CN113718021A - Primer, probe and kit for quantitatively detecting BCR-ABL1 fusion gene - Google Patents

Abstract

The invention provides a primer, a probe and a kit for quantitatively detecting a BCR-ABL1 fusion gene. Specifically, the invention designs specific primers and probes of a main type (P210) and a minor type (P190) of the BCR-ABL1 fusion gene by using a real-time fluorescent quantitative PCR (RQ-PCR) technology, and the target gene is amplified in a targeted manner, so that the 2 fusion genes can be rapidly and specifically detected. The kit of the invention contains the artificially synthesized large fragment containing the fusion site of the major type (P210) or the minor type (P190) of the BCR-ABL1 fusion gene as a quantitative reference substance, and can carry out quantitative detection on the fusion gene in a patient body at each treatment stage.

Description

Primer, probe and kit for quantitatively detecting BCR-ABL1 fusion gene

Technical Field

The invention belongs to the technical field of biology, and particularly relates to a primer, a probe and a kit for quantitatively detecting BCR-ABL1 fusion genes.

Background

Leukemia, also known as leukemia, is a malignant clonal disease of hematopoietic stem cells. Leukemia cells are produced in the bone marrow and disseminated into the blood and the whole body. According to foreign statistics, leukemia accounts for about 3% of the total incidence of tumors, and is the most common malignant tumor in children and young people. The investigation result of the disease condition of leukemia in China shows that: the annual incidence of leukemia is 2.76/10 ten thousand, and of all leukemias, the incidence of acute myelogenous leukemia is highest (1.62/10 ten thousand), the secondary acute lymphocytic leukemia is (0.69/10 ten thousand), and the third chronic myelogenous leukemia is (0.36/10 ten thousand). The incidence rates of M2a, M3 and M5 among the subtypes of acute myeloid leukemia are 25.2%, 18.7% and 23.2%, respectively.

Chronic Myelogenous Leukemia (CML) is the first identified neoplastic disease associated with a particular chromosome or gene and is characterized by the Philadelphia chromosome (Ph chromosome), t (9; 22) (q 34; q11), with a pathogenic basis of the 3' end of the BCR gene, which is translocated from c-ABL1 to 22q11 at 9q34, forming a BCR-ABL1 fusion gene. The fusion gene exists in more than 95% of chronic granulocytic leukemia, 25% -30% of adults and 2% -5% of children acute leukemia (ALL), and a few patients with AML myelodysplastic syndrome (MDS) and other hematological tumors. The BCR-ABL1 fusion gene is an anti-apoptosis gene, has high tyrosine kinase activity, and can activate various signal transduction pathways to ensure that cells are over-proliferated so as to cause cell regulation disorder.

Due to the different breakpoints, the BCR gene and the ABL1 gene generate 3 different isoforms of BCR-ABL1 fusion gene, which are major (major BCR, M-BCR) i.e. e13a2 or e14a2, respectively, encoding P210 cytoplasmic protein, found in more than 90% of CML patients and some Ph chromosome positive ALL patients (Ph)^+-ALL); the minor form (minor bcr, m-bcr), e1a2, encodes the P190 fusion protein, the majority of Ph⁺ALL patients were of this type; microminiature (. mu. -bcr), i.e., e6a2, e8a2 or e19a2, etc., encodes P190 fusion proteins, found in 2-3% of CML patients. Wherein the major and minor accounts for more than 95%. The curative effect and the clinical application of the Tyrosine Kinase Inhibitor (TKI) can be evaluated by regularly monitoring the transcription level of the BCR-ABL1 fusion gene of a patientMinor residual events, the molecular response at 3, 6, 12 months and any time thereafter in TKI treatment, have been listed at home and abroad in CML and Ph⁺ALL medical recommendations or guidelines.

At present, the detection commonly used for the BCR-ABL1 fusion gene comprises Fluorescence In Situ Hybridization (FISH), immunotyping, real-time quantitative PCR (RQ-PCR) technology, digital PCR and other detection methods.

(1) Fluorescence In Situ Hybridization (FISH) is a technique for determining the morphology and distribution of cells or organelles stained after hybridization with specific probes, or the location of DNA regions or RNA molecules bound to fluorescent probes in chromosomes or other organelles, by hybridizing specific probes labeled with fluorescein to target DNA or RNA molecules in the nuclei of sample cells and observing fluorescent signals under a fluorescent microscope or a confocal laser scanner. The fluorescent in situ hybridization probes have various types and are widely applicable to sample sources. The FISH counting only needs to analyze interphase cells, is not influenced by division or not, and has good specificity and repeatability, but the experimental operation of the FISH detection is complex, so that the loci hidden from the chromosome ectopic are difficult to detect and false negative results are easy to appear, and secondly, the FISH detection sensitivity is low, and the quantitative tracking of the minimal residual disease is insufficient, so that the application of the FISH counting in clinic is greatly limited.

(2) The immunophenotyping is one of the important indexes for diagnosing leukemia, in which, during the growth and development of cells, the cells in different stages detect corresponding leukocyte surface or cytoplasmic antigens according to different markers on the surfaces of the cells, and the cells are rapidly classified. The current internationally accepted method is Flow CytoMetry (FCM). FCM utilizes fluorescein labeled monoclonal antibody (McAb) as a molecular probe to analyze the immunophenotype of the cell membrane, cytoplasm or nucleus of leukemia cells in a multiparameter way, thereby knowing the cytology department and differentiation degree of the detected leukemia cells. The FCM technology can be used for rapidly, multiparamently and objectively measuring the antigen expression of cell membranes, cytoplasm and cell nucleus of leukemia, the method is simple, convenient and rapid, and the repeatability is good, but no specific antigen for detecting leukemia cells is found so far, and the detection is difficult to popularize due to the special requirements of reagents and instruments.

(3) Digital pcr (dpcr), an absolute quantification technique for nucleic acid molecules. The technical principle is that a sample is divided before the traditional PCR amplification, namely a reaction system containing nucleic acid molecules is divided into thousands of nano-scale micro-reactions, wherein each micro-reaction does not contain the nucleic acid target molecules to be detected or contains one to a plurality of nucleic acid target molecules to be detected. After PCR amplification, the micro-reaction is detected, the interpretation of the micro-reaction with a fluorescent signal is 1, the interpretation of the micro-reaction without the fluorescent signal is 0, and the initial copy number or the concentration of the target molecule can be obtained according to the Poisson distribution principle and the number and the proportion of the positive micro-reactions. Compared with qPCR, the digital PCR does not need a standard curve, and can carry out absolute quantification on low-copy target molecules to be detected. However, the digital PCR system has high cost, limited flux, complicated operation and lack of practical clinical verification data, so the technology has no advantages in conventional gene expression analysis at present.

(4) The real-time fluorescent quantitative PCR (RQ-PCR) technology is based on TaqMan probe fluorescent quantitative PCR, wherein the 5 'end of the TaqMan probe is marked with a fluorescent molecule (namely a reporter group), and the 3' end of the TaqMan probe is marked with a fluorescent quenching molecule (namely a quenching group). When the probe is intact, Fluorescence Resonance Energy Transfer (FRET) occurs between the two, and the fluorescent signal emitted by the reporter is absorbed by the quencher. During PCR amplification, Taq enzyme has 5'→ 3' exonuclease activity, and the probe is hydrolyzed to increase the distance between the reporter group and the quencher group, so that a fluorescent signal can be detected by a fluorescence monitoring system. Along with the increase of the cycle number, the amplified target gene fragment and the fluorescence signal intensity are in a linear relation, and the copy number of the target gene of the sample to be detected can be obtained through the Ct value. The real-time fluorescence quantitative PCR technology has simple operation, short time consumption and good flux, and instruments and equipment can be widely used in the market and applied to scientific research and clinical research.

The Chinese diagnosis and treatment guideline for chronic myelogenous leukemia (2020 edition), the Chinese diagnosis and treatment monitoring guideline for chronic myelogenous leukemia (2014 edition), the adult acute lymphoblastic leukemia treatment and treatment guideline for acute lymphoblastic leukemia (2018 edition) and the NCCN clinical practice guideline for chronic myelogenous leukemia (2020) indicate that the detection of BCR-ABL1 fusion gene is one of the most specific and most sensitive biological methods for diagnosing CML, and the curative effect and the minimal residual condition of a Tyrosine Kinase Inhibitor (TKI) can be clinically evaluated by regularly monitoring the transcription level of the BCR-ABL1 fusion gene of a patient, so that the molecular targeted treatment and prognosis judgment of the patient can be better guided. In conclusion, a kit which has high sensitivity and good specificity and can detect the BCR-ABL1 fusion gene rapidly and reliably is needed at the present stage.

Disclosure of Invention

The invention aims to provide a method for quantitatively detecting a main type (P210) and a minor type (P190) of a BCR-ABL1 fusion gene in Chronic Myelogenous Leukemia (CML) or Acute Lymphoblastic Leukemia (ALL), a primer, a probe and a kit comprising the primer and probe mixture.

In a first aspect of the invention, there is provided a set of primer pairs for detecting a BCR-BAL1 fusion gene, the set of primer pairs comprising:

a first primer pair comprising a forward primer as set forth in SEQ ID No.:1 and a reverse primer as set forth in SEQ ID No.: 2.

In another preferred embodiment, the primer pair set further includes:

a second primer pair group comprising a forward primer as set forth in SEQ ID No. 3; and, a reverse primer as set forth in SEQ ID No. 4.

In another preferred embodiment, the primer pair set further includes:

a third primer pair group comprising forward primers as set forth in SEQ ID No. 5; and, a reverse primer as set forth in SEQ ID No. 6.

In a second aspect of the present invention, there is provided a probe set for detecting a BCR-BAL1 fusion gene, the probe set comprising: a first probe represented by SEQ ID NO. 7.

In another preferred example, the probe set further includes: a second probe represented by SEQ ID NO. 8.

In another preferred example, the probe set further includes: a third probe shown as SEQ ID NO. 9.

In another preferred embodiment, the 5' end of the first probe comprises a fluorescent reporter group; and/or, the 3' end of the first probe comprises a fluorescence quenching group.

In another preferred embodiment, the 5' end of the second probe comprises a fluorescent reporter group; and/or, the 3' end of the second probe comprises a fluorescence quenching group.

In another preferred embodiment, the 5' end of the third probe comprises a fluorescent reporter group; and/or, the 3' end of the third probe comprises a fluorescence quenching group.

In another preferred embodiment, the first probe-labeled fluorescent reporter, the second probe-labeled fluorescent reporter, and the third probe-labeled fluorescent reporter are the same.

In a third aspect of the invention, a kit for detecting a BCR-BAL1 fusion gene is provided, the kit comprising the primer pair set of the first aspect of the invention.

In another preferred embodiment, the kit further comprises a probe set according to the second aspect of the present invention.

In another preferred embodiment, the kit comprises a first container, wherein the first container contains a first primer probe mixture, and the primer probe mixture contains a primer probe sequence shown in SEQ ID NO: 1. a polynucleotide sequence shown in SEQ ID No. 2 and SEQ ID No. 7.

In another preferred embodiment, the kit further comprises a second container, wherein a second primer probe mixture is contained in the second container, and the primer probe mixture comprises a primer probe sequence shown in SEQ ID NO: 3. a polynucleotide sequence shown in SEQ ID No. 4 and SEQ ID No. 8.

In another preferred embodiment, the kit further comprises a third container, wherein a third primer probe mixture is contained in the third container, and the primer probe mixture comprises a primer of SEQ ID NO: 5. the polynucleotide sequence shown in SEQ ID No. 6 and SEQ ID No. 9.

In another preferred embodiment, the kit further comprises a fourth container, wherein the fourth container comprises one or more components selected from the group consisting of: hot start Taq enzyme, reverse transcriptase, and dntps.

In another preferred example, the kit also comprises an independently-dispensed BCR-ABL 1P 210 type positive quantitative reference, and the BCR-ABL 1P 210 type positive quantitative reference is a plasmid containing a target fragment of BCR-ABL 1P 210 type; preferably, the concentration gradient of the BCR-ABL 1P 210 positive quantitative reference substance is 2 x 10⁶copies/ml、2×10⁵copies/ml、2×10⁴copies/ml, and 2X 10³copies/ml。

In another preferred example, the kit further comprises an independently dispensed BCR-ABL 1P 190 type positive quantitative reference, and the BCR-ABL 1P 190 type positive quantitative reference is a plasmid containing a target fragment of BCR-ABL 1P 190 type; preferably, the concentration gradient of the BCR-ABL 1P 190 type positive quantitative reference substance is 2 x 10⁶copies/ml、2×10⁵copies/ml、2×10⁴copies/ml, and 2X 10³copies/ml。

In another preferred example, the kit further comprises an independently dispensed ABL1 positive quantitative reference, wherein the ABL1 positive quantitative reference is a plasmid containing an ABL1 target fragment; preferably, the concentration gradient of the ABL1 positive quantitative reference substance is 2 x 10⁶copies/ml、2×10⁵copies/ml、2×10⁴copies/ml, and 2X 10³copies/ml。

In another preferred embodiment, the kit further comprises a positive quality control product and a negative quality control product which are separately packaged.

In a fourth aspect of the present invention, there is provided a method for detecting a BCR-BAL1 fusion gene, said method comprising the steps of:

(1) providing a nucleic acid sample of an object to be detected;

(2) preparing a PCR reaction system and carrying out PCR detection:

the PCR reaction system comprises a BCR-ABL1 primary reaction tube system, a BCR-ABL1 secondary reaction tube system and an ABL1 reaction tube system;

wherein the PBCR-ABL1 main type reaction tube system comprises the nucleic acid sample prepared in the step (1) and the first primer probe mixed solution; the BCR-ABL1 minor-type reaction tube system comprises the nucleic acid sample prepared in the step (1) and the second primer probe mixed solution; the ABL1 reaction tube system comprises the nucleic acid sample prepared in the step (1) and the third primer probe mixed solution.

In another preferred embodiment, the method is a non-diagnostic detection method, for example, a detection analysis is performed on a tumor cell line cultured in a laboratory, for the development and use of new drugs.

In another preferred embodiment, the PCR reaction system further comprises a positive quality control substance, and/or a negative quality control substance.

In the fifth aspect of the invention, the use of the primer pair set of the first aspect of the invention and/or the probe set of the second aspect of the invention is provided for preparing a PCR detection kit, and the PCR detection kit is used for detecting a BCR-ABL1 fusion gene.

It is to be understood that within the scope of the present invention, the above-described features of the present invention and those specifically described below (e.g., in the examples) may be combined with each other to form new or preferred embodiments. Not to be reiterated herein, but to the extent of space.

Drawings

FIG. 1 is a top view of negative quality control tests.

FIG. 2 shows the result of the BCR-ABL1 strong positive quality control test.

FIG. 3 shows the result of critical positive quality control test of BCR-ABL 1.

FIG. 4 detection results of BCR-ABL1 major type quantitative reference.

FIG. 5 detection results of BCR-ABL1 minor form of quantitative reference.

Figure 6ABL1 quantitative reference detection results.

FIG. 7BCR-ABL1 major (P210) clinical specimen.

FIG. 8BCR-ABL1 minor form (P190) clinical specimen.

Fig. 9 shows the standard curve of P210 control system 1.

Detailed Description

The inventor designs specific primers and probes of a main type (P210) and a minor type (P190) of a BCR-ABL1 fusion gene by utilizing a real-time fluorescent quantitative PCR (RQ-PCR) technology through extensive and intensive research, amplifies target genes in a targeted manner, and realizes the rapid and specific detection of 2 fusion genes. The kit of the invention contains the artificially synthesized large fragment containing the fusion site of the major type (P210) or the minor type (P190) of the BCR-ABL1 fusion gene as a quantitative reference substance, and can carry out quantitative detection on the fusion gene in a patient body at each treatment stage.

Before the present invention is described, it is to be understood that this invention is not limited to the particular methodology and experimental conditions described, as such methodologies and conditions may vary. It is also to be understood that the terminology used herein is for the purpose of describing particular embodiments only, and is not intended to be limiting, since the scope of the present invention will be limited only by the appended claims.

Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs. As used herein, the term "about" when used in reference to a specifically recited value means that the value may vary by no more than 1% from the recited value. For example, as used herein, the expression "about 100" includes 99 and 101 and all values in between (e.g., 99.1, 99.2, 99.3, 99.4, etc.).

Although any methods and materials similar or equivalent to those described herein can be used in the practice or testing of the present invention, the preferred methods and materials are now exemplified.

The invention provides a method for quantitatively detecting a main type (P210) or a minor type (P190) fusion gene of a BCR-ABL1 fusion gene in Chronic Myelogenous Leukemia (CML) or Acute Lymphoblastic Leukemia (ALL), a primer, a probe and a kit comprising a primer-probe mixed solution.

In a preferred embodiment of the present invention, the present invention provides a method, primers, probes for quantitatively detecting the expression level of mRNA of a BCR-ABL1 fusion gene major (P210) or minor (P190) fusion gene in Chronic Myelogenous Leukemia (CML) or Acute Lymphocytic Leukemia (ALL):

the nucleotide sequence of the upstream primer for detecting P210 is shown as SEQ ID NO: 1, and the nucleotide sequence of the downstream primer for detecting P210 is shown as SEQ ID NO: 2 is shown in the specification; the nucleotide sequence of the upstream primer for detecting P190 is shown as SEQ ID NO: 3, the nucleotide sequence of the downstream primer for detecting P190 is shown as SEQ ID NO: 4, the nucleotide sequence of the upstream primer for detecting the internal control gene of ABL1 is shown as SEQ ID NO: 5, the nucleotide sequence of the downstream primer for detecting the internal control gene of ABL1 is shown as SEQ ID NO: 6 is shown in the specification;

the nucleotide sequence of the probe for detecting P210 is shown as SEQ ID NO: 7, the nucleotide sequence of the probe for detecting P190 is shown as SEQ ID NO: 8, the probe nucleotide sequence of the ABL1 internal control gene is shown as SEQ ID NO: shown at 9.

Further, the probe SEQ ID NO: 7. SEQ ID NO: 8. SEQ ID NO: the 5 'end of the 9 nucleotide sequence is labeled with FAM and the 3' end is labeled with BHQ 1.

Preferably, the final concentration of the BCR-ABL1 fusion gene P210 and P190 upstream primer in the reaction system is 0.16 pmol/. mu.L, the final concentration of the BCR-ABL1 fusion gene P210 and P190 downstream primer in the reaction system is 0.16 pmol/. mu.L, and the final concentration of the BCR-ABL1 fusion gene P210 and P190 probe in the reaction system is 0.1 pmol/. mu.L; the final concentration of the internal control upstream primer in the reaction system is 0.16 pmol/muL, the final concentration of the internal control downstream primer in the reaction system is 0.16 pmol/muL, and the final concentration of the internal control probe in the reaction system is 0.1 pmol/muL;

the primer probe sequences of the BCR-BAL1 fusion gene and the internal control gene are shown in the following table 1:

TABLE 1 primer Probe nucleotide sequence information

The PCR primers and the probes can be used for quantitatively detecting BCR-ABL1 fusion genes P210 and P190.

The copy numbers of the BCR-ABL1 fusion gene and the internal control ABL1 gene are respectively calculated by using the BCR-ABL1 fusion gene and the internal control ABL1 gene quantitative reference substances, and the transcript level of the BCR-BAL1 fusion gene is determined by using the copy number ratio, namely: BCR-ABL1-Qty/ABL1-Qty ═ BCR-BAL1 fusion gene copy number (P210 or P190)/ABL1 internal reference gene copy number. Wherein, the linear range of the BCR-ABL1 fusion gene is 1.0E +03copies/mL or less and the BCR-ABL1-Qty or less and the 1.0E +08copies/mL, and the quantitative result of the sample exceeding the concentration range is only used for reference. The invention combines the fusion gene specific probe to make the sensitivity of the detection system reach 500 copies/mL.

The kit prepared by the specific primers and the probes can detect two fusion types of P210 and P190 of the BCR-ABL1 fusion gene based on a fluorescence PCR (probe method), and provides reference for the regular monitoring and treatment scheme of the curative effect of the two types of patients clinically.

The invention also discloses a kit for quantitatively detecting the BCR-ABL1 fusion gene, which comprises the BCR-ABL1 fusion gene (P210 and P190), internal control gene ABL1 primer probe mixed liquor, hot start Taq enzyme, reverse transcriptase, dNTP and the like. The kit also comprises BCR-ABL1 fusion genes (P210 and P190), an internal control gene ABL1 positive quantitative reference substance and a quality control substance.

The nucleotide sequence of the upstream primer for detecting P210 is shown as SEQ ID NO: 1, the nucleotide sequence of the downstream primer for detecting P210 is shown as SEQ ID NO: 2, the nucleotide sequence of the primer for detecting the P190 upstream is shown as SEQ ID NO: 3, the nucleotide sequence of the downstream primer for detecting P190 is shown as SEQ ID NO: 4, the nucleotide sequence of the upstream primer for detecting the internal control gene of ABL1 is shown as SEQ ID NO: 5, the nucleotide sequence of the downstream primer for detecting the internal control gene of ABL1 is shown as SEQ ID NO: 6 is shown in the specification;

the probes comprise probes for detecting two types of P210 and P190 and an internal control gene ABL1 probe; the nucleotide sequence of the probe of the P210 is shown as SEQ ID NO: 7, the nucleotide sequence of the probe of the P190 is shown as SEQ ID NO: 8, the nucleotide sequence of the probe of the internal control gene ABL1 is shown as SEQ ID NO: 9, the 5 'end of all the probes is marked with FAM fluorescent reporter group, and the 3' end is marked with BHQ1 fluorescent quenching group.

When the BCR-ABL1 major fusion gene or BCR-ABL1 minor fusion gene exists in the detection sample, the probe is combined with the target fragment amplified by the upstream and downstream primers to release an FAM fluorescent signal; the internal control gene ABL1 primer and the probe are designed and synthesized according to the human ABL1 gene conserved fragment and are used for detecting the ABL1 gene;

the primer probe mixture comprises the following components as shown in Table 2:

TABLE 2BCR-ABL1 fusion Gene primer Probe mixture Components

The components of the positive quantitative reference product are as follows, and are shown in a table 3:

TABLE 3BCR-ABL1 fusion gene positive quantitative reference composition

The quality control material components are as follows, and the table 4:

TABLE 4BCR-ABL1 fusion Gene quality control Material composition

The invention relates to a target fragment which comprises:

BCR-ABL1 major form fragment 1 of interest (SEQ ID No.: 10):

CGGGATCCCGAGTTACACGTTCCTGATCTCCTCTGACTATGAGCGTGCAGAGTGGAGGGAGAACATCCGGGAGCAGCAGAAGAAGTGTTTCAGAAGCTTCTCCCTGACATCCGTGGAGCTGCAGATGCTGACCAACTCGTGTGTGAAACTCCAGACTGTCCACAGCATTCCGCTGACCATCAATAAGGAAGATGATGAGTCTCCGGGGCTCTATGGGTTTCTGAATGTCATCGTCCACTCAGCCACTGGATTTAAGCAGAGTTCAAAAGCCCTTCAGCGGCCAGTAGCATCTGACTTTGAGCCTCAGGGTCTGAGTGAAGCCGCTCGTTGGAACTCCAAGGAAAACCTTCTCGCTGGACCCAGTGAAAATGACCCCAACCTTTTCGTTGCACTGTATGATTTTGTGGCCAGTGGAGATAACACTCTAAGCATAACTAAAGGTGAAAAGCTCCGGGTCTTAGGCTATAATCACAATGGGGAATGGTGTGAAGCCCAAACCAAAAATGGCCAAGGCTGGGTCCCAAGCAACTACATCACGCCAGTCAACAGTCTGGAGAAACACTCCTGGTACCATGGGCCTGTGTCCCGCAATGCCGCTGAGTATCTGCTGAGCAGCGGGATCAATGGCAGCTTCTTGGTGCGTGAGAGTGAGAGCAGTCCTGGCCAGAGGTCCATCTCGCTGAGATACGAAGGGAGGGTGTACCATTACAGGATCAACACTGCTTCTGATGGCAAGCATAAGAATGCGGCCGCTAAACTAT

BCR-ABL1 minor form fragment of interest 2(SEQ ID NO.: 11):

CGGGATCCCGGCTCCTGCGCAGCCAGAGCACCTCTGAGCAGGAGAAGCGCCTTACCTGGCCCCGCAGGTCCTACTCCCCCCGGAGTTTTGAGGATTGCGGAGGCGGCTATACCCCGGACTGCAGCTCCAATGAGAACCTCACCTCCAGCGAGGAGGACTTCTCCTCTGGCCAGTCCAGCCGCGTGTCCCCAAGCCCCACCACCTACCGCATGTTCCGGGACAAAAGCCGCTCTCCCTCGCAGAACTCGCAACAGTCCTTCGACAGCAGCAGTCCCCCCACGCCGCAGTGCCATAAGCGGCACCGGCACTGCCCGGTTGTCGTGTCCGAGGCCACCATCGTGGGCGTCCGCAAGACCGGGCAGATCTGGCCCAACGATGGCGAGGGCGCCTTCCATGGAGACGCAGAAGCCCTTCAGCGGCCAGTAGCATCTGACTTTGAGCCTCAGGGTCTGAGTGAAGCCGCTCGTTGGAACTCCAAGGAAAACCTTCTCGCTGGACCCAGTGAAAATGACCCCAACCTTTTCGTTGCACTGTATGATTTTGTGGCCAGTGGAGATAACACTCTAAGCATAACTAAAGGTGAAAAGCTCCGGGTCTTAGGCTATAATCACAATGGGGAATGGTGTGAAGCCCAAACCAAAAATGGCCAAGGCTGGGTCCCAAGCAACTACATCACGCCAGTCAACAGTCTGGAGAAACACTCCTGGTACCATGGGCCTGTGTCCCGCAATGCCGCTGAGTATCTGCTGAGCAGCGGGATCAATGGCAGCTTCTTGGTGCGTGAGAGTGAGAGCAGTCCTGGCCAGAGGTCCATCTCGCTGAGATACGAAGGGAGGGTGTACCATTACAGGATCAACACTGCTTCTGATGGCAAGCCCCAAGCTTGGG

fragment 3 of ABL1 mesh (SEQ ID No.: 12):

CGGGATCCGGACCGAGCTGGGAGAGGGGCTCCGGCCCGATCGTTCGCTTGGCGCAAAATGTTGGAGATCTGCCTGAAGCTGGTGGGCTGCAAATCCAAGAAGGGGCTGTCCTCGTCCTCCAGCTGTTATCTGGAAGAAGCCCTTCAGCGGCCAGTAGCATCTGACTTTGAGCCTCAGGGTCTGAGTGAAGCCGCTCGTTGGAACTCCAAGGAAAACCTTCTCGCTGGACCCAGTGAAAATGACCCCAACCTTTTCGTTGCACTGTATGATTTTGTGGCCAGTGGAGATAACACTCTAAGCATAACTAAAGGTGAAAAGCTCCGGGTCTTAGGCTATAATCACAATGGGGAATGGTGTGAAGCCCAAACCAAAAATGGCCAAGGCTGGGTCCCAAGCAACTACATCACGCCAGTCAACAGTCTGGAGAAACACTCCTGGTACCATGGGCCTGTGTCCCGCAATGCCGCTGAGTATCTGCTGAGCAGCGGGATCAATGGCAGCTTCTTGGTGCGTGAGAGTGAGAGCAGTCCTGGCCAGAGGTCCATCTCGCTGAGATACGAAGGGAGGGTGTACCATTACAGGATCAACACTGCTTCTGATGGCAAGCTCTACGTCTAAGCTTGGG

the kit is suitable for the nucleic acid of the peripheral blood or bone marrow sample.

The kit provided by the invention is used for judging the detection effectiveness according to the following standards: and a negative quality control product group, a positive quality control product group and a quantitative reference product group are set in each detection. And when the detection result of the positive quality control is positive and the negative control group is negative, the experimental result is effective. The detection sensitivity of the kit can reach 500 copies/mL.

The invention also discloses a method for quantitatively detecting the BCR-ABL1 fusion gene, which comprises the following steps:

processing a sample to be detected and extracting RNA in the sample; preferably, the sample to be detected is nucleic acid extracted from a peripheral blood or bone marrow sample, and the quality of the sample nucleic acid is detected;

1. preparation of real-time fluorescent quantitative PCR reaction system

Taking out the BCR-ABL1 primary PCR reaction solution A, BCR-ABL1 secondary PCR reaction solution A, ABL1PCR reaction solution A, BCR-ABL 1PCR reaction solution B, thawing at room temperature, shaking and mixing uniformly, and performing instant centrifugation at 8,000rpm for use. The formulations were as described in tables 5 to 7.

After preparation, all the components are fully mixed to prepare corresponding BCR-ABL1 major and minor PCR reaction tubes and ABL1PCR reaction tubes, the reaction tubes are instantaneously centrifuged to ensure that liquid on the tube wall is completely centrifuged to the tube bottom, and then 30 mu L of amplification system is respectively subpackaged into the PCR tubes.

TABLE 5BCR-ABL1 Main type reaction tube system preparation (Single person)

TABLE 6 BCR-ABL1 minor type reaction tube system preparation (Single person)

TABLE 7 ABL1 reaction tube systems preparation (Single person)

2. Amplifying by a real-time fluorescent PCR instrument: the fluorescence PCR reaction system containing the sample to be detected is placed in a fluorescence PCR amplification instrument (ABI 7500 or QuantStudio) after being subjected to short-time rapid centrifugation^TM5) In a 96-well plate, the experiment name, the positive quality control product, the negative quality control product and the quantitative reference product are correctly set, and the fluorescence channel and the amplification program are set. And after the setting is finished, running can be performed, and after the setting is finished, manual analysis is performed on the result.

3. Results reading and analysis: and storing the detection data file after the reaction is finished. 4 positive quantitative references (Standard in Task and concentration in Quantity corresponding to the positive quantitative reference in copies/mL) of BCR-ABL1(P210, P190) and internal control gene ABL1 were set in the corresponding order. Adjusting the Start Value, the End Value and the Threshold Value of Baseline according to the analyzed image (the user can adjust the Value according to the actual situation, the Start Value can be 3-15, the End Value can be 5-20, the highest fluorescence Value 1/20 is sampled at the Value of Threshold Value of Log map window, so that the Threshold Value line is positioned in the exponential phase of the amplification curve, the amplification curve of the negative quality control product is straight or lower than the Threshold Value line)), and the Standard curve graph under the 'Standard' window is optimal, namely R²The value (correlation value) is not less than 0.97. The "Report" window recording instrument automatically analyzes the calculated copy number of the unknown sample BCR-ABL1 (BCR-ABL1-Qty), and derives the result. And 4 positive quantitative reference products of the ABL1 are arranged again according to the corresponding sequence, and the copy number (ABL1-Qty) of the ABL1 of the unknown specimen is derived. (Note: Qty is an abbreviation for Quantity, for concentration).

4. And judging whether the sample to be detected is subjected to BCR-ABL1 fusion or not according to the detection result, and further calculating the BCR-ABL1 fusion gene expression quantity which is BCR-ABL1 fusion gene copy number/ABL 1 reference gene copy number.

The detection principle of real-time fluorescence quantitative PCR is as follows:

the real-time fluorescent quantitative PCR technology is based on TaqMan probe fluorescent quantitative PCR, wherein a fluorescent reporter group is marked at the 5 'end of the TaqMan probe, and a fluorescent quenching group is marked at the 3' end of the TaqMan probe. When the probe is intact, Fluorescence Resonance Energy Transfer (FRET) occurs between the two, and the fluorescent signal emitted by the reporter is absorbed by the quencher. When PCR is performed, Taq enzyme has exonuclease activity in the 5'→ 3' direction due to DNA polymerization, and further has exonuclease activity in the 5'-3' direction of the nucleotide sequence bound to the target sequence, which is encountered during the polymerization extension. When the probe is hydrolyzed, the distance between the reporter group and the quencher group is increased, and the inhibition effect is relieved, so that the fluorescent monitoring system can detect a fluorescent signal.

Based on the fluorescent quantitative PCR principle, the method is suitable for a real-time fluorescent PCR instrument to detect the fluorescent signal, and is based on the linear relation of positive correlation between the fluorescent signal intensity and the amplification cycle number. The number of DNA copies generated during the PCR reaction increases exponentially, and as the number of reaction cycles increases, the final PCR amplification product no longer increases exponentially, thereby entering a plateau. There is a linear relationship between the logarithmic value of the final product amount of PCR and the amount of the initial template, so that quantitative analysis can be selectively performed at the exponential growth stage of the fluorescence signal. When quantitative analysis is carried out, the Ct value of each template has a linear relation with the logarithm of the initial copy number of the template, and the Ct value is smaller when the initial copy number is larger. A standard curve can be made using a standard with a known starting copy number, so that the starting copy number of an unknown sample can be calculated from the standard curve as long as the Ct value of the sample is obtained.

Compared with the prior art, the invention has the beneficial effects that:

the invention provides a method, primers, probes and a kit for quantitatively detecting BCR-ABL1 fusion genes. The kit optimizes a specific primer probe and detects the main type and the minor type fusion genes of BCR-ABL 1. By using the specific primer and the probe provided by the invention, the transcription level of the BCR-ABL1 major (P210) or BCR-ABL1 minor (P190) fusion gene in peripheral whole blood or bone marrow samples of blood system tumors such as Chronic Myelogenous Leukemia (CML) or Acute Lymphoblastic Leukemia (ALL) can be quantitatively detected. Namely, BCR-ABL1 fusion gene copy number (P210 or P190)/ABL1 reference gene copy number). times.100%. The sensitivity of the invention can reach 500 copies/mL. The method has the advantages of simple process optimization, few required samples, stable and efficient performance, high accuracy and the like, the data analysis is automatic, and the result can be observed in real time. The invention is suitable for monitoring the transcription levels of the major type and the minor type of the BCR-ABL1 fusion gene of patients with Chronic Myelogenous Leukemia (CML) or Acute Lymphoblastic Leukemia (ALL), and clinically, the curative effect and the minimal residual condition of the Tyrosine Kinase Inhibitor (TKI) can be evaluated by regularly monitoring the transcription level of the BCR-ABL1 fusion gene of the patients, so that the dynamic tracking of the treatment effect is realized, the drug resistance or the disease progress is identified at an early stage, and the intervention and treatment are guided. And at present, similar kits are not on the market at home. The method is a feasible way for exploring early diagnosis and high-efficiency treatment of leukemia, and is worthy of popularization and application.

The present invention will be described in further detail with reference to the following examples. It should be understood that these examples are for illustrative purposes only and are not intended to limit the scope of the present invention. Experimental procedures for conditions not specified in detail in the following examples are generally carried out under conventional conditions such as those described in molecular cloning, A laboratory Manual (Huang Petang et al, Beijing: scientific Press, 2002) by Sambrook. J, USA, or under conditions recommended by the manufacturer. Unless otherwise indicated, percentages and parts are by weight. The test materials and reagents used in the following examples are commercially available without specific reference.

Example 1: kit and detection method

This example provides the components, packaging and quantity (20 reactions/cassettes) of a kit for quantitative detection of BCR-ABL1 fusion genes, as shown in Table 8.

TABLE 8 kit Components, packaging and quantities

This example provides a method for quantitative detection of BCR-ABL1 fusion gene using the above-described kit. The specific implementation steps are as follows:

the method comprises the following steps: extraction and quality detection of RNA template of sample to be detected

1) 2mL of peripheral blood of a leukemia patient is extracted and placed in a blood collection tube of EDTA or a sodium citrate anticoagulant, and the blood is stored at 4 ℃ after marking is done to ensure that label information is correct.

2) Nucleic acid extraction was performed using a nucleic acid extraction or purification kit (Yuejiu apparatus No. 20170583).

3) The concentration of the extracted nucleic acid is measured using a spectrophotometer (e.g., a NanoDrop2000 ultramicro spectrophotometer or other spectrophotometer). If the concentration is lower than 10 ng/muL, re-extraction is recommended after the sample quality is confirmed; if the concentration is higher than 100 ng/. mu.L, it is recommended to dilute the nucleic acid to 10-100 ng/. mu.L. The BCR-ABL1 strong positive quality control substance, the BCR-ABL1 critical positive quality control substance and the negative quality control substance in the kit all participate in nucleic acid extraction.

Step two: preparation of real-time fluorescent PCR amplification reaction system

And (3) taking out BCR-ABL 1P 210 PCR reaction solution A, BCR-ABL 1P 190 PCR reaction solution A, ABL1PCR reaction solution A, BCR-ABL 1PCR reaction solution B, BCR-ABL 1P 210 positive quantitative reference substance, BCR-ABL 1P 190 positive quantitative reference substance, ABL1 positive quantitative reference substance, BCR-ABL1 strong positive quality control substance, BCR-ABL1 critical positive quality control substance and negative quality control substance from the kit, melting the room temperature, then oscillating and uniformly mixing the substances, and using the substances after instantaneous centrifugation at 8,000 rpm.

1) Preparation of BCR-ABL1 main PCR reaction tube system

TABLE 9 BCR-ABL1 Main type reaction tube system preparation (Single person)

2) Preparation of secondary type reaction tube system of BCR-ABL1

TABLE 10 BCR-ABL1 minor PCR reaction tube system preparation (Single person)

3) ABL1PCR reaction tube system preparation

TABLE 11 ABL1 reaction tube System formulation (Single person)

Fully mixing the components to prepare corresponding BCR-ABL 1P 210 type, P190 type and ABL1PCR reaction tubes, instantaneously centrifuging to enable liquid on the tube wall to be completely centrifuged to the tube bottom, and then respectively subpackaging 30 mu L of amplification systems into the PCR tubes.

4) Sample adding: adding 20 mul of extracted nucleic acid of a sample to be detected, extracted quality control product and positive quantitative reference product of the corresponding genotype into the BCR-ABL1 major PCR reaction tube, the BCR-ABL1 minor PCR reaction tube and the ABL1PCR reaction tube respectively to make the total volume of each reaction be 50 mul. The tube caps were closed and transferred to amplification detection zones after transient centrifugation at 8,000 rpm.

5) PCR amplification

ABI 7500 instrument settings: after the software is opened, selecting 'New Experiment', setting negative quality control (NTC), positive quality control and Unknown Sample (Unknown) and positive quantitative reference product (Standard) according to the corresponding sequence of the samples, and setting the Name of the Sample in the column of 'Sample Name'; the FAM fluorescence channel was selected to collect the fluorescence signal. ABI 7500 instrument settings: FAM is selected by the Reporter; selecting NONE by the Quencher; and the Reference fluorescent Pasive Reference is NONE. The set cycling conditions were as follows: the volume of the reaction system was set to 50. mu.l.

And after the setting is finished, saving the file and operating the program.

QuantStudio^TM5, setting an instrument: after software is opened, selecting 'Create New Experiment', automatically presenting a guide interface, and naming according to requirements on the 'Experiment Properties' interface; program setting: selecting 'Method' on the guide interface to enter a program setting interface, and setting circulation conditions:

plate setting: selecting a "plate" interface to select None from the "Quick Setup" column compared with the fluorescent Pasive Reference; clicking "Advanced Setup" sets the detection channels Targets: FAM is selected by the Reporter; selecting NONE by the Quencher; selecting N for Task negative quality control; selecting U from a positive quality control sample and an unknown sample; and selecting S as a positive quantitative reference, and inputting the concentration of the quantitative reference in a 'Quantity' frame.

And after the setting is finished, saving the file and operating the program.

Step three: result reading and analysis

And storing the detection data file after the reaction is finished. BCR-ABL1(P210 type, P190 type) 4 positive quantitative references (Standard in Task and concentration in Quantity corresponding to the positive quantitative references in copies/mL) were set in the corresponding order. Adjusting the Start Value, the End Value and the Threshold Value of Baseline according to the analyzed image (the user can adjust the Value according to the actual situation, the Start Value can be 3-15, the End Value can be 5-20, the highest fluorescence Value 1/20 is sampled at the Value of Threshold Value of Log map window, so that the Threshold Value line is positioned in the exponential phase of the amplification curve, the amplification curve of the negative quality control product is straight or lower than the Threshold Value line)), and the Standard curve graph under the 'Standard' window is optimal, namely R²The value (correlation value) is not less than 0.97. The "Report" window recording instrument automatically analyzes the calculated copy number of the unknown sample BCR-ABL1 (BCR-ABL1-Qty), and derives the result. And 4 positive quantitative reference products of the ABL1 are arranged again according to the corresponding sequence, and the copy number (ABL1-Qty) of the ABL1 of the unknown specimen is derived. (Note): qty is an abbreviation for Quantity, for concentration).

Step four: result judgment

1. And (4) judging an internal control result: the FAM channel of the ABL1PCR reaction tube of the sample to be detected has an obvious amplification curve, Ct is less than or equal to 30, and if the condition is met, the result judgment is carried out according to 2; if the condition is not met, the detection result of the sample is invalid, and the re-detection is recommended after the quality of the nucleic acid or the sample is confirmed.

2. Judging the result of the PCR reaction tube (primary type and secondary type) of BCR-ABL 1:

1) if the FAM detection channel of the BCR-ABL 1PCR reaction tube has no amplification curve or has an amplification curve but the Ct value is more than 38, the BCR-ABL1 RNA concentration of the sample is judged to be lower than the lowest detection limit of the kit.

2) If the FAM detection channel amplification curve of the BCR-ABL 1PCR reaction tube has an obvious logarithmic growth period and the Ct value is less than or equal to 38, judging that the BCR-ABL1 is positive, and further carrying out quantitative result judgment according to the following method:

if the expression level of 1.0E +03copies/ml is less than or equal to BCR-ABL1-Qty is less than or equal to 1.0E +08copies/ml, the expression level of BCR-ABL1 of the sample is BCR-ABL1-Qty/ABL 1-Qty;

if BCR-ABL1-Qty >1.0E +08copies/ml, it is recommended to dilute the sample to a linear range for detection;

if BCR-ABL1-Qty < 1.0E +03copies/ml is less than or equal to 500copies/ml, the quantitative result is only used as a reference.

Note: the BCR-ABL1 primary and secondary reactions were interpreted separately.

FIG. 1 shows a negative quality control test plan.

FIG. 2 shows the result of BCR-ABL1 strong positive quality control test.

FIG. 3 shows the result of critical positive quality control test of BCR-ABL 1.

FIG. 4 shows the detection results of the BCR-ABL1 major type quantitative reference.

FIG. 5 shows the detection results of the BCR-ABL1 minor form of the quantitative reference.

Figure 6 shows the ABL1 quantitative reference detection results.

Example 2: sensitivity detection and minimum detection rate experiment of kit

The BCR-ABL1 major sample L1 and the BCR-ABL1 minor sample L2 with the calibrated concentration close to the detection limit of 500copies/mL are selected for verification. And (3) extracting nucleic acid according to the step one, and detecting two pairs of samples in the step, wherein 10 multitubules are used for each detection. The operation is strictly carried out according to the kit instructions, and the detection is carried out on a real-time PCR system. And after the amplification is finished, reading and analyzing the experimental result according to the third step, and judging the result according to the fourth step.

The sensitivity and the lowest detection limit of the present invention were measured, and the test results are shown in table 12 below.

TABLE 12 results of minimum detection limit of kit

The sensitivity detection result of the kit conforms to a theoretical value, and the sensitivity detection is good; the corresponding fusion gene can be stably detected, and the positive coincidence rate is 100%.

Example 3: reproducibility of the kit

Based on the number of copies of the control sample measured, a total of 4 duplicate reference samples were prepared, numbered R1-R4. R1-R2 is formed by mixing BCR-ABL1 main type (P210) positive sample nucleic acid and 10 ng/. mu.L negative sample nucleic acid; R3-R4 was composed of a mixture of BCR-ABL1 minor (P190) positive sample nucleic acid and 10 ng/. mu.L negative sample nucleic acid. The BCR-ABL1 major (P210) and BCR-ABL1 minor (P190) sample nucleic acids were copy number confirmed by digital PCR.

And (3) taking the prepared R1-R4 as a sample to be detected, detecting a repetitive reference product (R1-R4), repeatedly detecting for 10 times, and carrying out statistical calculation on the variation coefficient of the logarithmic value of the concentration of the sample for 10 times. The detection results of R1-R2 are positive for BCR-ABL1 major (P210) fusion genes; the detection results of R3-R4 are positive for BCR-ABL1 minor type (P190) fusion genes; the coefficient of variation (CV,%) of R1-R4 concentration logarithm is less than or equal to 5%. The results are shown in Table 13.

TABLE 13 kit repeatability test results

The detection result shows that: the coefficient of variation CV values of the concentration logarithm values of the repetitive reference products R1-R4 are all less than 5%. Conforms to CSLI EP5-A3 and conforms to the precision requirement of a quantitative detection method.

Example 4: accuracy of the kit

Based on the number of copies of the control sample determined, a total of 6 positive test samples were prepared, numbered P1-P6, respectively. P1-P3 is prepared by mixing BCR-ABL1 main type positive sample nucleic acid with different copy numbers (high, medium and low) and negative sample nucleic acid of 10 ng/. mu.L; P4-P6 was prepared by mixing BCR-ABL1 secondary positive sample nucleic acid of different copy numbers of high, medium and low and negative sample nucleic acid of 10 ng/. mu.L.

And detecting a positive reference substance (P1-P6) by using the prepared P1-P6 as a sample to be detected. The detection results of P1-P3 are positive for BCR-ABL1 major (P210) fusion genes; the detection results of P4-P6 are positive for BCR-ABL1 minor type (P190) fusion genes, and the coincidence rate is 100%. The results are shown in Table 14.

TABLE 14 accuracy test results of the kit

The detection result shows that: the results of the positive reference products P1-P3 are positive for the main type fusion gene of BCR-ABL 1; the results of P4-P6 should all be positive for the BCR-ABL1 minor fusion gene. The kit provided by the invention is better in accuracy.

Example 5: clinical application experiment

2mL of peripheral blood of 10 leukemia patients is extracted and placed in blood collection tubes of EDTA or sodium citrate anticoagulant, and 10 patients providing blood samples are determined by BCR-ABL1 fusion gene types through a Sanger sequencing method; the samples are marked and the label information is ensured to be correct, and the samples are stored at 4 ℃. Extracting nucleic acid with nucleic acid extraction or purification reagent (Yuejiu instrument No. 20170583) according to kit instructions; and (3) detecting the extracted nucleic acid by using a spectrophotometer (such as a NanoDrop2000 ultramicro spectrophotometer or other spectrophotometer instruments), wherein the purity of the nucleic acid is required to meet the condition that the ratio of A260/A280 is in the range of 1.8-2.2, the concentration is not lower than 10 ng/mu L, and the template nucleic acid can be directly used for subsequent experiments or stored at-80 ℃ for later use, so that repeated freeze thawing is avoided.

Respectively taking 20 mu L of the RNA template of each sample and the control sample in the kit, and adding the RNA template and the control sample into eight connected tubes of the fluorescent PCR amplification reaction system prepared in the step two to ensure that the total volume of reaction liquid in each tube is 50 mu L; and (3) tightly covering the tube caps of the eight connecting tubes, fully mixing the mixture, centrifuging the mixture at a high speed for 10 seconds, and performing PCR amplification. After the amplification is finished, reading and analyzing the result according to the third step, and judging the result according to the fourth step.

The detection result is as follows: of the 10 samples, 5 samples were positive for BCR-ABL1 fusion (P210 in 3 cases and P190 in 2 cases), and 5 samples were negative, and the consistency of the detected results with those detected by Sanger sequencing method was 100%.

FIG. 7 shows the results of a typical BCR-ABL1 major (P210) clinical sample assay.

FIG. 8 shows the results of a typical BCR-ABL1 minor form (P190) clinical sample test.

Comparative example 1

The inventor designs dozens of primer probes aiming at a target sequence after deeply comparing and analyzing the gene sequence of the BCR-ABL1 fusion gene, and expects to obtain a primer probe combination which can accurately and quantitatively detect 2 fusion genes and has high sensitivity.

Due to the differences in primer specificity, the inconsistency in annealing temperature and the like, it is difficult to obtain high-sensitivity fluorescent PCR amplification primers and probe sequences capable of performing synchronous amplification for a plurality of targets. The inventor optimally selects and verifies the designed primers and probes through a large number of experiments, wherein the standard curve of most primer probe systems is difficult to meet the requirement of quantitative detection, and some primer probe systems have better standard curves but lower sensitivity.

For example, the following control primer pairs were used for detection, and the other detection steps and conditions were the same as in the above example:

table 15P 210 control system 1:

TABLE 16P 190 control System 1

The detection is carried out according to the method of example 1, and the detection result shows that the standard curve of the P210 control system 1 is poor and cannot meet the requirement of quantitative detection, and the detection result of the quantitative reference substance of the P210 control system 1 is shown in FIG. 9. The standard curve of the P190 control system 1 is better, and can meet the requirement of quantitative detection.

The sensitivity detection and the lowest detection rate experiment are carried out according to the method of example 2, the result shows that the sensitivity of the P190 control system 1 is poor, and the positive coincidence rate is only 80 percent when the detection is carried out on the BCR-ABL1 minor type sample (10 double tubes) with the concentration of 500 copies/mL.

All documents referred to herein are incorporated by reference into this application as if each were individually incorporated by reference. Furthermore, it should be understood that various changes and modifications of the present invention can be made by those skilled in the art after reading the above teachings of the present invention, and these equivalents also fall within the scope of the present invention as defined by the appended claims.

Sequence listing

<110> Guangzhou Daan Gene GmbH

<120> primer, probe and kit for quantitatively detecting BCR-ABL1 fusion gene

<130> 020093

<160> 18

<170> SIPOSequenceListing 1.0

<210> 1

<211> 23

<212> DNA

<213> Artificial sequence (Artificial sequence)

<400> 1

gaccaactcg tgtgtgaaac tcc 23

<210> 2

<211> 22

<212> DNA

<213> Artificial sequence (Artificial sequence)

<400> 2

ctcagaccct gaggctcaaa gt 22

<210> 3

<211> 18

<212> DNA

<213> Artificial sequence (Artificial sequence)

<400> 3

gtgtccgagg ccaccatc 18

<210> 4

<211> 22

<212> DNA

<213> Artificial sequence (Artificial sequence)

<400> 4

gaggctcaaa gtcagatgct ac 22

<210> 5

<211> 23

<212> DNA

<213> Artificial sequence (Artificial sequence)

<400> 5

agcataacta aaggtgaaaa gct 23

<210> 6

<211> 20

<212> DNA

<213> Artificial sequence (Artificial sequence)

<400> 6

agcagatact cagcggcatt 20

<210> 7

<211> 23

<212> DNA

<213> Artificial sequence (Artificial sequence)

<400> 7

atgctactgg ccgctgaagg gct 23

<210> 8

<211> 22

<212> DNA

<213> Artificial sequence (Artificial sequence)

<400> 8

cgctgaaggg cttctgcgtc tc 22

<210> 9

<211> 25

<212> DNA

<213> Artificial sequence (Artificial sequence)

<400> 9

aggcccatgg taccaggagt gtttc 25

<210> 10

<211> 761

<212> DNA

<213> Artificial sequence (Artificial sequence)

<400> 10

cgggatcccg agttacacgt tcctgatctc ctctgactat gagcgtgcag agtggaggga 60

gaacatccgg gagcagcaga agaagtgttt cagaagcttc tccctgacat ccgtggagct 120

gcagatgctg accaactcgt gtgtgaaact ccagactgtc cacagcattc cgctgaccat 180

caataaggaa gatgatgagt ctccggggct ctatgggttt ctgaatgtca tcgtccactc 240

agccactgga tttaagcaga gttcaaaagc ccttcagcgg ccagtagcat ctgactttga 300

gcctcagggt ctgagtgaag ccgctcgttg gaactccaag gaaaaccttc tcgctggacc 360

cagtgaaaat gaccccaacc ttttcgttgc actgtatgat tttgtggcca gtggagataa 420

cactctaagc ataactaaag gtgaaaagct ccgggtctta ggctataatc acaatgggga 480

atggtgtgaa gcccaaacca aaaatggcca aggctgggtc ccaagcaact acatcacgcc 540

agtcaacagt ctggagaaac actcctggta ccatgggcct gtgtcccgca atgccgctga 600

gtatctgctg agcagcggga tcaatggcag cttcttggtg cgtgagagtg agagcagtcc 660

tggccagagg tccatctcgc tgagatacga agggagggtg taccattaca ggatcaacac 720

tgcttctgat ggcaagcata agaatgcggc cgctaaacta t 761

<210> 11

<211> 888

<212> DNA

<213> Artificial sequence (Artificial sequence)

<400> 11

cgggatcccg gctcctgcgc agccagagca cctctgagca ggagaagcgc cttacctggc 60

cccgcaggtc ctactccccc cggagttttg aggattgcgg aggcggctat accccggact 120

gcagctccaa tgagaacctc acctccagcg aggaggactt ctcctctggc cagtccagcc 180

gcgtgtcccc aagccccacc acctaccgca tgttccggga caaaagccgc tctccctcgc 240

agaactcgca acagtccttc gacagcagca gtccccccac gccgcagtgc cataagcggc 300

accggcactg cccggttgtc gtgtccgagg ccaccatcgt gggcgtccgc aagaccgggc 360

agatctggcc caacgatggc gagggcgcct tccatggaga cgcagaagcc cttcagcggc 420

cagtagcatc tgactttgag cctcagggtc tgagtgaagc cgctcgttgg aactccaagg 480

aaaaccttct cgctggaccc agtgaaaatg accccaacct tttcgttgca ctgtatgatt 540

ttgtggccag tggagataac actctaagca taactaaagg tgaaaagctc cgggtcttag 600

gctataatca caatggggaa tggtgtgaag cccaaaccaa aaatggccaa ggctgggtcc 660

caagcaacta catcacgcca gtcaacagtc tggagaaaca ctcctggtac catgggcctg 720

tgtcccgcaa tgccgctgag tatctgctga gcagcgggat caatggcagc ttcttggtgc 780

gtgagagtga gagcagtcct ggccagaggt ccatctcgct gagatacgaa gggagggtgt 840

accattacag gatcaacact gcttctgatg gcaagcccca agcttggg 888

<210> 12

<211> 625

<212> DNA

<213> Artificial sequence (Artificial sequence)

<400> 12

cgggatccgg accgagctgg gagaggggct ccggcccgat cgttcgcttg gcgcaaaatg 60

ttggagatct gcctgaagct ggtgggctgc aaatccaaga aggggctgtc ctcgtcctcc 120

agctgttatc tggaagaagc ccttcagcgg ccagtagcat ctgactttga gcctcagggt 180

ctgagtgaag ccgctcgttg gaactccaag gaaaaccttc tcgctggacc cagtgaaaat 240

gaccccaacc ttttcgttgc actgtatgat tttgtggcca gtggagataa cactctaagc 300

ataactaaag gtgaaaagct ccgggtctta ggctataatc acaatgggga atggtgtgaa 360

gcccaaacca aaaatggcca aggctgggtc ccaagcaact acatcacgcc agtcaacagt 420

ctggagaaac actcctggta ccatgggcct gtgtcccgca atgccgctga gtatctgctg 480

agcagcggga tcaatggcag cttcttggtg cgtgagagtg agagcagtcc tggccagagg 540

tccatctcgc tgagatacga agggagggtg taccattaca ggatcaacac tgcttctgat 600

ggcaagctct acgtctaagc ttggg 625

<210> 13

<211> 22

<212> DNA

<213> Artificial sequence (Artificial sequence)

<400> 13

ctccagactg tccacagcat tc 22

<210> 14

<211> 21

<212> DNA

<213> Artificial sequence (Artificial sequence)

<400> 14

gcgagaaggt tttccttgga g 21

<210> 15

<211> 24

<212> DNA

<213> Artificial sequence (Artificial sequence)

<400> 15

cggcttcact cagaccctga ggct 24

<210> 16

<211> 18

<212> DNA

<213> Artificial sequence (Artificial sequence)

<400> 16

gagttttgag gattgcgg 18

<210> 17

<211> 18

<212> DNA

<213> Artificial sequence (Artificial sequence)

<400> 17

tgcgagttct gcgaggga 18

<210> 18

<211> 25

<212> DNA

<213> Artificial sequence (Artificial sequence)

<400> 18

ttttgtcccg gaacatgcgg taggt 25

Claims (10)

1. A set of primer pairs for detecting a BCR-BAL1 fusion gene, the set of primer pairs comprising:

a first primer pair comprising a forward primer as set forth in SEQ ID No.:1 and a reverse primer as set forth in SEQ ID No.: 2;

a second primer pair group comprising a forward primer as set forth in SEQ ID No. 3; and, a reverse primer as set forth in SEQ ID No. 4;

a third primer pair group comprising forward primers as set forth in SEQ ID No. 5; and, a reverse primer as set forth in SEQ ID No. 6.

2. A probe set for detecting a BCR-BAL1 fusion gene, the probe set comprising: a first probe represented by SEQ ID No. 7; a second probe represented by SEQ ID No. 8; and a third probe represented by SEQ ID NO. 9.

3. A kit for detecting a BCR-BAL1 fusion gene, comprising the primer set of claim; and/or the probe set of claim 2.

4. The kit of claim 3, comprising a first container containing a first primer probe mixture comprising the nucleic acid sequence of SEQ ID NO: 1. a polynucleotide sequence shown in SEQ ID No. 2 and SEQ ID No. 7.

5. The kit of claim 4, further comprising a second container, wherein the second container comprises a second primer probe mixture, and wherein the primer probe mixture comprises the nucleotide sequence of SEQ ID NO: 3. a polynucleotide sequence shown in SEQ ID No. 4 and SEQ ID No. 8.

6. The kit of claim 5, further comprising a third container, wherein the third container comprises a third primer probe mixture, and wherein the primer probe mixture comprises the nucleotide sequence set forth in SEQ ID NO: 5. the polynucleotide sequence shown in SEQ ID No. 6 and SEQ ID No. 9.

7. The kit of claim 6, further comprising a fourth container comprising one or more components selected from the group consisting of: hot start Taq enzyme, reverse transcriptase, and dntps.

8. The kit of claim 7, further comprising an independently dispensed BCR-ABL 1P 210 type positive reference, wherein the BCR-ABL 1P 210 type positive reference is a plasmid containing a fragment of interest of BCR-ABL 1P 210 type; preferably, theThe concentration gradient of the BCR-ABL 1P 210 positive quantitative reference substance is 2 multiplied by 10⁶copies/ml、2×10⁵copies/ml、2×10⁴copies/ml, and 2X 10³copies/ml；

The kit also comprises an independently subpackaged BCR-ABL 1P 190 type positive quantitative reference substance, wherein the BCR-ABL 1P 190 type positive quantitative reference substance is a plasmid containing a BCR-ABL 1P 190 type target fragment; preferably, the concentration gradient of the BCR-ABL 1P 190 type positive quantitative reference substance is 2 x 10⁶copies/ml、2×10⁵copies/ml、2×10⁴copies/ml, and 2X 10³copies/ml; and/or

The kit also comprises an independently subpackaged ABL1 positive quantitative reference substance, wherein the ABL1 positive quantitative reference substance is a plasmid containing an ABL1 target fragment; preferably, the concentration gradient of the ABL1 positive quantitative reference substance is 2 x 10⁶copies/ml、2×10⁵copies/ml、2×10⁴copies/ml, and 2X 10³copies/ml。

9. A method of detecting a BCR-BAL1 fusion gene, the method comprising the steps of:

(1) providing a nucleic acid sample of an object to be detected;

(2) preparing a PCR reaction system and carrying out PCR detection:

the PCR reaction system comprises a BCR-ABL1 primary reaction tube system, a BCR-ABL1 secondary reaction tube system and an ABL1 reaction tube system;

wherein the PBCR-ABL1 main type reaction tube system comprises the nucleic acid sample prepared in the step (1) and the first primer probe mixed solution; the BCR-ABL1 minor-type reaction tube system comprises the nucleic acid sample prepared in the step (1) and the second primer probe mixed solution; the ABL1 reaction tube system comprises the nucleic acid sample prepared in the step (1) and the third primer probe mixed solution.

10. Use of the primer pair set of claim 1, and/or the probe set of claim 2, for preparing a PCR detection kit for detecting BCR-ABL1 fusion genes.

Images