CN102827937A

CN102827937A - Primer and probe for detecting relative fusion genes of leukemia and kit of primer and probe

Info

Publication number: CN102827937A
Application number: CN2012103275473A
Authority: CN
Inventors: 熊慧; 程新建; 谢立群; 陈嘉铮; 包文静; 童光铨; 陈伟
Original assignee: SHANGHAI YUANQI BIOLOGICAL MEDICAL TECHNOLOGY Co Ltd
Current assignee: SHANGHAI YUANQI BIOLOGICAL MEDICAL TECHNOLOGY Co Ltd
Priority date: 2012-09-06
Filing date: 2012-09-06
Publication date: 2012-12-19
Anticipated expiration: 2032-09-06
Also published as: CN102827937B

Abstract

The invention relates to detection of genotypes, in particular to a primer and a probe for detecting relative fusion genes of leukemia and a kit of the primer and the probe. The kit can qualitatively detect quantity of BCR-ABL, AML1-ETO and PML-RARa of the relative fusion genes of the leukemia in human marrow specimens so as to instruct clinical diagnosis and pharmacy of the leukemia.

Description

A kind of primer and probe and test kit thereof that detects the relevant fusion gene of white blood disease

Technical field

The present invention relates to genotypic detection, specifically, relate to a kind of primer and probe and test kit thereof that detects the relevant fusion gene of white blood disease.

Background technology

White blood disease (Leukemia) is a malignant tumor of hematopoiesis system; It is characterized in that one or more hemocyte generation malignant proliferations in the hemopoietic systems such as marrow, lymphoglandula; And respectively organize internal organs in the infiltration body, and cause the normal hematopoiesis histocyte to be suppressed, produce various symptoms.Often with heating, hemorrhage, anaemia, liver, spleen, the enlargement of lymph node is characteristics greatly clinically for white blood disease.White blood disease generally can be divided into acute leukemia (AL) and chronic leukemia (CL) by natural history and cell development degree; According to leukemia cell's form and biochemical character, can be divided into acute lymphoblastic leukemia (ALL), acute nonlymphocytic leukemia (ANLL), chronic myelocytic leukemia (CML), leukemia chronic myelo-monocytic (CMML) etc. again.

White blood disease is one of domestic ten big malignant tumours occurred frequently, and its sickness rate is 2.76/10 ten thousand populations, and China estimates at 50,000 above patients, and leukaemic's quantity increases just year by year.Though leukemic sickness rate is arranged the 6th in tumor incidence, in the M & M of children and teenager's malignant tumour, all account for the 1st.

Recent clinical studies shows that there are some chromosome aberration in most of white blood disease and lymphoma, like transposition, disappearance, insertion etc.Can produce new fusion gene under most of situation during these chromosome translocation distortion, these fusion genes can be used as and are used to diagnose dissimilar white blood disease and lymphadenomatous molecular marker.Dissimilar leukemia chemotherapies is different with the scheme of radiotherapy.So, these molecule markers are carried out check and analysis help confirming of regimen and analyze prognosis.Therefore, the white blood disease of World Health Organization's issue in 2000 and Lymphoma Diagnosis standard detect fusion gene after the chromosome translocation as one of most important index.

It is the most deep part of studying in each quasi-leukemia that the BCR-ABL fusion gene is expressed, and BCR-ABL is relevant with the chromosomal formation in Philadelphia (Ph), is modal chromosome abnormalty in the white blood disease.Can detect this Ph karyomit(e) among the CML patient of about 90%-95%.The molecular basis that Ph karyomit(e) forms is to form the BCR-ABL fusion gene on No. 9 bcr genes on c-ab1 group translocation to 22 karyomit(e) on the karyomit(e), and promptly t (9; 22) (q34; Q11) transposition.Clinically detect Ph karyomit(e) as the CML classification diagnosis according to, therapeutic evaluation, and the reliability index of the detection of minimal residual disease and prognosis evaluation.In addition, what deserves to be mentioned is, in CML; The CML patient that some Ph karyomit(e) is negative, its BCR-ABL fusion gene is also positive, and this possibly be that a part of Ph karyomit(e) is difficult for seeing clearly; According to statistics; In patient CML, the positive rate of BCR-ABL fusion gene is 99%, and this more cytogenetic method of detection that molecular level also is described is more responsive.In addition, in acute lymphoblastic leukemia, also exist t (9; 22) (q34; Q11) transposition forms the BCR-ABL fusion gene.

T (15; 17) (q22; Q12-21) transposition is shown among the ANLL of 10%-15%, is found among the APL more than 90%, becomes the special sign of APL, and transposition produces the PML-RARa fusion gene.PML gene (promyelocytic leukemia gene) is positioned at karyomit(e) No. 15; Total length 50kb; Its various structure territory is by different exons codings, exons 1 coding proline(Pro) active region, exon 2 coding zinc fingers; Exon 3 coding and Dimerized relevant spirane structure, exon 4-6 coding a helical region.The PML-RARa fusion gene can be used as the molecular indexes of the small Restzustand of monitoring white blood disease; It is detected help further to understand the dynamics that the leukaemic is alleviated leukemia cell in the body of back; Obtain a new standard of alleviating fully of confirming from molecular level, thereby can make correct evaluation, in time adjust regimen the clinical treatment reaction; Alleviate patient's economical load, reduce the unnecessary misery that chemotherapy caused simultaneously.

T (8; 21) (q22; Q22) be modal chromosome translocation among the AM, incidence can be up to 20%-40%, and 90% is shown in the M2b type white blood disease, and transposition causes the generation of AML1-ETO fusion gene.The AML1-ETO fusion gene positive is prognosis bona's a sign, and it is alleviated (CR) rate fully and can reach 90%, 5 year long-term DFS and can reach 50%-70%.Adopt the chromosome karyotype analysis result to detect the result that this fusion gene obtains contradiction sometimes, it is carried out fluorescent quantitation detect and to carry out classification to patient's the state of an illness, thereby carry out judgement of prognosis more accurately and recurrence detection.

At present leukemic inspection is mainly contained, hemogram checking, examination of bone marrow smear, blood biochemistry checking etc., but these do not check to fusion gene that all the resultant error scope of acquisition is also bigger.The method that detects fusion gene at present mainly comprises fluorescence in situ hybridization technique (FISH), PCR and gene chip etc.But these methods exist defectives such as poor accuracy, complicated operation, the clinical application difficulty.

In order to help clinicians accurately and timely to detect leukemia fusion gene, auxiliary confirm to be correlated with chemotherapy regimen and recurrence detection; The present invention is from China's actual conditions; Developed the relevant fusion gene detection kit of white blood disease; The RNA amount of BCR-ABL, AML1-ETO and PML-RARa in the relevant fusion gene of white blood disease in this test kit ability qualitative detection people bone marrow prepare, thus white blood disease clinical diagnosis and medication instructed.

Summary of the invention

The present invention relates to a kind of primer that detects the relevant fusion gene of white blood disease and probe, test kit.

In order to accomplish the object of the invention, the technical scheme of employing is:

The present invention relates to a kind of primer and probe that detects the relevant fusion gene of white blood disease, wherein, the nucleotides sequence of said primer and probe is classified as:

(1) primer and the probe that are used to detect the BCR-ABL fusion gene are: by the upstream primer F1 shown in the SEQ ID NO:1; By the upstream primer F2 shown in the SEQ ID NO:2; By the upstream primer F3 shown in the SEQ ID NO:3, by the downstream primer shown in the SEQ ID NO:4, by the probe shown in the SEQ ID NO:5; Wherein 5 ' of the nucleotide sequence shown in SEQ ID NO:5 end has the Fam mark, and 3 ' end has the Tamara mark;

(2) primer and the probe that are used to detect the PML-RARa fusion gene are: by the upstream primer F1 shown in the SEQ ID NO:6; By the upstream primer F2 shown in the SEQ ID NO:7; By the upstream primer F3 shown in the SEQ ID NO:8, by the downstream primer shown in the SEQ ID NO:9, by the probe shown in the SEQ ID NO:10; Wherein 5 ' of the nucleotide sequence shown in SEQ ID NO:10 end has the Fam mark, and 3 ' end has the Tamara mark;

(3) primer and the probe that are used to detect the AML1-ETO fusion gene are: by the upstream primer F1 shown in the SEQ ID NO:11; By the downstream primer shown in the SEQ ID NO:12; By the probe shown in the SEQ ID NO:13; Wherein 5 ' of the nucleotide sequence shown in SEQ ID NO:13 end has the Fam mark, and 3 ' end has the Tamara mark.

The invention still further relates to a kind of primer and the test kit of probe that detects the relevant fusion gene of white blood disease, the consisting of of described test kit: described test kit comprises nucleic acid amplification reagent, reference substance and reference article, and wherein, described nucleic acid amplification reagent comprises:

Table 1:

Sequence number	Component	Major ingredient in the component
			1	Detect the RT-PCR reaction solution 1 of BCR-ABL fusion gene	Primer, probe, dNTPs, buffer;
2	Detect the RT-PCR reaction solution 2 of PML-RARa fusion gene	Primer, probe, dNTPs, buffer;
			3	Detect the RT-PCR reaction solution 3 of AML1-ETO fusion gene	Primer, probe, dNTPs, buffer;

4	RT confidential reference items PCR reaction solution	Primer, probe, dNTPs, buffer;
			5	With reference to article PCR reaction solution	Primer, probe, dNTPs, buffer;
6	Mixed enzyme solution I	RT enzyme, Taq enzyme, UNG enzyme;
			7	Mixed enzyme solution II	Taq enzyme, UNG enzyme.

First optimal technical scheme of test kit of the present invention is:

Contain in the RT-PCR reaction solution 1 of detection BCR-ABL fusion gene: 5 * Buffer liquid, 5 μ l; Each 0.25 μ l of the dNTPs of 10mmol/L; Each 0.12 μ l of the SEQ ID NO:1 of 50 μ mol/L～SEQ ID NO:5; 50 μ mol/L SEQ ID NO:50.1 μ l complement to 8 μ l with process water;

Contain in the RT-PCR reaction solution 2 of detection PML-RARa fusion gene: 5 * Buffer liquid, 5 μ l; Each 0.25 μ l of the dNTPs of 10mmol/L; Each 0.12 μ l of the SEQ ID NO:6 of 50 μ mol/L～SEQ ID NO:10; 50 μ mol/L SEQ ID NO:100.1 μ l complement to 8 μ l with process water;

The primer and the probe that are used for detecting the AML1-ETO fusion gene are for containing: 5 * Buffer liquid, 5 μ l; Each 0.25 μ l of the dNTPs of 10mmol/L; Each 0.12 μ l of the SEQ ID NO:11 of 50 μ mol/L～SEQ ID NO:12; 50 μ mol/LSEQ ID NO:130.1 μ l complement to 8 μ l with process water;

Contain in the RT confidential reference items PCR reaction solution: 5 * Buffer liquid, 5 μ l; Each 0.25 μ l of the dNTPs of 10mmol/L; Each 0.12 μ l of the SEQ ID NO:14 of 50 μ mol/L～SEQ ID NO:16,50 μ mol/L SEQ ID NO:160.1 μ l complement to 8 μ l with process water; Wherein, By the upstream primer shown in the SEQ ID NO:14, by the downstream primer shown in the SEQ ID NO:15, by the probe shown in the SEQ ID NO:16; Wherein 5 ' of the nucleotide sequence shown in SEQ ID NO:16 end has the Fam mark, and 3 ' end has the Tamara mark;

With reference to containing in the article PCR reaction solution: 5 * Buffer liquid, 5 μ l; Each 0.25 μ l of the dNTPs of 10mmol/L; Each 0.12 μ l of the SEQ ID NO:17 of 50 μ mol/L～SEQ ID NO:18,50 μ mol/L SEQ ID NO:16,0.1 μ l complements to 8 μ l with process water; Wherein, by the upstream primer shown in the SEQ ID NO:17, by the downstream primer shown in the SEQ ID NO:18.

Second optimal technical scheme of test kit of the present invention is:

Table 2:

Sequence number	Component	Major ingredient in the component
			8	Negative control	Process water;
9	Positive control 1	Cell lysate;
			10	Positive control 2	The plasmid mixed solution.

Contain K562, NB4 and Kasumi cell lysate in the described positive control 1, concentration is 2.5 * 103cells/ml; Described positive control 2 is for containing the segmental four kinds of plasmids of BCR-ABL, PML-RARa, AML1-ETO and abl gene purpose respectively, and its nucleotide sequence is respectively SEQ ID NO:19～SEQ ID NO:27, and concentration is 1pg/ml.

Wherein, the K562 cell lysate is that BCR-ABL fusion gene male K562 cell lysate, NB4 cell lysate PML-RARa fusion gene male NB4 cell lysate, Kasumi cell lysate are AML1-ETO fusion gene male Kasumi cell lysate.

The 3rd optimal technical scheme of test kit of the present invention is:

Table 3:

Sequence number	Component	Major ingredient in the component
			11	With reference to article 1:1 * 10 ⁶copies	Plasmid liquid;
12	With reference to article 2:1 * 10 ⁵copies	Plasmid liquid;
			13	With reference to article 3:1 * 10 ⁴copies	Plasmid liquid;
14	With reference to article 4:1 * 10 ³copies	Plasmid liquid;

Described plasmid liquid is for containing the segmental DNA liquid of abl gene purpose, and its nucleotides sequence is classified SEQ ID NO:27 as.

The 4th optimal technical scheme of test kit of the present invention is: said test kit is the OD of the RNA that carries to the requirement that detects sample ₂₆₀/ OD ₂₈₀1.8～2.0.

The invention still further relates to the method for use of this test kit, may further comprise the steps:

(1) sample process: extract RNA nucleic acid; Negative control, positive control 1 are handled with sample simultaneously

Going bail for exists the sample 400 μ l in the Trizol, adds the 400ul chloroform, mixing, and room temperature was placed 5 minutes; Centrifugal 10 minutes of 15000rpm, colourless supernatant is drawn in centrifugal back, adds isopyknic buffer RLT, mixing,

Concrete steps are following:

5. going bail for exists the sample 400 μ l in the Trizol, adds 400 μ l chloroforms, mixing, and room temperature was placed 5 minutes; Centrifugal 10 minutes of 15000rpm, colourless supernatant is drawn in centrifugal back;

6. the Virahol that in above-mentioned supernatant, adds the equal-volume precooling, put upside down mixing after room temperature placed 10 minutes; Centrifugal 10 minutes of 15000rpm inhales and abandons supernatant;

7. in above-mentioned centrifuge tube, add 70% ethanol of 300 μ l precoolings, centrifugal 5 minutes of 15000rpm inhales and abandons supernatant; Room temperature 10 minutes makes the ethanol volatilization;

8. add 200ul DEPC-ddH ₂The dissolving of O mixing is with this template as relevant PCR reaction.

(2) amplifing reagent is prepared:

Take-off pipe 1～7 from test kit, behind room temperature thawing and the vibration mixing, and of short duration centrifugal 1～8 second;

The preparation of sample PCR premixed liquid system:

Get RT-PCR reaction solution 18 μ l, add mixed enzyme solution I 2 μ l; Single sample preparation 4 pipes;

Get RT-PCR reaction solution 28 μ l, add mixed enzyme solution I 2 μ l; Single sample preparation 4 pipes;

Get RT-PCR reaction solution 38 μ l, add mixed enzyme solution I 2 μ l; Single sample preparation 4 pipes;

Get RT-confidential reference items PCR reaction solution 8 μ l, add mixed enzyme solution I 2 μ l; Single sample preparation 4 pipes;

Preparation with reference to article PCR premixed liquid system:

Get with reference to article PCR reaction solution 8 μ l, add mixed enzyme solution II 2 μ l; Preparation 4 pipes;

(3) application of sample:

Get 15 μ l from the sample to be tested pipe, join respectively in the PCR pipe that sample PCR premixed liquid system is housed;

Get 15 μ l from positive control 1 pipe that extracting is good, join respectively in the PCR pipe that sample PCR premixed liquid system is housed;

Get 15 μ l from positive control 2 pipes, join respectively in the PCR pipe that sample PCR premixed liquid system is housed;

Get 15 μ l from the good negative control pipe of extracting, join respectively in the PCR pipe that sample PCR premixed liquid system is housed;

Add to the PCR pipe that is equipped with reference to article PCR premixed liquid system from getting 15 μ l respectively, cover tight Guan Gai, it is moved to detection zone with reference to article 1～4 pipe;

(4) pcr amplification:

ABI PRISM fluorescence PCR detection system amplification condition: 42 ℃, 30min; 94 ℃, 5min; (94 ℃, 15sec; 60 ℃, 60sec) 40 circulations; Reaction system is 25ul; , PCR circulation second collects fluorescent signal when going on foot 60 ℃; Sense channel is: FAM-TAMRA, and reference fluorescence is set at none;

StratagenePCR fluorescence detector amplification condition: 42 ℃, 30min; 94 ℃, 5min; (94 ℃, 45sec; 60 ℃, 80sec) 40 circulations; Reaction system is 25ul; , PCR circulation second collects fluorescent signal when going on foot 60 ℃; Sense channel is: FAM-TAMRA

(5) detect:

(1) confirm baseline: selecting 3～15 round-robin mean fluorecence signals is baseline;

(2) confirm threshold value: do not have at negative control under the situation of amplification, threshold setting is at the vertex of no amplification curve sample, and negative control do not detect, and confirms as initiation threshold;

(3) computingmachine is handled and analytical data automatically.

This law also relates to the authentication method of said test kit, may further comprise the steps:

(1) availability deciding:

Four C with reference to article _TValue is less than 36.0, and the absolute value of typical curve degree of fitting is judged to be effectively more than or equal to 0.9; Otherwise it is quantitatively invalid to be regarded as;

Table 4:

(2) result judges:

After amplification finishes, analyze with the typical curve that obtains, obtain the detectable level of internal control gene in each sample;

A. as sample internal control gene C _TBe worth≤36 o'clock:

If the correlation detection gene C of sample _TValue≤36, it is positive then to be reported as its correlation detection gene;

If the correlation detection gene C of sample _TValue>=38 or show " Undet ", it is negative or be lower than minimum detection limit then to be reported as its correlation detection gene;

If the correlation detection gene C of 36＜sample _TValue＜38 then needs this sample is strengthened the RNA amount of getting, detects again, in order to avoid because the RNA add-on is very few, and produce omission;

B. as sample internal control gene C _TWhen value＞36 or demonstration " Undet ":

Have inhibition or RNA add-on not enough in the ability sample, suggestion is carried out the extracting of RNA again or is carried out collection of specimens again and strengthen the PCR experiment of being correlated with again after the RNA amount of getting;

Table 5:

Wherein, for the patient after the treatment, internal control gene RNA detectable level adopts 1 * 10 ⁶Copies.

Do further explanation and explanation in the face of content of the present invention down:

The technical superiority of test kit of the present invention is: the contriver is from China's actual conditions; Invented the relevant fusion gene detection kit of a kind of white blood disease; The RNA amount of BCR-ABL, AML1-ETO and PML-RARa in the relevant fusion gene of white blood disease in this test kit ability qualitative detection people bone marrow prepare, thus white blood disease clinical diagnosis and medication instructed.

The primer and the probe that are used to detect the BCR-ABL fusion gene are:

Table 6:

Title	Sequence	Modify
			SEQ?ID?NO：1	CTGGCCCAACGATGGCGA	Do not have
SEQ?ID?NO：2	TCCGCTGACCATCAATAAGGA	Do not have
			SEQ?ID?NO：3	TGGAGGAGGTGGGCATCTAC	Do not have
SEQ?ID?NO：4	CACTCAGACCCTGAGGCTCAA	Do not have
			SEQ?ID?NO：5	CCCTTCAGCGGCCAGTAGCATCTGA	5’Fam，3’Tamara

The primer and the probe that are used to detect the PML-RARa fusion gene are:

Table 7:

Title	Sequence	Modify
			SEQ?ID?NO：6	TCTTCCTGCCCAACAGCAA	Do not have
SEQ?ID?NO：7	ACCTGGATGGACCGCCTAG	Do not have

?SEQ?ID?NO：8	CCGATGGCTTCGACGAGTT	Do not have
			?SEQ?ID?NO：9	GCTTGTAGATGCGGGGTAGAG	Do not have
?SEQ?ID?NO：10	AGTGCCCAGCCCTCCCTCGC	5’Fam，3’Tamara

The primer and the probe that are used to detect the AML1-ETO fusion gene are:

Table 8:

Title	Sequence	Modify
			?SEQ?ID?NO：11	CACCTACCACAGAGCCATCAAA	Do not have
?SEQ?ID?NO：12	ATCCACAGGTGAGTCTGGCATT	Do not have
			?SEQ?ID?NO：13	AACCTCGAAATCGTACTGAGAAGCACTCCA	?5’Fam，3’Tamara

Wherein, the primer of confidential reference items reaction is:

Table 9:

Title	Sequence	Modify
			?SEQ?ID?NO：14	TGGAGATAACACTCTAAGCATAACTAAAGGT	Do not have
?SEQ?ID?NO：15	GATGTAGTTGCTTGGGACCCA	Do not have
			?SEQ?ID?NO：16	CCATTTTTGGTTTGGGCTTCACACCATT	5’Fam，3’Tamara

Primer with reference in the article PCR reaction solution is:

Table 10:

Title	Sequence	Modify
			?SEQ?ID?NO：17	TGGAGATAACACTCTAAGCATAACTAAAGGT	Do not have
?SEQ?ID?NO：18	GATGTAGTTGCTTGGGACCCA	Do not have

The nucleotides sequence of BCR-ABL gene fragment is classified as:

Table 11:

Title	The different genes type of fusion gene
		?SEQ?ID?NO：19	BCR-ABL-190(ela2)
?SEQ?ID?NO：20	BCR-ABL-210(b2a2)
		?SEQ?ID?NO：21	BCR-ABL-210(b3a2)
?SEQ?ID?NO：22	BCR-ABL-230(e19a2)

The nucleotides sequence of PML-RARa gene fragment is classified as:

Table 12:

Title	The different genes type of fusion gene
		?SEQ?ID?NO：23	PML-RARA-L
?SEQ?ID?NO：24	PML-RARA-S
		?SEQ?ID?NO：25	PML-RARA-V

The nucleotides sequence of AML1-ETO gene fragment is classified as:

Table 13:

Title	Fusion gene
		?SEQ?ID?NO：26	AML1-ETO

The segmental nucleotides sequence of abl gene is classified as:

Table 14:

Title	Fusion gene
		?SEQ?ID?NO：27	Abl gene, gene order number is NM_005157.4

In technological design; The present invention optimizes the pcr amplification system; And consumption, reaction volume and the method for extracting of experiment sample be optimized; Guarantee extracting under the minimum prerequisite of patient's sample, farthest the transcript to relevant fusion gene in the leukemia patient marrow detects.Simultaneously, confirmed to adopt the amplification condition of different instruments, to enlarge the range of application of this test kit.

The present invention adopts quality control product that finished product is done Performance Detection, specificity Quality Control article coincidence rate 100%, i.e. detected result all negative (except that internal control gene); Accuracy Quality Control article coincidence rate 100%, promptly detected result is all positive; BCR-ABL, PML-RAR α, AML-ETO and internal control gene sensitivity all reach 100 copy levels.In addition, carry out accuracy experiment, CV value≤10% with the cell lysate that carries fusion genes.

The present invention has also carried out stability test to test kit, comprises conventional stability, the stability of uncapping and transportation stability test, has confirmed the validity period of test kit according to experimental result.

On this basis, also test kit of the present invention has been carried out clinical examination, and contrasted experiment with gold standard-chromosome karyotype analysis, the result shows that the yin and yang attribute coincidence rate is good, and lower limit of detectability reaches 100 copies.

Test kit of the present invention can assist carry out that clinical definite, regimen are confirmed, therapeutic evaluation and prognosis judge: can detect the BCR-ABL fusion gene among the CML of about 90%-95% (chronic myelocytic leukemia) patient; About 90% M2b type (acute M2b type granulocyte leukemia) patient can detect the AML1-ETO fusion gene; About APL (acute promyelocytic leukemia) leukaemic more than 90% can detect the PML-RARa fusion gene; Therefore the detection to these fusion genes helps clinical making a definite diagnosis CML, APL and patient M2b; Confirm suitable chemotherapy regimen, thereby carry out therapeutic evaluation and help the clinician to obtain the prognosis of patients information judged.

Test kit of the present invention also can be assisted and recurred detection: through chemotherapy or transplanting; Most patients can obtain clinical remission, but because the existence of minimum remaining focus (MRD), all patients are faced with the risk of recurrence; This test kit can effectively be monitored MRD; Help the clinician early stage intervention treatment to be carried out in recurrence, delay recurrence, make patient obtain a secular DFS phase in the molecular biology level.

Specific embodiment mode of the present invention is only made explanations to content of the present invention and is explained, does not limit content of the present invention.Agents useful for same is the commercial reagent, and used instrument is the conventional instrument in laboratory.

Embodiment

Embodiment 1

Table 15:

Wherein:

Table 16:

Title	Sequence	Modify
			SEQ?ID?NO：1	CTGGCCCAACGATGGCGA	Do not have
SEQ?ID?NO：2	TCCGCTGACCATCAATAAGGA	Do not have
			SEQ?ID?NO：3	TGGAGGAGGTGGGCATCTAC	Do not have
SEQ?ID?NO：4	CACTCAGACCCTGAGGCTCAA	Do not have

SEQ?ID?NO：5

CCCTTCAGCGGCCAGTAGCATCTGA

5’Fam，3’Tamara

Contain in the RT-PCR reaction solution 2 of detection PML-RARa fusion gene: 5 * Buffer liquid, 5 μ l; Each 0.25 μ l of the dNTPs of 10mmol/L; Each 0.12 μ l of the SEQ ID NO:6 of 50 μ mol/L～SEQ ID NO:10; 50 μ mol/L SEQ ID NO:10,0.1 μ l complements to 8 μ l with process water;

Table 17:

Title	Sequence	Modify
			?SEQ?ID?NO：6	TCTTCCTGCCCAACAGCAA	Do not have
?SEQ?ID?NO：7	ACCTGGATGGACCGCCTAG	Do not have
			?SEQ?ID?NO：8	CCGATGGCTTCGACGAGTT	Do not have
?SEQ?ID?NO：9	GCTTGTAGATGCGGGGTAGAG	Do not have
			?SEQ?ID?NO：10	AGTGCCCAGCCCTCCCTCGC	?5’Fam，3’Tamara

The primer and the probe that are used for detecting the AML1-ETO fusion gene are for containing: 5 * Buffer liquid, 5 μ l; Each 0.25 μ l of the dNTPs of 10mmol/L; Each 0.12 μ l of the SEQ ID NO:11 of 50 μ mol/L～SEQ ID NO:12; 50 μ mol/L SEQ ID NO:130.1 μ l complement to 8 μ l with process water;

Table 18:

Title	Sequence	Modify
			?SEQ?ID?NO：11	CACCTACCACAGAGCCATCAAA	Do not have
?SEQ?ID?NO：12	ATCCACAGGTGAGTCTGGCATT	Do not have
			?SEQ?ID?NO：13	AACCTCGAAATCGTACTGAGAAGCACTCCA	5’Fam，3’Tamara

Contain in the RT confidential reference items PCR reaction solution: 5 * Buffer liquid, 5 μ l; Each 0.25 μ l of the dNTPs of 10mmol/L; Each 0.12 μ l of the SEQ ID NO:14 of 50 μ mol/L～SEQ ID NO:16,50 μ mol/L SEQ ID NO:16,0.1 μ l complements to 8 μ l with process water; Wherein, By the upstream primer shown in the SEQ ID NO:14, by the downstream primer shown in the SEQ ID NO:15, by the probe shown in the SEQ ID NO:16; Wherein 5 ' of the nucleotide sequence shown in SEQ ID NO:16 end has the Fam mark, and 3 ' end has the Tamara mark;

Table 19:

Title	Sequence	Modify
			SEQ?ID?NO：14	TGGAGATAACACTCTAAGCATAACTAAAGGT	Do not have
SEQ?ID?NO：15	GATGTAGTTGCTTGGGACCCA	Do not have
			SEQ?ID?NO：16	CCATTTTTGGTTTGGGCTTCACACCATT	5’Fam，3’Tamara

With reference to containing in the article PCR reaction solution: 5 * Buffer liquid, 5 μ l; Each 0.25 μ l of the dNTPs of 10mmol/L; Each 0.12 μ l of the SEQ ID NO:17 of 50 μ mol/L～SEQ ID NO:18,50 μ mol/L SEQ ID NO:160.1 μ l complement to 8 μ l with process water; Wherein, by the upstream primer shown in the SEQ ID NO:17, by the downstream primer shown in the SEQ ID NO:18;

Table 20:

Contain among the mixed enzyme solution I: the UNG enzyme 0.2ml of the Taq archaeal dna polymerase 0.4ml of 5U/ μ l, 200U/ μ l RT enzyme 0.5ml, 40U/ μ l RNasin0.25ml, 1U/ μ l and enzyme storage liquid 0.65ml enzyme mix, and are equipped with the 2ml enzyme solution.

Contain among the mixed enzyme solution II: the Taq archaeal dna polymerase 0.4ml of 5U/ μ l, the UNG enzyme 0.2ml of 1U/ μ l and enzyme storage liquid 0.65ml enzyme mix, and are equipped with the 2ml enzyme solution.

Contain K562, NB4 and Kasumi cell lysate in the positive control 1, concentration is 2.5 * 10 ³Cells/ml; Described positive control 2 is for containing the segmental four kinds of plasmids of BCR-ABL, PML-RARa, AML1-ETO and abl gene purpose respectively, and its nucleotide sequence is respectively SEQ ID NO:19～SEQ ID NO:27, and concentration is 1pg/m; Wherein, the K562 cell lysate is that BCR-ABL fusion gene male K562 cell lysate, NB4 cell lysate PML-RARa fusion gene male NB4 cell lysate, Kasumi cell lysate are AML1-ETO fusion gene male Kasumi cell lysate.

Contain in the positive control 2: 100pg/ml contains the segmental four kinds of plasmids of BCR-ABL, PML-RARa, AML1-ETO and abl gene purpose, with the dilution of Trziol liquid with 100 times; Wherein,

The nucleotides sequence of BCR-ABL gene fragment is classified as:

Table 21:

The nucleotides sequence of PML-RARa gene fragment is classified as:

Table 22:

Title	The different genes type of fusion gene
		SEQ?ID?NO：23	PML-RARA-L
SEQ?ID?NO：24	PML-RARA-S
		SEQ?ID?NO：25	PML-RARA-V

The nucleotides sequence of AML1-ETO gene fragment is classified as:

Table 23:

Title	Fusion gene
		?SEQ?ID?NO：26	AML1-ETO

The segmental nucleotides sequence of abl gene is classified as:

Table 24:

Title	Fusion gene
		?SEQ?ID?NO：27	Abl gene, gene order number is NM_005157.4

Embodiment 2: adopt the test kit of embodiment 1 that sample is detected.

1, sample process: sample 1～10 adopts RNA to extract test kit and extracts RNA nucleic acid; The OD of the RNA that carries ₂₆₀/ OD ₂₈₀1.8～2.0.The RNA suggestion of having extracted detects immediately, otherwise in preserving below-80 ℃; The RNA that extracting is good adds the dissolving of 200ul RNeas-Free water mixing, with the template of this treatment solution as relevant PCR reaction;

2, amplifing reagent is prepared:

The preparation of sample PCR premixed liquid system:

Get RT-PCR reaction solution 1 8ul, add mixed enzyme solution I 2ul; Single sample preparation 4 pipes;

Get RT-PCR reaction solution 2 8ul, add mixed enzyme solution I 2ul; Single sample preparation 4 pipes;

Get RT-PCR reaction solution 3 8ul, add mixed enzyme solution I 2ul; Single sample preparation 4 pipes;

Get RT-confidential reference items PCR reaction solution 8ul, add mixed enzyme solution I 2ul; Single sample preparation 4 pipes;

Preparation with reference to article PCR premixed liquid system:

Get with reference to article PCR reaction solution 8ul, add mixed enzyme solution II 2ul; Preparation 4 pipes;

3, application of sample:

Get 15ul from the sample to be tested pipe, join respectively in the PCR pipe that sample PCR premixed liquid system is housed;

Get 15ul from positive control 1 pipe, join respectively in the PCR pipe that sample PCR premixed liquid system is housed;

Get 15ul from positive control 2 pipes, join respectively in the PCR pipe that sample PCR premixed liquid system is housed;

Get 15ul from the negative control pipe, join respectively in the PCR pipe that sample PCR premixed liquid system is housed;

Add to the PCR pipe that is equipped with reference to article PCR premixed liquid system from getting 15ul respectively, cover tight Guan Gai, it is moved to detection zone with reference to article 1～4 pipe;

4, pcr amplification:

StratagenePCR fluorescence detector amplification condition: 42 ℃, 30min; 94 ℃, 5min; (94 ℃, 45sec; 60 ℃, 80sec) 40 circulations; Reaction system is 25ul; , PCR circulation second collects fluorescent signal when going on foot 60 ℃; Sense channel is: FAM-TAMRA;

5, detect

(1) confirming of baseline: it is baseline that software default is set 3-15 round-robin mean fluorecence signal.In experiment, general trade-off curve fluctuation is less, and that more stable section is as baseline, and the user can take the circumstances into consideration adjustment voluntarily according to practical situation.Starting point will be avoided beginning several cycles because the signal that high temperature causes increases, and is located at signal and has dropped to the background height and can keep place stably, and terminal point will be avoided covering signal and begin that the place that rises appreciably is arranged.According to the difference of empirical curve tendency, general start value can be chosen between the 3-12; The stop value is selected can 8 at interval be principle more than the circulation preferably between the Origin And Destination, better to satisfy the mathematics requirement of statistical baseline standard deviation.

(2) determines the threshold value: negative control, no amplification of the case, the threshold value is set in the absence of the amplification curve the highest point of the sample, that is higher than the no amplification growth curve (i.e. in the result of "Component" column no inflection point) the highest point, and the principle of the negative control was not detected, determine the starting threshold.

(3) note: different reaction solutions is analyzed after should distinguishing the baseline of confirming separately separately and threshold value more separately.

Computingmachine is handled and analytical data automatically.

Availability deciding:

Table 25:

B, result judge:

A, as sample internal control gene C _TBe worth≤36 o'clock:

B, as sample internal control gene C _TWhen value＞36 or demonstration " Undet ":

Table 26:

It is as shown in the table for experimental result:

Table 27:

Claims

1. a primer and probe that detects the relevant fusion gene of white blood disease, wherein, the nucleotides sequence of said primer and probe is classified as:

(1) primer and the probe that is used to detect the BCR-ABL fusion gene is for by the upstream primer F1 shown in the SEQ ID NO:1; By the upstream primer F2 shown in the SEQ ID NO:2; By the upstream primer F3 shown in the SEQ ID NO:3, by the downstream primer shown in the SEQ ID NO:4, by the probe shown in the SEQ ID NO:5; Wherein 5 ' of the nucleotide sequence shown in SEQ ID NO:5 end has the Fam mark, and 3 ' end has the Tamara mark;

2. one kind contains the primer of the relevant fusion gene of the said detection white blood disease of claim 1 and the test kit of probe; It is characterized in that; Consisting of of described test kit: described test kit comprises nucleic acid amplification reagent, reference substance and reference article, and wherein, described nucleic acid amplification reagent comprises:

3. test kit according to claim 2 is characterized in that,

Contain in the RT confidential reference items PCR reaction solution: 5 * Buffer liquid, 5 μ l; Each 0.25 μ l of the dNTPs of 10mmol/L; Each 0.12 μ l of the SEQ ID NO:14 of 50 μ mol/L～SEQ ID NO:16,50 μ mol/L SEQ ID NO:160.1 μ l complement to 8 μ l with process water;

With reference to containing in the article PCR reaction solution: 5 * Buffer liquid, 5 μ l; Each 0.25 μ l of the dNTPs of 10mmol/L; Each 0.12 μ l of the SEQ ID NO:17 of 50 μ mol/L～SEQ ID NO:18,50 μ mol/L SEQ ID NO:160.1 μ l complement to 8 μ l with process water.

4. test kit according to claim 2 is characterized in that, described reference substance is:

Contain K562, NB4 and Kasumi cell lysate in the described positive control 1, concentration is 2.5 * 10 ³Cells/ml; Described positive control 2 is for containing the segmental four kinds of plasmids of BCR-ABL, PML-RARa, AML1-ETO and abl gene purpose respectively, and its nucleotide sequence is respectively SEQ ID NO:19～SEQ ID NO:27, and concentration is 1pg/ml.

5. test kit according to claim 2 is characterized in that, described reference article are:

6. test kit according to claim 2 is characterized in that, said test kit is the OD of the RNA that carries to the requirement that detects sample ₂₆₀/ OD ₂₈₀1.8～2.0.

7. the method for use of test kit as claimed in claim 2 is characterized in that, may further comprise the steps:

Concrete steps are following:

1. going bail for exists the sample 400 μ l in the Trizol, adds 400 μ l chloroforms, mixing, and room temperature was placed 5 minutes; Centrifugal 10 minutes of 15000rpm, colourless supernatant is drawn in centrifugal back;

2. the Virahol that in above-mentioned supernatant, adds the equal-volume precooling, put upside down mixing after room temperature placed 10 minutes; Centrifugal 10 minutes of 15000rpm inhales and abandons supernatant;

3. in above-mentioned centrifuge tube, add 70% ethanol of 300 μ l precoolings, centrifugal 5 minutes of 15000rpm inhales and abandons supernatant; Room temperature 10 minutes makes the ethanol volatilization;

4. add 200ul DEPC-ddH ₂The dissolving of O mixing is with this template as relevant PCR reaction.

(2) amplifing reagent is prepared:

The preparation of sample PCR premixed liquid system:

Preparation with reference to article PCR premixed liquid system:

(3) application of sample:

(4) pcr amplification:

(5) detect:

(3) computingmachine is handled and analytical data automatically.

8. the authentication method of test kit as claimed in claim 2 is characterized in that, may further comprise the steps:

(1) availability deciding:

(2) result judges:

A. as sample internal control gene C _TBe worth≤36 o'clock:

9. the authentication method of test kit as claimed in claim 2 is characterized in that, may further comprise the steps: for the patient after the treatment, internal control gene RNA detectable level adopts 1 * 10 ⁶Copies.