CN118326071A - InDel marker primer for identifying tomato variety and application thereof - Google Patents

Abstract

The invention discloses an InDel marker primer for identifying tomato varieties and application thereof, and belongs to the technical field of biology. The InDel marker primer, the kit and the related identification method provided by the invention can greatly improve the accuracy of green vegetable variety identification and shorten the identification time, thereby providing a basic tool for the development of subsequent new plant varieties, plant typing and plant breeding, and having wide application prospects.

Description

InDel marker primer for identifying tomato variety and application thereof

Technical Field

The invention relates to the technical field of biology, in particular to an InDel marker primer for identifying tomato varieties and application thereof.

Background

Heterosis is prevalent in the biological world, meaning the phenomenon that a hybrid is superior to two parents in one or more traits. Heterosis utilization is a typical representation of genetic applications and has achieved great success in rice, maize, and wheat crops. Along with the deep breeding work, the application of heterosis is not limited to grain crops, and the heterosis also applied to the fields of vegetables and the like. "Pink Ke No. 4" is used as a new cultivated hybrid tomato variety, and in the seed production process, the purity of hybrid seeds is often reduced due to incomplete emasculation, insect pollination, mechanical mixing and the like, so that the yield or quality of tomatoes is affected, and certain loss is caused to production. The purity of the hybrid seeds is one of important indexes for measuring the quality of the seeds, and is increasingly valued by seed production units and growers. In order to ensure the quality of the hybrid seeds, the purity of the hybrid seeds needs to be identified before the sale of the seeds, so that the establishment of an efficient and accurate hybrid seed purity identification method is important.

Currently, traditional hybrid purity identification is based on field phenotype investigation. The method has the advantages of large workload, easiness in being influenced by planting environment and long identification period, and is often required to pass through a complete growth and development period, so that seed sales lag is caused, and even the sales season is missed.

Disclosure of Invention

The invention aims to solve the problem of improving the accuracy of tomato variety identification while improving the speed of tomato variety identification.

In order to solve the problems, the first aspect of the invention provides an InDel marker primer for identifying tomato varieties, which comprises an upstream primer shown in SEQ ID No.1 and a downstream primer shown in SEQ ID No.2,

SEQ ID No.1：TAACCATAACTAAAACAAAA；

SEQ ID No.2：TAAAGATGAACTAACCAATA，

The InDel marker locus corresponding to the InDel marker primer is shown as SEQ ID No.5,

SEQ ID No.5：

GAATCTTGGCAAAAGCGTGTAATAAAAGTTGCAATGTATATATTCTTA。

The InDel marker primer provided by the invention is designed aiming at tomato variety 'Pink Ke No. 4' and female parent 'XT 2108' and male parent 'XT 2109', and the InDel polymorphism molecular marker is a marker which is formed by designing specific primers based on sequences at two sides of an insertion or deletion site and carrying out PCR amplification, and has the advantages of clear and simple amplified product band type, strong stability, obvious separation effect and the like. Compared with the traditional field cell phenotype identification method, the InDel molecular marker detection hybrid purity can avoid the problems of large test field, environmental mutation, artificial subjective judgment error, long period and the like, and can rapidly and accurately identify the purity of a large amount of hybrid seeds at the seedling or seed level.

The second aspect of the present invention provides the use of an InDel marker primer as hereinbefore described, comprising any one or more of the following:

a: identification or auxiliary identification of tomato varieties;

b: preparing a product for identifying or assisting in identifying tomato varieties;

c: selecting or assisting in selecting tomato varieties;

d: preparing a product for breeding or assisting in breeding tomato varieties;

e: breeding tomatoes;

f: preparing tomato breeding products.

Further, the third aspect of the present invention provides a kit comprising the primers shown in SEQ ID No.1 and SEQ ID No. 2.

Preferably, the kit further comprises reagents for a PCR reaction and/or reagents for agarose gel electrophoresis.

Further, a fourth aspect of the present invention provides a method for identifying tomato varieties, wherein the method uses the InDel marker primers shown in SEQ ID No.1 and SEQ ID No.2 to identify tomato varieties.

Preferably, the method is used to identify one or more of the tomato varieties "Pink Ke No. 4", "XT2108", "XT 2109".

Preferably, the method comprises the steps of:

S1: extracting DNA of a sample tomato;

S2: carrying out PCR amplification on DNA of the sample tomato by adopting an InDel marked primer or a kit containing the InDel marked primer;

S3: agarose gel electrophoresis is carried out on the PCR amplification result;

S4: and identifying the tomato variety according to the agarose gel electrophoresis result.

Further preferably, in the step S4, if the agarose gel electrophoresis result is double-band, the molecular weight indicated by the upper band is 199bp, and the molecular weight indicated by the lower band is 151bp, the variety of the sample tomato is "Pink Ke 4"; if the agarose gel electrophoresis result is single band type and the molecular weight shown by the band is 199bp, the variety of the sample tomato is 'XT 2108'; if the agarose gel electrophoresis result is single band type and the molecular weight shown by the band is 151bp, the tomato variety is 'XT-2109'.

Further preferably, in the step S1, the organ for extracting the tomato DNA is selected from any one or more of roots, stems, leaves, flowers, fruits, seeds.

Further, a fifth aspect of the present invention provides a method for verifying the accuracy of an InDel marker primer, the InDel marker primer being shown in SEQ ID No.1 and SEQ ID No.2, the verification method comprising the steps of:

step1: planting target crops, and carrying out field phenotype identification;

step 2: performing PCR (polymerase chain reaction) amplification on target crops by using InDel marked primers and performing agarose gel electrophoresis on the PCR amplification result;

Step 3: and comparing the field phenotype identification result with the agarose gel electrophoresis result, and calculating the accuracy.

The invention has the beneficial effects that: "Pink Ke No. 4" is F ₁ after hybridization of female parent "XT2108" and male parent "XT 2109". Compared with the prior art, the InDel marker primer, the kit and the related identification method provided by the invention can greatly improve the accuracy of identifying the green vegetable varieties and shorten the identification time, thereby providing a basic tool for the development of subsequent new plant varieties, plant typing and plant breeding, and having wide application prospects.

Drawings

FIG. 1 shows the results of primer screening in example 1 according to the embodiment of the present invention;

Figure 2 is a partial result of a field test in example 2 of an embodiment of the present invention.

Detailed Description

In order that the above-recited objects, features and advantages of the present invention will become more readily apparent, a more particular description of embodiments of the invention will be rendered by reference to specific embodiments thereof which are illustrated in the appended drawings. It should be noted that the following examples are only for illustrating the implementation method and typical parameters of the present invention, and are not intended to limit the scope of the parameters described in the present invention, so that reasonable variations are introduced and still fall within the scope of the claims of the present invention.

It should be noted that endpoints and any values of the ranges disclosed herein are not limited to the precise range or value, and that such range or value should be understood to include values approaching such range or value. For numerical ranges, one or more new numerical ranges may be found between the endpoints of each range, between the endpoint of each range and the individual point value, and between the individual point value, in combination with each other, and are to be considered as specifically disclosed herein.

Unless defined otherwise, all terms, symbols and other scientific terms used herein are intended to have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs. In some cases, terms with commonly understood meanings are defined herein for either clarity or for ease of reference, such definitions herein should not be construed to represent a significant departure from the conventional understanding in the art. The technical methods described or cited herein are generally well known to those skilled in the art and are employed by conventional methods. Unless otherwise indicated, the use of the kits and reagents, instruments, which are commercially available, are carried out according to the protocols and parameters given by the manufacturer.

Description of the terminology:

InDel markers: insertion-deletion (InDel) refers to the insertion or deletion of nucleotide fragments of different sizes in the sequence at the same genomic locus between closely related species or different individuals of the same species, i.e., one or more bases in one sequence at a position that is homologous to another sequence. The InDel polymorphism molecular marker is a marker for PCR amplification based on the sequence design specific primers at two sides of an insertion/deletion site. The InDel polymorphism molecular marker is a marker which designs a specific primer based on sequences at two sides of an insertion or deletion site and carries out PCR amplification, and has the advantages of clear and simple amplified product banding pattern, strong stability, obvious separation effect and the like. With the development of the second generation sequencing technology, experimenters can quickly mine variation information from the whole genome range, and the development and application of InDel markers are facilitated. InDel loci are widely distributed in genomic DNA of animals and plants, and compared with SNP, the InDel loci have better genetic stability. Compared with SSR markers, the InDel molecular markers are developed, the workload of corresponding development is greatly reduced, and the amplified products are clear and simple in band type and have better stability and separation effect. Compared with the traditional field cell phenotype identification method, the InDel molecular marker detection hybrid purity can avoid the problems of large test field, environmental mutation, artificial subjective judgment error, long period and the like, and can rapidly and accurately identify the purity of a large amount of hybrid seeds at the seedling or seed level.

"Pink cocoa No. 4": "Pink Ke No. 4" is F ₁ after hybridization of female parent "XT2108" and male parent "XT 2109".

In order to solve the defects of the prior art in the background technology, the specific embodiment of the invention provides an InDel marking primer for identifying tomato varieties, which comprises an upstream primer shown in SEQ ID No.1 and a downstream primer shown in SEQ ID No.2,

SEQ ID No.1：TAACCATAACTAAAACAAAA；

SEQ ID No.2: TAAAGATGAACTAACCAATA in this embodiment, the InDel marker locus corresponding to the InDel marker primer is shown in SEQ ID No.5,

SEQ ID No.5：GAATCTTGGCAAAAGCGTGTAATAAAAGTTGCAAT GTATATATTCTTA。

Specifically, the design steps of the InDel marker primer provided in the above embodiment are as follows:

Taking seedling leaves of female parent XT2108 and male parent XT2109 of hybrid variety Pink Ke No. 4 as samples, carrying out whole genome resequencing, and obtaining CLEAN DATA after data quality control. The tomato whole genome data were aligned with BWA software and parental mutation sites were aligned and screened.

According to the resequencing detection result, selecting a male parent deletion, female parent non-variation or female parent deletion, and designing primers at conserved regions at two sides of a difference site by PRIMER PREMIER 5.0.0 software. In order to ensure the specificity of amplification, the primer design parameters especially consider that the GC content is between 40 and 50 percent, the annealing temperature is between 50 and 60 ℃, the length of the primer fragment is between 17 and 25bp, and the length of the primer PCR amplified product is between 200 and 300bp.

The DNA sample of hybrid variety "Pink Ke No. 4" and its parent and mother single plant is used as template, designed InDel primer is added, PCR amplification and gel electrophoresis imaging are carried out, and the primers with specificity of "Pink Ke No. 4" and its parent and mother single plant are screened out.

The InDel labeled primer provided in the embodiment can be applied to any one or more of the following aspects:

a: identification or auxiliary identification of tomato varieties;

b: preparing a product for identifying or assisting in identifying tomato varieties;

c: selecting or assisting in selecting tomato varieties;

d: preparing a product for breeding or assisting in breeding tomato varieties;

e: breeding tomatoes;

f: preparing tomato breeding products.

Another embodiment of the present invention also provides a method for identifying tomato varieties, which uses the InDel marker primers shown in the foregoing SEQ ID No.1 and SEQ ID No.2 to identify tomato varieties. One or more of tomato varieties "Pink Ke No. 4", "XT2108", "XT2109" can be accurately and rapidly identified.

In the above embodiment, the method for identifying tomato variety comprises the steps of:

S1: extracting DNA of a sample tomato;

S2: carrying out PCR amplification on DNA of the sample tomato by adopting an InDel marked primer or a kit containing the InDel marked primer;

S3: agarose gel electrophoresis is carried out on the PCR amplification result;

S4: and identifying the tomato variety according to the agarose gel electrophoresis result.

More specifically, in step S1 of the above embodiment, the organ for extracting tomato DNA is selected from any one or more of roots, stems, leaves, flowers, fruits, seeds.

More specifically, in step S1 of the above embodiment, the DNA extraction method may be any method conforming to national standards or commercial kit, and of course, a CTAB method is preferred, such as a CTAB method for extracting DNA, and the specific steps are as follows: plant tissue was placed in a 2ml centrifuge tube equipped with steel balls (diameter: 2 mm) and ground with a multiple sample tissue grinder (frequency: 60Hz, time: 90 s). Adding 700 mu L of CTAB solution of NaHSO ₃ (NaHSO ₃ concentration: 10.4 g.L ^-1) into the grinded centrifuge tube, fully shaking, putting into a 65 ℃ water bath kettle, carrying out water bath for 30min, and shaking once every 10 min. After completion of the water bath, 700. Mu.L of a mixture of isoamyl alcohol and chloroform (isoamyl alcohol: chloroform=1:24) was added to the centrifuge tube and centrifuged (rotation speed: 8000g, time: 10 min), and 400. Mu.L of the supernatant was extracted and placed in a 1.5ml centrifuge tube. The supernatant was added with 300. Mu.L of precooled isopropanol and centrifuged (rotation speed: 12000g, time: 10 min), the supernatant was poured out to leave a bottom, rinsed with 75% ethanol, and then air-dried, and dissolved with ddH ₂ O to obtain an aqueous DNA solution.

More specifically, in step S2 of the above embodiment, the PCR reaction system in the PCR amplification comprises 5.5. Mu.L of ddH ₂ O, 10. Mu.L of 2×taq mix, 1.5. Mu.L of the upstream primer (concentration: 10 mM), 1.5. Mu.L of the downstream primer (concentration: 10 mM), 1.5. Mu.L of the single-strain DNA of the hybrid variety "Pink 4" or its parent. The PCR reaction procedure in PCR amplification includes: pre-denaturation at 94℃for 5min, denaturation at 94℃for 20s, annealing for 20s (annealing temperature was set according to the design primer), extension at 72℃for 40s, cycling for 35 times, extension at 72℃for 10min, and preservation at 4 ℃.

More specifically, in step S3 of the above embodiment, the PCR amplification product is subjected to agarose gel electrophoresis and imaged in a gel imaging system (model: BIO-RAD). When the primers are screened, a large-scale A3-1 gel electrophoresis system is adopted, 350V voltage and 500mA current are set, and 4% agarose gel electrophoresis is carried out for 50min. The nucleic acid staining is performed by gel staining, i.e. adding nucleic acid dye E×Red in a proportion of 5 μ L E ×Red 10000×stock solution per 50ml agarose solution.

More specifically, in step S4 of the above embodiment, if the agarose gel electrophoresis result is double-band, the molecular weight indicated by the upper band is 199bp, and the molecular weight indicated by the lower band is 151bp, the variety of the sample tomato is "Pink cocoa No. 4"; if the agarose gel electrophoresis result is single band type and the molecular weight shown by the band is 199bp, the variety of the sample tomato is 'XT 2108'; if the agarose gel electrophoresis result is single band type and the molecular weight shown by the band is 151bp, the tomato variety is 'XT-2109'.

More specifically, to ensure accuracy of the InDel labeled primer, embodiments of the present invention further provide a field phenotypic identification and laboratory molecular detection contrast test, wherein:

The field phenotype identification comprises the following steps: on the land parcels of the same experimental plot, the hybrid seed "Pink Ke No. 4" is planted for identification, and the female parent "XT2108" is planted for comparison. And observing whether the phenotype of the plant to be identified is consistent with that of a normal 'Pink Ke No. 4' plant in each growth stage, and comparing the phenotype with that of the female parent planted, so as to identify hybrid female parent inbred seeds in the hybrid seeds.

Laboratory molecular assays include: seedling leaves of hybrid 'Pink Ke No. 4' plants are taken, single plant DNA is extracted by a CTAB method, screening primers are added for PCR amplification, and amplified products are subjected to agarose gel electrophoresis and then are placed in a gel imaging system for imaging. And counting the banding according to the gel imaging result, recording the mixed non-Pink Ke No. 4 plants in the plants to be identified, and calculating the purity. When the purity of the primer is detected, a large-scale A3-1 gel electrophoresis system is adopted for expanding the detection quantity, 350V voltage and 500mA current are set, and 4% agarose gel electrophoresis is carried out for 45min.

The field phenotype identification is compared with the laboratory molecular detection result one by one, plants which cannot be identified due to growth stopping during the field phenotype identification period can be eliminated during the comparison, exogenous pollen pollution abnormal plants with the field phenotype different from 'Pink Ke No. 4' and the mother 'XT 2108' can be eliminated, the field phenotype identification result is not generated, and the uncertainty of the exogenous pollen pollution abnormal plants is strong. In actual hybrid production, workers can effectively and manually control surrounding exogenous pollen sources.

The statistics of plants of the hybrid seeds 'Pink Ke No. 4' corresponding to the band type double bands and the female parent 'XT 2108' corresponding to the band type upper bands in the molecular detection shows that if the molecular detection is completely consistent with the field phenotype identification result, the InDel molecular marker capable of accurately identifying the purity of the hybrid seeds 'Pink Ke No. 4' is successfully developed, and the subsequent purity identification of the 'Pink Ke No. 4' can directly adopt the molecular detection.

The technical scheme of the invention is further described below with reference to the specification, the drawings and the specific embodiments.

Example 1

Pink cocoa No. 4 and its parent and parent PCR amplified product with specific primer screening

Taking seedling leaves of female parent XT2108 and male parent XT2109 of hybrid variety Pink Ke No. 4 as samples, sending to Tianjin North He Zhuangyuan technology Co., ltd, carrying out whole genome resequencing, and obtaining CLEAN DATA after data quality control. The tomato whole genome data were aligned with BWA software and parental mutation sites were aligned and screened.

Selecting a male parent deletion, a female parent non-variation or a female parent deletion, designing primers at conserved regions at two sides of a difference site by PRIMER PREMIER 5.0.0 software, wherein the male parent non-variation InDel site is selected. In order to ensure the specificity of amplification, the design parameters of the primers specifically consider that the GC content is 40% -50%, the annealing temperature is 50-60 ℃, the length of the primer fragment is 17-25 bp, the length of the PCR amplified product of the primers is 200-400 bp, and the sequences of the primers are shown in the table 1.

TABLE 1 InDel primer sequences designed for the hybrid "Pink Ke No. 4" assay

The DNA sample of hybrid variety "Pink Ke No. 4" and its parent and mother single plant is used as template, designed InDel primer is added, PCR amplification and gel electrophoresis imaging are carried out, and the primers with specificity of "Pink Ke No. 4" and its parent and mother single plant are screened out. Specific imaging results are shown in FIG. 1, and PCR amplification results of the primer pair numbered FK4-62 show that the parental and hybrid banding patterns thereof exhibit specificity. Wherein the sequence of the FK4-62 primer amplified female parent 'XT 2108' is shown in SEQ ID No.3, the sequence of the FK4-62 primer amplified male parent 'XT 2109' is shown in SEQ ID No.4,

SEQ ID No.3：TAACCATAACTAAAACAAAATAGGAACTTTGTTGT CTCACACAGAACATCTAGACATACACAGACATGATGTAGAAGTCCATAGAGCTAGAATCTTGGCAAAAGCGTGTAATAAAAGTTGCAATGTATATATTCTTACTTCTACTTATCCTAAAACCCATTCAGTGGAGTGCTTCCTCATATTGGTTAGTTCATCTTTA;

SEQ ID No.4：TAACCATAACTAAAACAAAATAGGAACTTTGTTGT CTCACACAGAACATCTAGACATACACAGACATGATGTAGAAGTCCATA GAGCTACTTCTACTTATCCTAAAACCCATTCAGTGGAGTGCTTCCTCAT ATTGGTTAGTTCATCTTTA.

InDel locus is shown as SEQ ID No.5,

SEQ ID No.5：GAATCTTGGCAAAAGCGTGTAATAAAAGTTGCAAT GTATATATTCTTA。

Example 2

Verifying accuracy of purity detection of specific primer pair' Pink cocoa No. 4

Cultivation of field materials

A batch of seeds (number: 192) of hybrid seeds "Pink Ke No. 4" are randomly extracted, and sown into a 96-hole tray together with the seeds of the homozygous female parent "XT2108", and one hole is used for sowing. When the plant grows to two leaves and is planted in the plastic greenhouse at one heart, the plant needs to be fully prepared and planted on the same ridge in order to reduce the influence caused by uneven soil fertility and other factors.

Sampling and molecular detection

The field "XT2108" with identification population plants were provided with a number plate, and new leaf blades of 192 plants were cut to extract DNA. The 192 DNA samples were subjected to amplification by using the screened primer 6F/R-2, and the PCR amplified products were subjected to agarose gel electrophoresis and then placed in a BIO-RAD gel imaging system to obtain images. 192 DNA bands were counted, wherein the number of the double bands was 192, and the number of the upper bands was 0, and the purity of the seeds of the hybrid "Pink 4" was 100% (calculation formula: purity (%) of the tomato hybrid "Pink 4" =number of plants (seeds) amplified into two bands/number of detection groups (seeds) ×100%). The imaging result of part of the glue pattern is shown in figure 2 in detail.

In summary, the specific embodiment of the invention is based on genome resequencing sequence of the obtained hybrid variety 'Pink Ke No. 4' father and mother, and the father deletion, the mother non-variation or the mother deletion, the father non-variation InDel locus are screened out through analysis and comparison, and the primer is designed. The designed primer is screened by taking the DNA sample of the hybrid variety 'Pink and Ke No. 4' and the parent and female parent single plant as a template, and the primer with specificity of the parent and female parent PCR amplified products is screened. The screening primer is used for detecting the hybrid seed 'Pink Ke No. 4' with identification population in the field, and the accuracy of the primer detection is confirmed by combining with the field phenotype identification. When the molecular detection result in the laboratory is completely consistent with the field phenotype identification result, namely the hybrid seeds of Pink Ke No. 4 and the hybrid seeds of female parent inbred seeds mixed therein can be accurately identified by molecular detection, the InDel molecular marker primer can be directly adopted for purity identification in the follow-up process, and the method has wide application prospect.

Although the present disclosure is described above, the scope of protection of the present disclosure is not limited thereto. Various changes and modifications may be made by one skilled in the art without departing from the spirit and scope of the disclosure, and these changes and modifications will fall within the scope of the invention.

Claims (10)

1. An InDel marker primer for identifying tomato varieties, which is characterized by comprising an upstream primer shown in SEQ ID No.1 and a downstream primer shown in SEQ ID No.2,

SEQ ID No.1：TAACCATAACTAAAACAAAA；

SEQ ID No.2：TAAAGATGAACTAACCAATA，

The InDel marker locus corresponding to the InDel marker primer is shown as SEQ ID No.5,

SEQ ID No.5：GAATCTTGGCAAAAGCGTGTAATAAAAGTTGCAAT GTATATATTCTTA。

2. Use of the InDel-labeled primer of claim 1, comprising any one or more of the following:

a: identification or auxiliary identification of tomato varieties;

b: preparing a product for identifying or assisting in identifying tomato varieties;

c: selecting or assisting in selecting tomato varieties;

d: preparing a product for breeding or assisting in breeding tomato varieties;

e: breeding tomatoes;

f: preparing tomato breeding products.

3. A kit, which is characterized by comprising primers shown in SEQ ID No.1 and SEQ ID No. 2.

4. A kit according to claim 3, wherein the kit further comprises reagents for a PCR reaction and/or reagents for agarose gel electrophoresis.

5. A method for identifying tomato varieties is characterized in that the method adopts InDel marker primers shown in SEQ ID No.1 and SEQ ID No.2 to identify the tomato varieties.

6. The method of claim 5, wherein the method is used to identify one or more of the tomato variety "Pink 4", "XT2108", "XT 2109".

7. The method of claim 5, comprising the steps of:

S1: extracting DNA of a sample tomato;

S2: carrying out PCR amplification on DNA of the sample tomato by adopting an InDel marked primer or a kit containing the InDel marked primer;

S3: agarose gel electrophoresis is carried out on the PCR amplification result;

S4: and identifying the tomato variety according to the agarose gel electrophoresis result.

8. The method according to claim 7, wherein in the step S4, if the agarose gel electrophoresis result is double-band and the molecular weight indicated by the upper band is 199bp and the molecular weight indicated by the lower band is 151bp, the variety of the sample tomato is "Pink Ke 4"; if the agarose gel electrophoresis result is single band type and the molecular weight shown by the band is 199bp, the variety of the sample tomato is 'XT 2108'; if the agarose gel electrophoresis result is single band type and the molecular weight shown by the band is 151bp, the tomato variety is 'XT-2109'.

9. The method according to claim 7, wherein in step S1, the organ used for extracting the tomato DNA is selected from any one or more of roots, stems, leaves, flowers, fruits, seeds.

10. A method for verifying the accuracy of an InDel marker primer, wherein the InDel marker primer is shown as SEQ ID No.1 and SEQ ID No.2, the verification method comprising the steps of:

step1: planting target crops, and carrying out field phenotype identification;

step 2: performing PCR (polymerase chain reaction) amplification on target crops by using InDel marked primers and performing agarose gel electrophoresis on the PCR amplification result;

Step 3: and comparing the field phenotype identification result with the agarose gel electrophoresis result, and calculating the accuracy.