CN105274219B - Purposes of the CL5547.Contig2 gene in the analysis of pumpkin gene expression real-time fluorescence quantitative PCR as reference gene - Google Patents

Purposes of the CL5547.Contig2 gene in the analysis of pumpkin gene expression real-time fluorescence quantitative PCR as reference gene Download PDF

Info

Publication number
CN105274219B
CN105274219B CN201510657559.6A CN201510657559A CN105274219B CN 105274219 B CN105274219 B CN 105274219B CN 201510657559 A CN201510657559 A CN 201510657559A CN 105274219 B CN105274219 B CN 105274219B
Authority
CN
China
Prior art keywords
gene
pumpkin
expression
contig2
analysis
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Active
Application number
CN201510657559.6A
Other languages
Chinese (zh)
Other versions
CN105274219A (en
Inventor
别之龙
孔秋生
张群芳
曹蕾
高凌云
谢俊俊
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Huazhong Agricultural University
Original Assignee
Huazhong Agricultural University
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Huazhong Agricultural University filed Critical Huazhong Agricultural University
Priority to CN201510657559.6A priority Critical patent/CN105274219B/en
Publication of CN105274219A publication Critical patent/CN105274219A/en
Application granted granted Critical
Publication of CN105274219B publication Critical patent/CN105274219B/en
Active legal-status Critical Current
Anticipated expiration legal-status Critical

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
    • C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
    • C12Q1/6895—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms for plants, fungi or algae
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00—Oligonucleotides characterized by their use
    • C12Q2600/158—Expression markers
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00—Oligonucleotides characterized by their use
    • C12Q2600/166—Oligonucleotides used as internal standards, controls or normalisation probes

Landscapes

  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Analytical Chemistry (AREA)
  • Engineering & Computer Science (AREA)
  • Organic Chemistry (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Health & Medical Sciences (AREA)
  • Biotechnology (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • Immunology (AREA)
  • Mycology (AREA)
  • Microbiology (AREA)
  • Molecular Biology (AREA)
  • Botany (AREA)
  • Biophysics (AREA)
  • Physics & Mathematics (AREA)
  • Biochemistry (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • General Engineering & Computer Science (AREA)
  • General Health & Medical Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)

Abstract

The invention belongs to gene expression analysis technical fields, and in particular to purposes of the CL5547.Contig2 gene in the analysis of pumpkin gene expression real-time fluorescence quantitative PCR as reference gene.The present invention utilizes pumpkin transcript profile data, the expression and stability of gene are compared in full-length genome level, the gene for therefrom selecting 10 expression stable, selecting 2 simultaneously, commonly tradition reference gene is used as control in pumpkin, 12 genes are compared in abiotic stress, biotic and plant growth regulator treatment (GA3, ABA, NAA, ETH the expression stability under) in the different tissues organ of two pumpkin varieties, it is verified by using CAT1 and CAT2 gene, determine the expression stability highest of CL5547.Contig2 gene, it is the best reference gene of pumpkin gene expression real-time fluorescence quantitative PCR analysis.

Description

CL5547.Contig2 gene is analyzed in pumpkin gene expression real-time fluorescence quantitative PCR The middle purposes as reference gene
Technical field
The invention belongs to molecular biology of plants technical fields, and in particular to needed for pumpkin gene expression analysis process Reference gene.
Background technique
Gene expression analysis is the important means for studying gene function and transcriptional level control.Real-time fluorescence quantitative PCR (qRT-PCR) because having the characteristics that high sensitivity, high specific, high precision and cost is relatively low, it is widely used in gene The quantitative analysis of expression.In qRT-PCR analysis, in order to obtain the real difference of target gene expression level, need to eliminate not With difference present on sample rna yield and quality and reverse transcription efficiency.Eliminating the difference between sample under normal conditions is to use Reference gene is corrected and standardizes, i.e., by measuring the expression quantity of target gene and reference gene respectively, by internal reference base Because expression quantity calculates the relative expression quantity of target gene as a standard, then between comparative sample relative expression quantity difference It is different.Relative quantitation method is simple, accurate, efficient, and application is very extensive, but needs to select suitable reference gene.In ideal Ginseng gene should be that expression is stablized in all samples, including different treatment conditions, different tissue site and not Same growth and development period.Therefore, it is depended on using the accuracy that qRT-PCR carries out relative quantification to target gene using process Reference gene that system is verified, expression is stable.
Pumpkin is Curcurbitaceae cucurbita plants, is a kind of important vegetable crop.Chinese cultivated pumpkin area is only second to print Degree occupies the second in the world, and total output ranks first in the world.Pumpkin favorable genes and regulation net are excavated using the method for gene expression analysis Network is the premise for carrying out pumpkin genetic improvement.Mostly used in pumpkin gene expression analysis at present is traditional reference gene, These traditional reference genes are simultaneously verified without system, and stability is poor, so as to cause the accuracy of pumpkin gene expression analysis It is poor.
Summary of the invention
The purpose of the invention is to improve the accuracy of pumpkin gene expression analysis, excavated from pumpkin transcript profile data A batch expresses more stable gene out, and it is more further to compare pumpkin and pumpkin of these genes under the conditions of different disposal Expression stability in kind tissue site, finishing screen select the stable reference gene suitable for pumpkin gene expression analysis.
The present invention solves principle used by its technical problem: transcript profile sequencing can obtain full gene on genome Expression data.The present invention utilizes the sequencing result of transcript profile, and the expression quantity and table of gene are compared in full-length genome level Up to stability, it has been screened out from it that expression is stable, reference gene suitable for cooking pumpkin gene expression analysis.
The technical solution adopted by the present invention to solve the technical problems is: comparing pumpkin according to the analysis of pumpkin transcript profile data The stability of gene expression, the gene for selecting 10 expression stable have selected forefathers in pumpkin as candidate reference gene On use 2 traditional reference genes (CAC, EF-1A) as control, determine 12 candidate reference genes using qRT-PCR At two pumpkin variety (C13-3, C13-84) different tissues positions, abiotic stress (salt, low temperature, arid), biotic (melon Class fruit blotch, watermelon blight, Muskmelon Fusarium wilt, root rot) and plant growth regulator (GA3, ABA, NAA, ETH) under altogether Expression in 60 samples calculates with NormFinder and compares the expression stability of 12 candidate reference genes, wherein The expression stability highest of CL5547.Contig2, suitable for doing the reference gene of pumpkin gene expression analysis.
Present invention is characterized in that comparing pumpkin gene on full-length genome using pumpkin transcript profile sequencing result Expression stability therefrom screens and demonstrates expression reference gene that is stable, being suitable as pumpkin gene expression analysis.
The invention has the advantages that
(1) expression stability is high: the present invention utilizes pumpkin transcript profile data, compares gene in full-length genome level Expression and stability, and it has been screened out from it suitable reference gene, and traditional reference gene is in transcriptome analysis Expression and stability is not high.Therefore, the expression stability for the reference gene that the present invention obtains is better than biography used at present System reference gene.
(2) applied widely: the present invention analyzes new reference gene at two pumpkin variety different tissues positions, abiotic Coerce (salt, low temperature, arid), biotic (fruit blotch, wilt disease, wilt disease, root rot), plant growth regulator treatment Expression stability under (GA3, ABA, NAA, ETH), therefore, present invention reference gene obtained have wide applicability.
Detailed description of the invention
Fig. 1: the PCR amplification and agarose gel electrophoresis testing result of candidate reference gene.
The PCR amplification and agarose gel electrophoresis testing result of Fig. 2: CAT family gene.
Fig. 3: it with the expression of CL5547.Contig2 and CAC gene standardization target gene (CAT1 gene), examines at PEG Manage lower expression of the CAT1 gene in C13-84 blade.
Fig. 4: it with the expression of CL5547.Contig2 and CAC gene standardization target gene (CAT2 gene), examines at PEG Manage lower expression of the CAT2 gene in C13-84 blade.
Specific embodiment
Embodiment 1
(1) vegetable material and processing:
Test material be giant pumpkin (C13-3, Cucurbita.maxima D.) and musky gourd (C13-84, Cucurbita.moschata D.), the nursery in national vegetables improvement center Central China branch center artificial climate room.Three leaves are wholeheartedly Period plant part is colonized in gardening forestry institute of Hua Zhong Agriculture University Vegetable Base, takes plant tendril in florescence, does not pollinate Ovary, stamen, gynoecium, petal；Other experiment process continue to carry out in the controlled environment chamber simultaneously, including abiotic stress, life Object stress and plant growth regulator treatment.Abiotic stress is salt stress, Osmotic treatment, low-temperature treatment.Salt stress is 100mM NaCl processing respectively in 0h, 4h, 6h, 12h, for 24 hours plant root, stem, leaf are sampled；Low-temperature treatment be 10 DEG C, respectively 0h, 2h, 6h, 12h, plant root, stem, leaf are taken for 24 hours；Drought stress be 15% PEG 6000 handle, respectively in 0h, 12h, for 24 hours, 48h, 72h take the root, stem, leaf of plant.Biotic is bacterium fruit blotch (Bacterial Fruit Blotch), watermelon is withered Disease (Fusarium oxysporum f.sp.niveum) No. 1 biological strain, Muskmelon Fusarium wilt (Fusarium oxysporum (Schl.) f.sp.melonis), root rot (Fu-asarium solani (Mart) Sacc.), sample time be 0d, 1d, 3d, 5d, 7d, sampling point are root, stem, leaf.Plant growth regulator is GA3 (gibberellin), ABA (abscisic acid), NAA (naphthalene second Acid), ETH (ethylene), concentration be 100uM sample time be 0h, 6h, 12h, for 24 hours, 48h, sampling point be root, stem, leaf.It is all Liquid nitrogen flash freezer when material samples, -80 DEG C of preservations.
(2) extraction and the synthesis of the first chain cDNA of RNA:
Experimental material TaKaRa (Plant RNA Extraction Kit；The step of including genomic DNA removal) point From total serum IgE is extracted, there are 3 biology to repeat between the different processing of each kind.With the concentration of Nanodrop2000 detection RNA And quality, the ratio of A260/A280 and A260/A230 will be between 1.8-2.The integrality of RNA uses 2% Ago-Gel Electrophoresis is detected, and electrophorogram 28S, 18S band is clear, shows that RNA integrality is preferable.After RNA detection is qualified, then carry out anti- Responsive transcription.1uL total serum IgE uses PrimeScriptTMRT reagent Kit with gDNA Eraser (TaKaRa) reagent Box carries out genomic DNA removal first, then carries out reverse transcription (two-step method: 37 DEG C of 15min；85 DEG C of 5s) form 20 the first chains of μ L cDNA.Sample carries out reverse transcription respectively between two kind different disposals, and every portion material is all repeated, as backup.-80℃ It saves.
(3) selection of candidate reference gene, design of primers and PCR amplification:
Transcript profile data are analyzed, Unigene15429 (nucleotide sequence is shown in SEQ ID NO:4), Unigene16959 are selected (nucleotide sequence is shown in SEQ ID NO:5), CL5002.Contig7 (nucleotide sequence is shown in SEQ ID NO:6), Unigene18197 (nucleotide sequence is shown in SEQ ID NO:7), Unigene4095 (nucleotide sequence is shown in SEQ ID NO:8), Unigene2257 (nucleotide sequence is shown in SEQ ID NO:9), CL10326.Contig1 (nucleotide sequence is shown in SEQ ID NO: 10), CL5479.Contig4 (nucleotide sequence is shown in SEQ ID NO:11), (nucleotide sequence is shown in SEQ to CL5547.Contig2 ID NO:3), CL4328.Contig3 (nucleotide sequence is shown in SEQ ID NO:12) is as candidate reference gene.
Above-mentioned 10 candidate internal references are in the website NCBI (http://www.ncbi.nlm.nih.gov/tools/primer- Blast/ design of primers) is carried out, and primer and transcript profile data are subjected to Blast, amplified production length is controlled in 80-150bp Between.And sequence (Obrero, the A reported in CAC, EF-1A primer bibliography；Die,JV；Roman,B；Gomez,P； Nadal,S；Gonzalez-Verdejo,CI Obrero,Alameda Obispo:Selection of Reference Genes for Gene Expression Studies in Zucchini(Cucurbita pepo)Using qPCR.JOURNAL OF AGRICULTURAL AND FOOD CHEMISTRY,2011；59(10):5402.).By every part of material The mixing of cDNA sample, carries out standard PCR amplification (Standard PCR program: 95 DEG C of pre- changes with the cDNA of the primer pair aggregate sample of synthesis Property 5min, 94 DEG C of denaturation 30s, 56 DEG C of annealing 30s, 72 DEG C of extension 30s, 31 circulation, 72 DEG C of extension 4min), the amplification of PCR is adopted With 2 × PCR reactant (Tiangeng biochemical technology Co., Ltd), product is detected with 2% agarose gel electrophoresis, candidate internal reference Gene (Unigene15429, Unigene16959, CL5002.Contig7, Unigene18197, Unigene4095, Unigene2257, CL10326.Contig1, CL5479.Contig4, CL5547.Contig2, CL4328.Contig3, CAC, EF-1A) cDNA band is that clearly unique band shows that the primer has specificity.The primer sequence of candidate reference gene and expansion Increase feature and be shown in Table 1, specific amplification testing result is shown in Fig. 1.
The candidate primer sequence of reference gene of table 1 and the expansion of qRT-PCR
Sequence table SEQ ID NO:1 is the forward primer sequence of CL5547.Contig2 primer.Sequence table SEQ ID NO:2 It is the reverse primer sequences of CL5547.Contig2 primer.Sequence table SEQ ID NO:3 is the core of CL5547.Contig2 gene Nucleotide sequence.
(4) qRT-PCR is analyzed:
QRT-PCR uses TransStartTMTop Green qPCR SuperMix (Tiangeng biochemical technology Co., Ltd) As fluorescent dye.Test uses 12 μ L loading systems, including 2 μ L templates (100ng), each 2 μ L (5nmol) of front and back primer, 6 μ L 2 × TransStart Top Green qPCR SuperMix.QRT-PCR is detected in Roche480 real-time fluorescence quantitative PCR It is carried out in system, PCR cycle is as follows:
94℃30s
Fluorescence is acquired in 56 DEG C of this steps.Final Cp (Crossing point) value includes all stress and different groups The biology for knitting organ sample repeats and technology repeats.Primer standard curve is analyzed, is calculated primer amplification efficiency (E).By mixed It closes sample cDNA successively to dilute 5 concentration (450,90,18,3.6 and 0.72ng/uL) with 5 times of concentration gradient, carries out qRT- PCR, with the calculation formula E=(10 of amplification efficiency-1//slope- 1) it × 100 is calculated.
(5) candidate reference gene stability analysis:
To Cp value of 12 candidate reference genes in 60 samples, according to Q=(1+E)(minCp-sampleCp)Formula carries out Data conversion is handled, different tissues position is divided into 6 groups, use then to the data after each candidate internal reference conversion by Different stress NormFinder software calculation expression stationary value M, the results are shown in Table 2.The M value of CL5547.Contig2 is minimum as shown in Table 2, shows It expresses most stable in the processing of pumpkin Different stress and different tissues position, is optimal reference gene.Currently pumpkin not The 9th is only come with the EF-1A for being used as reference gene progress quantitative expression analysis in Stress treatment, shows that it is not suitable for being used as The reference gene of gene expression analysis in pumpkin Different stress treatment process.
The stationary value and sequence of the NormFinder candidate reference gene calculated of table 2
Stability sequence Gene Name Stationary value (M)
1 CL5547.Contig2 0.430
2 Unigene16959 0.491
3 CAC 0.498
4 CL5002.Contig7 0.519
5 CL10326.Contig1 0.664
6 Unigene2257 0.703
7 Unigene4095 0.722
8 Unigene15429 0.746
9 EF-1A 0.836
10 Unigene18197 0.893
11 CL4328.Contig3 0.969
12 CL5479.Contig4 1.014
(6) candidate reference gene reliability demonstration:
C13-84 pumpkin is sampled for 0,1,3,5,7 day what 15%PEG was handled, for analyzing CAT family gene (CAT family gene bibliography: Neelam A, Korakot N, Wen hui L, Jinghua Y, Zhongyuan H, Mingfang Z:Antioxidant Enzymatic Activities and Gene Expression Associated with Heat Tolerance in the Stems and Roots of Two Cucurbit Species("Cucurbita maxima"and"Cucurbita moschata")and Their Interspecific Inbred Line"Maxchata" .International Journal of Molecular Sciences.12/2013；14 (12): 24008-24028) table Expression patterns.The sequence of family gene is obtained at ncbi database (http://www.ncbi.nlm.nih.gov/).Using online Design of primers website (http://cgi-www.daimi.au.dk/cgi-chili/primique/front.py) design primer, The amplification length of primer product controls between 80-150bp, and the information for obtaining primer is shown in Table 3.Fig. 2 is shown in primer specificity detection.
The primer sequence of 3 CAT family gene of table
The separation of total serum IgE, the synthesis of the first chain cDNA are carried out according to the method in above-mentioned steps (2).It selects NormFinder, which is identified, comes CL5547.Contig2 and tradition reference gene CAC as reference gene to CAT family gene Expression carries out relative quantification detection.QRT-PCR analysis is carried out according to above-mentioned steps (4) the method.The calculating of relative expression quantity Formula: [(target gene compares Cp- target gene sample CP)-(reference gene compares Cp- reference gene to 2- △ △ Cp=2 Sample Cp)] (Schmittgen, T.D, Livak, K.J:Analyzing real-time PCR data by the comparative CT method.Nature Protocols 2008,3,1101-1108).With CL5547.Contig2 and CAC gene standardizes the expression of target gene (CAT1, CAT2 gene), and PEG is examined to handle lower target gene in C13-84 blade In expression of results see Fig. 3,4.As seen from the figure, when using CL5547.Contig2 and CAC as reference gene, CAT1, CAT2 base Because of the expression up-regulation for 24 hours after PEG processing, 48h expression is lowered after processing.When using CAC as reference gene, expression quantity is excessively high, can It can lead to the expression quantity of excessively high estimation target gene, and CL5547.Contig2 expression is more stable, can preferably reduce expression Variation.

Claims (3)

  1. Use of the 1.CL5547.Contig2 gene in the analysis of pumpkin gene expression real-time fluorescence quantitative PCR as reference gene On the way, the nucleotides sequence of the CL5547.Contig2 gene is classified as shown in SEQ ID NO:3.
  2. 2. a kind of pumpkin gene expression real-time fluorescence quantitative PCR analysis method, it is characterised in that: described in claim 1 CL5547.Contig2 gene carries out quantitative analysis to target gene as reference gene.
  3. 3. pumpkin gene expression real-time fluorescence quantitative PCR analysis method as claimed in claim 2, it is characterised in that: described The PCR amplification primer nucleotide sequences of CL5547.Contig2 gene are:
    Forward primer sequence: CATCTGATCCTGCACCTGGA
    Reverse primer sequences: GCAATTTGATCCTCAGCGGC.
CN201510657559.6A 2015-10-13 2015-10-13 Purposes of the CL5547.Contig2 gene in the analysis of pumpkin gene expression real-time fluorescence quantitative PCR as reference gene Active CN105274219B (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
CN201510657559.6A CN105274219B (en) 2015-10-13 2015-10-13 Purposes of the CL5547.Contig2 gene in the analysis of pumpkin gene expression real-time fluorescence quantitative PCR as reference gene

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CN201510657559.6A CN105274219B (en) 2015-10-13 2015-10-13 Purposes of the CL5547.Contig2 gene in the analysis of pumpkin gene expression real-time fluorescence quantitative PCR as reference gene

Publications (2)

Publication Number Publication Date
CN105274219A CN105274219A (en) 2016-01-27
CN105274219B true CN105274219B (en) 2018-12-07

Family

ID=55144046

Family Applications (1)

Application Number Title Priority Date Filing Date
CN201510657559.6A Active CN105274219B (en) 2015-10-13 2015-10-13 Purposes of the CL5547.Contig2 gene in the analysis of pumpkin gene expression real-time fluorescence quantitative PCR as reference gene

Country Status (1)

Country Link
CN (1) CN105274219B (en)

Families Citing this family (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN110438250B (en) * 2018-05-04 2022-08-30 浙江省农业科学院 Application of LsH3 as internal reference gene in analysis of cucumber green mottle mosaic virus infection of cucumber by using bottle gourd
CN108486131A (en) * 2018-05-25 2018-09-04 福建省农业科学院作物研究所 A kind of american pumpkin TUA genes and application

Family Cites Families (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN104789557B (en) * 2015-02-11 2017-09-26 福建省农业科学院作物研究所 A kind of musky gourd reference gene and its application

Also Published As

Publication number Publication date
CN105274219A (en) 2016-01-27

Similar Documents

Publication Publication Date Title
Perini et al. Reference genes for transcriptional analysis of flowering and fruit ripening stages in apple (Malus× domestica Borkh.)
CN107190062B (en) Screening and application of fluorescent quantitative reference genes of pear fruits in different development periods
Xia et al. Analysis of multiple transcriptomes of the African oil palm (Elaeis guineensis) to identify reference genes for RT-qPCR
CN102321758B (en) Method for screening real-time fluorescent quantitative PCR internal reference molecules of desert plant Eremosparton songoricum (Litv.) Vass.
CN107475416B (en) Primer for screening internal reference gene under low-temperature stress of wax apples and application of primer
CN105274219B (en) Purposes of the CL5547.Contig2 gene in the analysis of pumpkin gene expression real-time fluorescence quantitative PCR as reference gene
CN108977514B (en) Primer for screening wax gourd real-time fluorescent quantitative PCR (polymerase chain reaction) reference gene EF-1 alpha
CN109022548B (en) Primer for screening wax gourd real-time fluorescent quantitative PCR (polymerase chain reaction) internal reference gene TUA
CN103555738A (en) Cloning and function-expressing methods of peanut adversity stress AhROLP1 gene
CN110184384B (en) Method for identifying drought resistance of corn variety based on real-time quantitative PCR
CN108085409B (en) Screening method of fir reference gene in different tissues and application of screening gene as reference gene
CN112941229B (en) Blueberry reference gene and primer and application thereof
CN110317899A (en) A method of drought resistance of maize is identified based on polygalacturonase gene expression
CN115927296A (en) Cabbage heart high-temperature stress reference gene and screening method and application thereof
CN113846108B (en) Screening and application of taro high-expression internal reference gene Ce047468
CN113462813B (en) Site linked with pear peel red character, molecular marker and application thereof
CN108728453A (en) A kind of giant pumpkin EF1- α genes and its application
CN113481320B (en) Site linked with pear peel red character, molecular marker and application thereof
CN106754965B (en) One kind reference gene relevant to poplar adversity gene expression regulation and its application
CN112011643B (en) qRT-PCR reference gene of grape as well as primer and application thereof
CN109680092B (en) Kit and method for detecting gene expression level of taxus plant
CN109055599B (en) Molecular marker primer for identifying Jinmei variety of kiwi fruit and application thereof
CN111270002A (en) SCAR marking method for sex early identification of male and female ginkgo plants
CN104195223A (en) Method for identifying iron deficiency-resistant apple rootstocks
CN115873982B (en) Internal reference gene for gene expression in peony stem development, primer and application thereof

Legal Events

Date Code Title Description
C06 Publication
PB01 Publication
C10 Entry into substantive examination
SE01 Entry into force of request for substantive examination
GR01 Patent grant
GR01 Patent grant