 2014-11-14 | 2015-02-25 | 辽宁迈迪生物科技有限公司 | Primer, probe and kit for detecting human BCR-ABL gene mutation |
-
2015
- 2015-12-07 CN CN201510888491.2A patent/CN105349681A/en active Pending
Patent Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101984071A (en) * | 2010-09-21 | 2011-03-09 | 广州益善生物技术有限公司 | Bcr-Abl gene mutation detection liquid-phase chip |
| CN104372095A (en) * | 2014-11-14 | 2015-02-25 | 辽宁迈迪生物科技有限公司 | Primer, probe and kit for detecting human BCR-ABL gene mutation |
Non-Patent Citations (3)
| Title |
|---|
| JEAN-CLAUDE CHOMEL ET AL.: "Quantitative monitoring of the T315I mutation in patients with chronic myeloid leukemia (CML)", 《LEUKEMIA RESEARCH》 * |
| LIHUI YIN, DAVID DITTMAN, AND ANJEN CHENN31: "Rapid Quantitative Detection of the T315I Mutation in Patients With Chronic Myelogenous Leukemia", 《DIAGNOSTIC MOLECULAR PATHOLOGY》 * |
| 张均田，杜冠华: "《现代药理试验方法 上》", 31 July 2012 * |
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN110997938A (en) * | 2017-04-26 | 2020-04-10 | 大塚制药株式会社 | Method for determining expression level of ABL 1T 315I mutation |
| CN113151459A (en) * | 2021-01-27 | 2021-07-23 | 青岛大学附属医院 | Fluorescence detection method of BCR-ABL1 mutant gene T315I and application thereof |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN104099425B (en) | A kind of test kit for detecting B-raf transgenation | |
| Hughes et al. | Molecular monitoring of BCR–ABL as a guide to clinical management in chronic myeloid leukaemia | |
| CN105296666A (en) | Fluorescent PCR detecting kit for V600E mutation of BRAF gene | |
| CN103074434B (en) | CYP2C19 gene polymorphyism detection kit and detection method thereof | |
| CN105624309A (en) | Primer, probe and kit for detecting EGFR and/or K-ras genetic mutation | |
| CN102827937A (en) | Primer and probe for detecting relative fusion genes of leukemia and kit of primer and probe | |
| CN109576372A (en) | A kind of nucleic acid sequence and its application for BRAF gene V600E abrupt climatic change | |
| CN109457024A (en) | Shr gene polymorphism fluorescent PCR solubility curve detection kit and application | |
| WO2006106316A2 (en) | Polynucleotide primers | |
| CN107988369A (en) | Kit that is a kind of while detecting 45 mutational sites of Human epidermal growth factor receptor gene | |
| CN104531881A (en) | Fluorescence PCR detection kit for human K-RAS gene mutation | |
| CN113718021A (en) | Primer, probe and kit for quantitatively detecting BCR-ABL1 fusion gene | |
| CN106434874A (en) | Droplet PCR (Polymerase Chain Reaction) kit for detecting mutation of human KRAS gene | |
| CN105349681A (en) | BCR-ABL fusion gene T315I mutation fluorescent PCR detection kit | |
| CN105441577A (en) | Probe, primer and kit for detecting 7 mutations of human CKIT gene | |
| CN108642156A (en) | A kind of the digital pcr detection kit and its detection method of T790M gene mutations | |
| CN105349682A (en) | C-KIT gene D816V mutation fluorescent PCR detection kit | |
| Nishikawa et al. | Selective gene amplification to detect the T790M mutation in plasma from patients with advanced non-small cell lung cancer (NSCLC) who have developed epidermal growth factor receptor tyrosine kinase inhibitor (EGFR-TKI) resistance | |
| CN111500687A (en) | Breast cancer 21 gene detection kit | |
| WO2020134950A1 (en) | Gene mutation/fusion combination and kit for identification of benign and malignant pulmonary nodules | |
| CN105969908A (en) | CTNNB1 third exon mutation detection primer probes and kit thereof | |
| CN105316426A (en) | TPMT (thiopurine S-methyltransferase) genetic polymorphism detection kit | |
| CN106636365B (en) | Nucleic acid, kit and method for detecting A1166C polymorphic site of AGTR1 gene | |
| CN110358825A (en) | Detect the kit and its application method of people BCR-ABL fusion | |
| CN109112187A (en) | A kind of kit for the ARMS-ddPCR detection gene mutation that closing probe mediates |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| CB03 | Change of inventor or designer information |
Inventor after: Dai Lizhong Inventor after: Wu Kang Inventor after: Tang Lian Inventor after: Long Fengying Inventor before: Dai Lizhong Inventor before: Wu Kang Inventor before: Tang Lian Inventor before: Huang Linmi |
|
| COR | Change of bibliographic data | ||
| RJ01 | Rejection of invention patent application after publication |
Application publication date: 20160224 |
|
| RJ01 | Rejection of invention patent application after publication |