CN111270002A - SCAR marking method for sex early identification of male and female ginkgo plants - Google Patents
SCAR marking method for sex early identification of male and female ginkgo plants Download PDFInfo
- Publication number
- CN111270002A CN111270002A CN202010204833.5A CN202010204833A CN111270002A CN 111270002 A CN111270002 A CN 111270002A CN 202010204833 A CN202010204833 A CN 202010204833A CN 111270002 A CN111270002 A CN 111270002A
- Authority
- CN
- China
- Prior art keywords
- male
- ginkgo
- marking method
- female
- scar
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
- 241000218628 Ginkgo Species 0.000 title claims abstract description 86
- 238000000034 method Methods 0.000 title claims abstract description 53
- 231100000241 scar Toxicity 0.000 title claims abstract 25
- 235000008100 Ginkgo biloba Nutrition 0.000 claims abstract description 34
- 235000011201 Ginkgo Nutrition 0.000 claims abstract description 33
- 108020004414 DNA Proteins 0.000 claims description 20
- 238000012408 PCR amplification Methods 0.000 claims description 12
- 230000003321 amplification Effects 0.000 claims description 10
- 239000003147 molecular marker Substances 0.000 claims description 10
- 238000003199 nucleic acid amplification method Methods 0.000 claims description 10
- IJGRMHOSHXDMSA-UHFFFAOYSA-N Atomic nitrogen Chemical compound N#N IJGRMHOSHXDMSA-UHFFFAOYSA-N 0.000 claims description 6
- 238000011144 upstream manufacturing Methods 0.000 claims description 6
- 244000194101 Ginkgo biloba Species 0.000 claims description 4
- 108091028043 Nucleic acid sequence Proteins 0.000 claims description 4
- 238000001962 electrophoresis Methods 0.000 claims description 4
- LZZYPRNAOMGNLH-UHFFFAOYSA-M Cetrimonium bromide Chemical compound [Br-].CCCCCCCCCCCCCCCC[N+](C)(C)C LZZYPRNAOMGNLH-UHFFFAOYSA-M 0.000 claims description 3
- 238000000137 annealing Methods 0.000 claims description 3
- 238000004925 denaturation Methods 0.000 claims description 3
- 230000036425 denaturation Effects 0.000 claims description 3
- 230000008014 freezing Effects 0.000 claims description 3
- 238000007710 freezing Methods 0.000 claims description 3
- 239000007788 liquid Substances 0.000 claims description 3
- 229910052757 nitrogen Inorganic materials 0.000 claims description 3
- 238000012257 pre-denaturation Methods 0.000 claims description 3
- 241000196324 Embryophyta Species 0.000 abstract description 13
- 239000000463 material Substances 0.000 abstract description 4
- 210000000056 organ Anatomy 0.000 abstract description 3
- 241000981782 Globularia Species 0.000 abstract description 2
- 238000003752 polymerase chain reaction Methods 0.000 description 11
- 239000003550 marker Substances 0.000 description 8
- 239000012634 fragment Substances 0.000 description 7
- 238000004519 manufacturing process Methods 0.000 description 4
- 230000000877 morphologic effect Effects 0.000 description 4
- 210000001519 tissue Anatomy 0.000 description 4
- 210000000349 chromosome Anatomy 0.000 description 3
- 108090000623 proteins and genes Proteins 0.000 description 3
- 238000011160 research Methods 0.000 description 3
- 108010044467 Isoenzymes Proteins 0.000 description 2
- 238000009395 breeding Methods 0.000 description 2
- 230000001488 breeding effect Effects 0.000 description 2
- 239000013043 chemical agent Substances 0.000 description 2
- 230000007547 defect Effects 0.000 description 2
- 230000018109 developmental process Effects 0.000 description 2
- 239000012154 double-distilled water Substances 0.000 description 2
- 235000013399 edible fruits Nutrition 0.000 description 2
- 102000004169 proteins and genes Human genes 0.000 description 2
- 238000012163 sequencing technique Methods 0.000 description 2
- 230000020509 sex determination Effects 0.000 description 2
- 241000269335 Ambystoma laterale x Ambystoma jeffersonianum Species 0.000 description 1
- 241000218631 Coniferophyta Species 0.000 description 1
- 102000053602 DNA Human genes 0.000 description 1
- 230000004543 DNA replication Effects 0.000 description 1
- 241000218791 Ginkgoaceae Species 0.000 description 1
- 102100023706 Steroid receptor RNA activator 1 Human genes 0.000 description 1
- 101710187693 Steroid receptor RNA activator 1 Proteins 0.000 description 1
- 241001530121 Trollius Species 0.000 description 1
- 208000005652 acute fatty liver of pregnancy Diseases 0.000 description 1
- 230000009286 beneficial effect Effects 0.000 description 1
- 238000010367 cloning Methods 0.000 description 1
- 230000000295 complement effect Effects 0.000 description 1
- 238000010276 construction Methods 0.000 description 1
- 239000003814 drug Substances 0.000 description 1
- 230000000694 effects Effects 0.000 description 1
- 238000012214 genetic breeding Methods 0.000 description 1
- 230000002068 genetic effect Effects 0.000 description 1
- 238000000338 in vitro Methods 0.000 description 1
- 230000000366 juvenile effect Effects 0.000 description 1
- 238000001823 molecular biology technique Methods 0.000 description 1
- 230000001681 protective effect Effects 0.000 description 1
- 238000001814 protein method Methods 0.000 description 1
- 238000013468 resource allocation Methods 0.000 description 1
- 210000003765 sex chromosome Anatomy 0.000 description 1
- 241000894007 species Species 0.000 description 1
- 239000000126 substance Substances 0.000 description 1
- 239000002699 waste material Substances 0.000 description 1
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
- C12Q1/6895—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms for plants, fungi or algae
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6879—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for sex determination
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/13—Plant traits
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Organic Chemistry (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Analytical Chemistry (AREA)
- Engineering & Computer Science (AREA)
- Health & Medical Sciences (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Biotechnology (AREA)
- Immunology (AREA)
- Microbiology (AREA)
- Molecular Biology (AREA)
- Biophysics (AREA)
- Physics & Mathematics (AREA)
- Biochemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Mycology (AREA)
- Botany (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention discloses an SCAR marking method for early sex identification of male and female ginkgo plants, belonging to the technical field of biology. According to the SCAR marking method for identifying the sex of the male and female ginkgo plants in the early stage, DNA of any available organs or tissues in ginkgo seedlings, leaves, globularia, seeds and other plants is extracted, and then the sex of the male and female ginkgo plants is accurately identified by a PCR method, so that the technical accuracy can reach 100%, the identification requirement can be met by as low as 10mg of fresh ginkgo tissues, the growth and development of ginkgo are not influenced, and the material taking time is not limited.
Description
Technical Field
The invention belongs to the technical field of biology, and particularly relates to an SCAR marking method for early sex identification of male and female ginkgo plants.
Background
Ginkgo biloba is a gymnosperm belonging to Ginkgo of Ginkgoaceae, is a unique tree species in China, and is classified as a national secondary protective plant. The ginkgo can be used as fruit material, can be used as medicine, can be viewed and enjoyed, and has high economic value. Gingko is a very typical female and male heterotrophic plant. Since the fruits and seed coats of female plants have rotten odor and drop to pollute the environment, the male plants are often used in gardens. The seeds of ginkgo are commonly called ginkgo which is a medicine-food homologous substance with extremely high economic value, so the economic forest of ginkgo is mainly female plants. Therefore, the resource allocation in the production and cultivation of ginkgo seeds and the landscaping requires that male and female ginkgo plants are distinguished and planted according to respective needs. However, ginkgo has a long juvenile period, and the seedling can bloom and distinguish male and female after being planted for about 20 years, so that the special requirement for distinguishing the sex of the immature trees during early planting can not be met. Therefore, the early identification of the sex of the male and female ginkgo plants has important practical application value in production.
At present, the male and female ginkgo plants can be identified to a certain extent by the prior art methods of morphological characteristics, physiological biochemistry, chromosome morphology, isoenzyme, specific protein, chemical agent treatment and the like. However, the disadvantages of these methods of identification are also evident.
The sex of male and female ginkgo plants is identified by a morphological characteristic method, which is relatively simple and feasible, but the identification result is often not stable and accurate due to large morphological characteristic difference of different plants.
The physiological and biochemical identification method is easily influenced by multiple factors such as producing areas, tree ages, temperature and the like, has strong volatility, and can not meet the requirement of early male and female plant identification by analyzing and determining adult plants with known sexes.
The identification method of morphological characteristics of chromosomes is one of important methods for identifying sex of male and female ginkgo, and researches on chromosome composition and sex chromosomes of ginkgo are reported at home and abroad, but the method is unrealistic to be used in production practice for large-scale identification of male and female ginkgo plants.
The sex determination of the ginkgo by the isozyme method is stable and reliable, but the scale is limited, the method is only limited by laboratory research and is not suitable for large-scale male and female determination in forestry production.
The sex determination of the ginkgo by the specific protein method is more accurate, but still needs higher scientific and technological support, and has complicated experimental steps, higher requirements on conditions and difficult popularization.
The chemical agent treatment and identification method is simple and easy to implement, but still in a qualitative stage, and lacks accurate quantitative standards.
Based on a molecular biology method, the difference of male and female plants is researched on a molecular level, and the accurate sex identification can be carried out on the plants. At present, molecular markers of RAPD, AFLP, ISSR, SSR, SCAR and the like are applied to the genetic fingerprint map construction, variety identification and genetic breeding research of ginkgo. But has no molecular marker which can be used for the sex early identification of the male and female ginkgo plants.
Disclosure of Invention
Technical problem to be solved
In order to overcome the defects in the prior art, the invention provides an SCAR marking method for early sex identification of male and female ginkgo plants, which solves the problems that the prior art can identify male and female ginkgo plants to a certain extent, but the defects of the identification technical methods are obvious, such as inaccurate identification, time and labor waste and inapplicability to large-scale identification.
(II) technical scheme
In order to achieve the purpose, the invention provides the following technical scheme: an SCAR marking method for the sex early identification of male and female Ginkgo plants, wherein the sequence of a SCAR molecular marker primer is Ginkgo SexD-F5R 5.
As a further scheme of the invention: the upstream primer sequence F5 in the SCAR molecular marker primer sequence: GAGTTGATGTGATTCTTGGAGA, downstream primer sequence R5: CATTTGGTTCAAACACCTTACT are provided.
As a further scheme of the invention: the primer pair is applied to the sex early identification of male and female ginkgo plants.
As a further scheme of the invention: in the application, the genome DNA of a sample to be identified is extracted, and then PCR amplification is carried out.
As a further scheme of the invention: the method for extracting the genomic DNA of the to-be-detected identification sample comprises the following steps of:
s1, selecting 10 ginkgo female and male trees with locally known sex, taking tender leaves, and quickly freezing by liquid nitrogen for later use.
S2, extracting the DNA of the ginkgo leaves by using a CTAB method.
As a further scheme of the invention: the reaction system of the PCR amplification is as follows: the reaction volume was 20uL, including 10uL for 2 XMix Master,the DNA of ginkgo is 2uL, the upstream and downstream primers of SCAR molecular marker are respectively 0.5uL and ddH2O 7uL。
As a further scheme of the invention: the reaction procedure of PCR amplification in the application is as follows: pre-denaturation at 94 ℃ for 3 min; denaturation at 94 ℃ for 30 s; annealing at 60 ℃ for 30 s; extension at 72 ℃ for 30 s; circulating for 30 times; extending for 10min at 72 ℃; after the reaction, the amplification product was stored in a refrigerator at 4 ℃.
As a further scheme of the invention: the PCR instrument model in the PCR amplification is not limited, and any one PCR instrument can be completed.
As a further scheme of the invention: in the application, the electrophoresis identifies the amplification product, 10 male ginkgo plants can amplify a specific strip of 297bp, and 10 female ginkgo plants have no amplification strips, so that the female ginkgo plants and the male ginkgo plants can be identified.
As a further scheme of the invention: and identifying the male ginkgo plant specific strip: the DNA sequence of the specific band is determined as follows:
GAGTTGATGTGATTCTTGGAGAGTAGTGGCTTAGAACACTAGAGACCTTCTCAATGAACTTAGAAGAGTTCTTCATTAAGTTTAATCTATAAGGAAAAGTGTATAAGTTGAGAGGATTGGTTGCACCACCACTAAATCAAGTAATTAATTATCATATGATGGAGAAGTTGATTAAAAAGGGTGCTACTAGCATCATTATGAGGTGCTACTCTATTGAAGGGTGTGAAGAATAGGAATCAATCACACTATAGCTACAGGAAGTTATTTCTTAACATAGTAAGGTGTTTGAACCAAATG。
(III) advantageous effects
Compared with the prior art, the invention has the beneficial effects that:
according to the SCAR marking method for identifying the sex of the male and female ginkgo plants in the early stage, DNA of any available organs or tissues in ginkgo seedlings, leaves, globularia, seeds and other plants is extracted, and then the sex of the male and female ginkgo plants is accurately identified by a PCR method, so that the technical accuracy can reach 100%, the identification requirement can be met by as low as 10mg of fresh ginkgo tissues, the growth and development of ginkgo are not influenced, and the material taking time is not limited.
Drawings
FIG. 1 shows the electrophoresis result of PCR products of male and female ginkgo plants, wherein M represents a gene scale, male represents female ginkgo plant, male represents male ginkgo plant, and 10 male ginkgo plants can amplify a specific band of 297bp, while 10 female ginkgo plants have no amplified band.
Detailed Description
The technical solution of the present patent will be described in further detail with reference to the following embodiments.
As shown in fig. 1, the present invention provides a technical solution: an SCAR marking method for the sex early identification of male and female Ginkgo plants, the sequence of a SCAR molecular marking primer is Ginkgo SexD-F5R 5.
The upstream primer sequence F5 in the SCAR molecular marker primer sequence: GAGTTGATGTGATTCTTGGAGA, downstream primer sequence R5: CATTTGGTTCAAACACCTTACT are provided.
The application of the primer pair in early sex identification of male and female ginkgo plants.
In the application, the genome DNA of a sample to be identified is extracted, and then PCR amplification is carried out.
The method for extracting the genomic DNA of the sample to be tested and identified comprises the following steps:
s1, selecting 10 ginkgo female and male trees with locally known sexes, taking tender leaves of the ginkgo female and male trees, and quickly freezing the leaves by liquid nitrogen for later use;
s2, extracting the DNA of the ginkgo leaves by using a CTAB method.
The reaction system of PCR amplification is as follows: the reaction volume is 20uL, including 10uL of 2 xMix Master, 2uL of gingko DNA, 0.5uL of each of upstream and downstream primers marked by SCAR molecules and ddH2O 7uL。
The reaction procedure for PCR amplification in the application is as follows: pre-denaturation at 94 ℃ for 3 min; denaturation at 94 ℃ for 30 s; annealing at 60 ℃ for 30 s; extension at 72 ℃ for 30 s; circulating for 30 times; extending for 10min at 72 ℃; after the reaction, the amplification product was stored in a refrigerator at 4 ℃.
The PCR instrument model in PCR amplification is not limited, and any one PCR instrument can be used.
When the electrophoresis is used for identifying the amplification product, 10 male ginkgo plants can amplify a specific band of 297bp, and 10 female ginkgo plants have no amplification band, so that the female ginkgo plants and the male ginkgo plants can be identified.
Identifying the specific bands of the male ginkgo plants: the DNA sequence of the specific band is determined as follows:
GAGTTGATGTGATTCTTGGAGAGTAGTGGCTTAGAACACTAGAGACCTTCTCAATGAACTTAGAAGAGTTCTTCATTAAGTTTAATCTATAAGGAAAAGTGTATAAGTTGAGAGGATTGGTTGCACCACCACTAAATCAAGTAATTAATTATCATATGATGGAGAAGTTGATTAAAAAGGGTGCTACTAGCATCATTATGAGGTGCTACTCTATTGAAGGGTGTGAAGAATAGGAATCAATCACACTATAGCTACAGGAAGTTATTTCTTAACATAGTAAGGTGTTTGAACCAAATG。
by extracting DNA of any organs or tissues which can be obtained from ginkgo seedlings, leaves, globeflower, seeds and other plants, and then accurately identifying the sex of male and female ginkgo plants by a PCR method, the technical accuracy provided by the invention can reach 100 percent, the identification requirement can be met by as low as 10mg of fresh ginkgo tissues, the growth and development of ginkgo are not influenced, and the material obtaining time is not limited.
Interpretation of terms:
molecular marking: molecular markers in the broad sense refer to heritable and detectable DNA sequences or proteins. A narrow molecular marker refers to a specific DNA fragment that reflects some difference in the genome between individual or population groups of an organism.
DNA: deoxyribonucleic acid.
And (3) PCR: the Polymerase Chain Reaction (PCR) is a molecular biology technique for amplifying and amplifying specific DNA fragments, and can be regarded as special DNA replication in vitro, and the biggest characteristic of the PCR is that trace amount of DNA can be greatly increased.
SCAR marking: SCAR (sequence-characterized amplified regions specific sequence amplification) markers are usually transformed from RAPD, SRAP, SSR markers. The SCAR marker is obtained by recovering a specific marker fragment from gel, cloning and sequencing the specific marker fragment, and designing a pair of specific primers (18-24 bases) according to the base sequence of the specific marker fragment; the sequencing of the labeled ends of RAPD can also be carried out, and about 14 bases are added at the ends of the 10-base primers used by the original RAPD to become the specific primers complementary to the ends of the original RAPD fragments. The SCAR marker is generally expressed by the existence of amplified fragments, is a dominant marker, is a first-choice marker which can be directly applied to molecular marker breeding practice at present, and is actually a molecular marker which can be directly applied to marker-assisted breeding.
Although the preferred embodiments of the present patent have been described in detail, the present patent is not limited to the above embodiments, and various changes can be made without departing from the spirit of the present patent within the knowledge of those skilled in the art.
Sequence listing
<110> Linyi university
<120> SCAR marking method for sex early identification of male and female ginkgo plants
<160>1
<170>SIPOSequenceListing 1.0
<210>1
<211>297
<212>DNA
<213>2 Ambystoma laterale x Ambystoma jeffersonianum
<400>1
gagttgatgt gattcttgga gagtagtggc ttagaacact agagaccttc tcaatgaact 60
tagaagagtt cttcattaag tttaatctat aaggaaaagt gtataagttg agaggattgg 120
ttgcaccacc actaaatcaa gtaattaatt atcatatgat ggagaagttg attaaaaagg 180
gtgctactag catcattatg aggtgctact ctattgaagg gtgtgaagaa taggaatcaa 240
tcacactata gctacaggaa gttatttctt aacatagtaa ggtgtttgaa ccaaatg 297
Claims (10)
1. An SCAR marking method for identifying the sex of male and female ginkgo plants at early stage is characterized in that: the sequence of the SCAR molecular marker primer is Ginkgo SexD-F5R 5.
2. The SCAR marking method for the sex early stage identification of the male and female ginkgo plants as claimed in claim 1, wherein the SCAR marking method comprises the following steps: the upstream primer sequence F5 in the SCAR molecular marker primer sequence: GAGTTGATGTGATTCTTGGAGA, downstream primer sequence R5: CATTTGGTTCAAACACCTTACT are provided.
3. The SCAR marking method for the sex early stage identification of the male and female ginkgo plants as claimed in claim 1, wherein the SCAR marking method comprises the following steps: the primer pair is applied to the sex early identification of male and female ginkgo plants.
4. The SCAR marking method for the sex early stage identification of the male and female ginkgo plants as claimed in claim 3, wherein the SCAR marking method comprises the following steps: in the application, the genome DNA of a sample to be identified is extracted, and then PCR amplification is carried out.
5. The SCAR marking method for the sex early stage identification of the male and female ginkgo plants as claimed in claim 4, wherein the SCAR marking method comprises the following steps: the method for extracting the genomic DNA of the to-be-detected identification sample comprises the following steps of:
s1, selecting 10 ginkgo female and male trees with locally known sexes, taking tender leaves of the ginkgo female and male trees, and quickly freezing the leaves by liquid nitrogen for later use;
s2, extracting the DNA of the ginkgo leaves by using a CTAB method.
6. The SCAR marking method for the sex early stage identification of the male and female ginkgo plants as claimed in claim 4, wherein the SCAR marking method comprises the following steps: the reaction system of the PCR amplification is as follows: the reaction volume is 20uL, including 10uL of 2 xMix Master, 2uL of gingko DNA, 0.5uL of each of upstream and downstream primers marked by SCAR molecules and ddH2O7uL。
7. The SCAR marking method for the sex early stage identification of the male and female ginkgo plants as claimed in claim 4, wherein the SCAR marking method comprises the following steps: the reaction procedure of PCR amplification in the application is as follows: pre-denaturation at 94 ℃ for 3 min; denaturation at 94 ℃ for 30 s; annealing at 60 ℃ for 30 s; extension at 72 ℃ for 30 s; circulating for 30 times; extending for 10min at 72 ℃; after the reaction, the amplification product was stored in a refrigerator at 4 ℃.
8. The SCAR marking method for the sex early stage identification of the male and female ginkgo plants as claimed in claim 4, wherein the SCAR marking method comprises the following steps: the PCR instrument model in the PCR amplification is not limited, and any one PCR instrument can be completed.
9. The SCAR marking method for the sex early stage identification of the male and female ginkgo plants as claimed in claim 3, wherein the SCAR marking method comprises the following steps: in the application, the electrophoresis identifies the amplification product, 10 male ginkgo plants can amplify a specific strip of 297bp, and 10 female ginkgo plants have no amplification strips, so that the female ginkgo plants and the male ginkgo plants can be identified.
10. The SCAR marking method for the sex early stage identification of the male and female ginkgo plants as claimed in claim 9, wherein the SCAR marking method comprises the following steps: and identifying the male ginkgo plant specific strip: the DNA sequence of the specific band is determined as follows:
GAGTTGATGTGATTCTTGGAGAGTAGTGGCTTAGAACACTAGAGACCTTCTCAATGAACTTAGAAGAGTTCTTCATTAAGTTTAATCTATAAGGAAAAGTGTATAAGTTGAGAGGATTGGTTGCACCACCACTAAATCAAGTAATTAATTATCATATGATGGAGAAGTTGATTAAAAAGGGTGCTACTAGCATCATTATGAGGTGCTACTCTATTGAAGGGTGTGAAGAATAGGAATCAATCACACTATAGCTACAGGAAGTTATTTCTTAACATAGTAAGGTGTTTGAACCAAATG。
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202010204833.5A CN111270002A (en) | 2020-03-22 | 2020-03-22 | SCAR marking method for sex early identification of male and female ginkgo plants |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202010204833.5A CN111270002A (en) | 2020-03-22 | 2020-03-22 | SCAR marking method for sex early identification of male and female ginkgo plants |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN111270002A true CN111270002A (en) | 2020-06-12 |
Family
ID=70995942
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN202010204833.5A Pending CN111270002A (en) | 2020-03-22 | 2020-03-22 | SCAR marking method for sex early identification of male and female ginkgo plants |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN111270002A (en) |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN114134245A (en) * | 2021-11-09 | 2022-03-04 | 浙江省林业科学研究院 | SNP sites associated with ginkgo sex and primers and application thereof |
Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN103374568A (en) * | 2012-04-17 | 2013-10-30 | 韩国林业研究所 | Usage of molecular marker for identifying gender of gingo |
-
2020
- 2020-03-22 CN CN202010204833.5A patent/CN111270002A/en active Pending
Patent Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN103374568A (en) * | 2012-04-17 | 2013-10-30 | 韩国林业研究所 | Usage of molecular marker for identifying gender of gingo |
Non-Patent Citations (3)
| Title |
|---|
| LIQIN LIAO等: "Development and application of SCAR markers for sex identification in the dioecious species Ginkgo biloba L", 《EUPHYTICA》 * |
| 朱晓利: "银杏雌雄株性别鉴定的分子标记研究", 《中国优秀博硕士学位论文全文数据库(硕士)基础科学辑》 * |
| 黄茜等: "SCAR分子标记和叶形分析对银杏性别鉴定的研究", 《西南大学学报(自然科学版)》 * |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN114134245A (en) * | 2021-11-09 | 2022-03-04 | 浙江省林业科学研究院 | SNP sites associated with ginkgo sex and primers and application thereof |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN105368935B (en) | SSR primer sets and method for the Purity Identification of capsicum variety Huifeng 2 | |
| CN112695124B (en) | Phalaenopsis SSR molecular marker primer composition and application thereof | |
| Ibrahim et al. | Genetic variability among three sweet basil (Ocimum basilicum L.) varieties as revealed by morphological traits and RAPD markers | |
| CN111270002A (en) | SCAR marking method for sex early identification of male and female ginkgo plants | |
| CN110878376B (en) | SSR molecular marker primer for identifying dendrobium huoshanense and application thereof | |
| CN110273020B (en) | SNP molecular marker for distinguishing summer orange and common sweet orange of citrus and application thereof | |
| CN116103429B (en) | Primer for rapidly identifying molecular markers of germplasm of rhizoma zingiberis, molecular markers and application | |
| CN108977563B (en) | SSR core primer group developed based on radish whole genome sequence and application thereof | |
| CN108165652B (en) | Specific molecular marker TGMI001 for identifying sex of torreya grandis at seedling stage | |
| KR101783347B1 (en) | CAPS marker for discriminating presence or absence of pollen in pear and uses thereof | |
| CN112725515B (en) | Iris florida ground color SNP molecular marker primer composition and application thereof | |
| CN113403417A (en) | SSR molecular marker AerM01 for sex identification of actinidia arguta and application thereof | |
| CN113718050A (en) | Molecular characteristic SSR primer and method for identifying Chinese torreya polyploid varieties | |
| KR101359542B1 (en) | Microsatellite primer sets for discriminating cultivars of peach and uses thereof | |
| KR101301867B1 (en) | Microsatellite primer set for identifying onion varieties | |
| CN115838790B (en) | Molecular marker for sex identification of actinidia arguta and application of specific primer pair M4 | |
| CN116334269B (en) | Molecular marker for sex identification of actinidia arguta and specific primer pair M3 thereof | |
| KR102686449B1 (en) | InDel molecular marker for discriminating sex of Actinidia arguta and uses thereof | |
| CN114634991B (en) | InDel marker for identifying high-variety coconuts and application thereof | |
| CN115181814B (en) | Molecular marker primer combination for rapidly identifying blueberry fruit size and application thereof | |
| CN114990251B (en) | Molecular marker closely linked with rape methylselenocysteine content trait QTL and application thereof | |
| CN118326071A (en) | InDel marker primer for identifying tomato variety and application thereof | |
| CN115852031B (en) | SNP marker coseparated with melon seed size characters and application thereof | |
| CN114058720B (en) | Primer probe combination, kit and detection method for detecting Lonsdalea pathogenic bacteria and application of primer probe combination | |
| CN116219052B (en) | Marker gene Pt7G61650 for identifying different periods of nutrient growth of slash pine and application method thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| TA01 | Transfer of patent application right |
Effective date of registration: 20240929 Address after: 276012 west side of north section of Gongye Avenue, Lanshan District, Linyi City, Shandong Province Applicant after: LINYI University Country or region after: China Applicant after: Shandong (Linyi) Institute of modern agriculture, Zhejiang University Address before: 276000 Shuangling Road, Lanshan District, Linyi City, Shandong Province Applicant before: LINYI University Country or region before: China |