CN110438250B - Application of LsH3 as internal reference gene in analysis of cucumber green mottle mosaic virus infection of cucumber by using bottle gourd - Google Patents
Application of LsH3 as internal reference gene in analysis of cucumber green mottle mosaic virus infection of cucumber by using bottle gourd Download PDFInfo
- Publication number
- CN110438250B CN110438250B CN201810422078.0A CN201810422078A CN110438250B CN 110438250 B CN110438250 B CN 110438250B CN 201810422078 A CN201810422078 A CN 201810422078A CN 110438250 B CN110438250 B CN 110438250B
- Authority
- CN
- China
- Prior art keywords
- artificial sequence
- bottle gourd
- gene
- internal reference
- analysis
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6844—Nucleic acid amplification reactions
- C12Q1/686—Polymerase chain reaction [PCR]
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
- C12Q1/6895—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms for plants, fungi or algae
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/166—Oligonucleotides used as internal standards, controls or normalisation probes
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Organic Chemistry (AREA)
- Engineering & Computer Science (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Health & Medical Sciences (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Analytical Chemistry (AREA)
- Biotechnology (AREA)
- Microbiology (AREA)
- Biochemistry (AREA)
- Biophysics (AREA)
- Molecular Biology (AREA)
- Physics & Mathematics (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Genetics & Genomics (AREA)
- Immunology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Botany (AREA)
- Mycology (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention belongs to the technical field of molecular biology, and particularly relates to application of an LsH3 gene as an internal reference gene in qRT-PCR analysis of bottle gourd leaves or fruits under cucumber green mottle mosaic virus infection. According to the invention, the expression level and stability of the gene are compared on the whole genome level by utilizing bottle gourd transcription group data, and the LsIPT or LsDdRP gene is used for verification, so that the disclosed LsH3 gene can be stably expressed in bottle gourd leaves and fruits under cucumber green mottle mosaic virus infection, and is a reliable reference gene for detecting gene expression analysis of bottle gourd under cucumber green mottle mosaic virus infection by utilizing a qRT-PCR technology. The LsH3 gene is used as an internal reference gene for bottle gourd gene expression analysis for the first time, and the current situation that no internal reference gene exists in the conventional bottle gourd quantitative PCR detection is solved.
Description
Technical Field
The invention belongs to the technical field of molecular biology, and particularly relates to application of a gene as an internal reference gene in qRT-PCR analysis of bottle gourd leaves or fruits under cucumber green mottle mosaic virus infection.
Background
Lagenaria siceraria var. hispida is an annual viniferous herb of cucurbitaceae, and is a medicinal melon dish with effects of relieving swelling and moistening skin. The tender fruit is a delicious food which is frequently eaten in summer in China, tastes tender and soft, has slight sweet taste, and can be eaten after being peeled. Mature and old fruits cannot be eaten, and mature and dry shells of the fruits are used as containers in ancient China and also used as medicines. Bottle gourds are cultivated in all parts of the south and the north of China, the bottle gourds are cultivated in the south, and introduction and cultivation are started in the north in recent years.
In recent years, with the frequent reports of the occurrence of damage of Cucumber green mosaic virus (CGMMV) on watermelons, there are also a large number of cases in which CGMMV is carried by bottle gourds as watermelon stocks. The CGMMV infects the watermelon to cause the new leaves to generate light green or light yellow flower spots, then green protrusions are formed, and even the leaves are deformed. The symptoms gradually weaken along with the aging of diseased leaves, and compared with normal plants, the diseased plants grow slowly, are short and small, and sometimes have wilting symptoms. Sometimes, the surface of the sick watermelon fruit has mosaic mottle or dark green round spots, and dead spots may be generated in the center of the watermelon fruit. Sometimes, the surface of the diseased watermelon fruit has no symptoms, but the pulp inside the fruit, which is close to the seeds, is in a brownish purple turbid and opaque water immersion state, and the pulp is fibrous, even hollow and rotten. The CGMMV-infected Lagenaria siceraria leaf is yellow, has green-band shape along the leaf vein, and sometimes has green protrusion. Generally, the top leaves of the diseased plants are yellow, floral leaves, green, prominent and small, the bottom leaves shrink along the veins, the edges of the leaves are wavy, the leaves are deformed, and sometimes cryptoneurosis also occurs to old leaves. After the young fruits are infected with diseases, the surfaces of the fruits show symptoms such as mottle or green part protrusion, and the like, and when the fruits are ripe, the symptoms disappear, and the fruit stalks of the diseased fruits have brown necrosis. The phenomenon that CGMMV infects different host leaves and shows similar symptoms, but the difference of the CGMMV between the CGMMV and the leaves is large on fruits attracts people's attention.
At present, the research on functional genes of cucurbit crops is still laggard, the research on analyzing gene expression by utilizing qRT-PCR in the research on the functional genes of bottle gourds is not reported, and only a small amount of related reports of applying traditional reference genes in the stages of biotic or abiotic stress, fruit development and the like in the close-source species of melons, watermelons and the like exist. Therefore, when genes of leaves and fruits of the bottle gourds after being infected by the CGMMV are subjected to expression analysis at present, only traditional internal reference genes with expression stability lacking in system verification can be selected by referring to other species, and therefore the accuracy of gene expression analysis of the leaves and fruits of the bottle gourds after being infected by the viruses is seriously influenced. And the transcriptome sequencing technology which is emerging in recent years provides possibility for screening internal reference genes which are stably expressed in bottle gourd leaves after CGMMV infection.
Therefore, a special reference gene of the cucurbitaceae plant under the infection of cucumber green mottle mosaic virus is needed to provide possibility for accurately monitoring and preventing the disease.
Disclosure of Invention
According to the application, bottle gourd before and after CGMMV infection is used as a test material, the gene expression conditions of candidate housekeeping genes and cucurbitaceae traditional internal reference genes in bottle gourd leaves and fruits are detected, and the application of the candidate genes as the internal reference genes in qRT-PCR analysis of the bottle gourd leaves or fruits under cucumber green mottle mosaic virus infection is disclosed.
The method aims to solve the problem that a bottle gourd lacks of a reference gene which is verified by a system and stably expressed when quantitative analysis of gene expression is carried out on leaves or fruits of the bottle gourd after the bottle gourd is infected by cucumber green mottle mosaic virus. One purpose of the invention is to provide an application of LsH3 gene as an internal reference gene in qRT-PCR analysis of bottle gourd leaves or fruits under cucumber green mottle mosaic virus infection.
In some preferred modes, the LsH3 gene sequence is shown as SEQ ID No. 1.
In some preferred modes, the primers of the reference gene are: forward primer sequence: CAAACTGCCCGTAAGTCCAC, respectively; reverse primer sequence: GGCTTCTTCACTCCTCCTGT are provided.
On the other hand, the invention provides a method for analyzing LsIPT or LsDdRP by qRT-PCR of bottle gourd leaves or fruits infected by cucumber green mottle mosaic virus, which comprises the following steps:
step 1: sample handling
Planting bottle gourd seedlings in greenhouse soil, keeping the temperature at 20-25 ℃, watering once every 3 days, and frictionally inoculating cucumber green mottle mosaic virus juice to unfolded system leaves in a two-leaf one-heart period; disease fluid was formed by homogenizing 100mg of cucumber green mottle mosaic virus-infected tissue in 20 volumes of PBS buffer; healthy plants were treated with PBS buffer as control;
randomly selecting bottle gourd system leaves and fruits infected by cucumber green mottle mosaic virus, and storing the bottle gourd system leaves and fruits in liquid nitrogen for later use;
step 2: extraction of RNA and cDNA Synthesis
RNA extraction is carried out on a test sample preserved in liquid nitrogen for later use, and 3 biological repetitions are set for each treatment; detecting the quality and concentration of RNA by using denaturing gel electrophoresis and a bioanalyzer; carrying out reverse transcription on each RNA to obtain corresponding cDNA;
and step 3: providing a primer for a reference gene LsIPT or LsDdRP; the nucleotide sequence of the LsIPT primer is as follows: the sequence of the forward primer is GCACTCCAATGGCTCGTTTA, and the sequence of the reverse primer is GGTCGATGGTGGATTTGTCG; the nucleotide sequence of the LsDdRP primer is as follows: the sequence of the forward primer is AAACTCCCTTTCAGCCTCGA, and the sequence of the reverse primer is AGATGTGGCCCTGTTGAGAA;
providing a primer of an internal reference gene LsH3, wherein the nucleotide sequence of a LsH3 primer is as follows: the forward primer sequence is CAAACTGCCCGTAAGTCCAC; the reverse primer sequence is GGCTTCTTCACTCCTCCTGT;
and 4, step 4: qRT-PCT analysis
Diluting the synthesized cDNA solution by 5 times to obtain the initial concentration of qRT-PCR; the 10. mu.L qRT-PCR reaction system contained 5. mu.L of 2 XSSYBR Premix Ex TaqTM solution, 0.5. mu.L of cDNA solution, 0.15. mu.L each of upstream and downstream detection primers (reference gene: LsIPT or LsDdRP; reference gene LsH3), and 3.9. mu.L of RNase Free dH 2O.
The reaction procedure is as follows: pre-denaturation at 95 ℃ for 5 min; denaturation at 95 ℃ for 15sec, annealing at 58 ℃ for 15sec, extension at 72 ℃ for 15sec, 40 cycles; each sample was set up for 3 replicates;
if the expression mode of the reference gene LsIPT or LsDdRP in the leaf or fruit of the bottle gourd to be detected is up-regulated expression and the expression level is increased, the LsH3 is suitable for being used as the internal reference gene of CGMMV infected bottle gourd leaf or fruit.
The invention has the beneficial technical effects that:
the expression stability is high, namely the expression level and stability of genes in leaves and fruits of the bottle gourd after CGMMV infection are compared on the whole genome level by utilizing the bottle gourd transcriptome data, and a proper new internal reference gene is screened out from the expression level and stability of the traditional internal reference gene in transcriptome analysis. Therefore, the expression stability of the reference gene obtained by the invention is superior to that of the traditional reference gene used at present.
The application range is wide: the expression stability of the internal reference gene in the bottle gourd with 2 different tissues and health and infection of CGMV (China general microbiological culture Collection culture medium) in the leaves and fruits of the bottle gourd is analyzed, and the obtained internal reference gene has wide applicability.
Drawings
FIG. 1 is an electrophoresis chart showing PCR amplification results of candidate internal reference genes of leaf and fruit of Lagenaria siceraria, wherein A) shows a PCR amplification result of candidate internal reference genes of leaf; panel B) shows the PCR amplification result of leaf and fruit common candidate reference genes and the PCR amplification result of fruit candidate reference genes.
FIG. 2 is the analysis of the dissolution curves of the candidate internal reference genes of the leaves and fruits of the bottle gourd, wherein A) shows the dissolution curves of the candidate internal reference genes of the leaves and the fruits together; B) the figure shows a leaf candidate internal reference gene dissolving curve; C) the graph shows the fruit candidate internal reference gene lysis curve.
FIG. 3 is a box plot of original Ct values of the internal reference genes of the bottle gourd leaf candidates and fruit candidates in all sample groups, wherein, the graph A) represents the box plot of the original Ct values of the internal reference genes of the bottle gourd leaf candidates; graph B) shows a distribution box of original Ct values of candidate internal reference genes of bottle gourd fruits; and (C) is a box diagram showing the distribution of original Ct values of the common candidate internal reference genes of the leaf and the fruit of the bottle gourd.
FIG. 4 is a graph of geNorm analysis CGMMV infection bottle gourd leaf and fruit common candidate internal reference gene stability M.
FIG. 5 is a graph of geNorm analysis CGMMV infection bottle gourd leaf and fruit common candidate internal reference gene stability V.
FIG. 6 shows that NormFinder software analyzes the stability of the bottle gourd leaf and fruit common candidate reference genes.
FIG. 7 is a graph of the stability M of candidate genes of bottle gourd leaves infected by CGMMV in the analysis of geNorm.
FIG. 8 is a graph of stability V of candidate genes of bottle gourd leaves infected by CGMMV analyzed by geNorm.
FIG. 9 shows the stability of candidate genes in the leaves of bottle gourd infected by CGMMV in NormFinder analysis.
FIG. 10 is a graph of candidate gene stability M in bottle gourd fruits infected by CGMMV in geNorm analysis.
FIG. 11 is a graph of the stability V of candidate genes in bottle gourd fruits infected with CGMMV by geonorm analysis.
FIG. 12 shows that the CGMMV of NormFinder analysis infects the stability of candidate genes in bottle gourd fruits.
FIG. 13 shows that the stability of internal reference genes screened from CGMMV infected bottle gourd is verified by qRT-PCR analysis of IPT and DdRP gene expression.
FIG 14 shows CGMMV infection-related bottle gourd leaf and fruit common candidate internal reference gene primer sequences.
FIG. 15 shows the primer sequences of candidate internal reference genes of leaf and fruit of bottle gourd screened in transcriptome data
Detailed Description
The present invention is further illustrated by the following examples, which should not be construed as limiting the scope of the invention. The experimental procedures in the following examples were carried out in a conventional manner unless otherwise specified, and materials, reagents and the like used in the following examples were commercially available unless otherwise specified.
Example 1: selection of reference Gene
Bottle gourd planting and sample collection
The bottle gourd variety Hangzhou long melon is planted in soil rich in organic matters in greenhouse of Vibriology and biotechnology institute of agricultural academy of sciences in Zhejiang province, the temperature is kept at 20-25 ℃, water is poured once every 3 days, and the soil humidity is kept. The CGMMV disease juice is inoculated to the unfolded systemic leaves by friction in the two-leaf one-heart period, and the specific preparation method of the disease juice comprises the following steps: 100mg of CGMMV-sensitive tissue homogenate was placed in 20 volumes of PBS buffer (0.1M PBS, pH7.5, 0.2% sodimulfite and 0.01M 2-mercaptoethanol), whereas control healthy plants were inoculated by rubbing with PBS buffer only. Other management is performed as usual. Collecting CGMMV infected leaves and fruits of bottle gourd system and healthy leaves and fruits of bottle gourd system for RNA extraction, and setting 3 biological repetitions for each treatment. The bottle gourd leaves and fruit samples are collected and then immediately placed in liquid nitrogen for RNA extraction or stored in a refrigerator at-70 ℃.
Second, total RNA extraction, first strand cDNA Synthesis
Total RNA of bottle gourds to be tested and total RNA of control bottle gourds were extracted by the Trizol method (Invitrogen, USA), and the extraction procedure was performed according to the instructions of the suppliers. RNA quality and concentration were determined by denaturing gel electrophoresis and 2100Bioanalyzer (Agilent, USA). Extracting bottle gourd total RNA as template, and applying PrimeScript TM The RT reagent Kit with gDNA Eraser (Perfect Real Time) Kit is prepared by removing genomic DNA and then carrying out reverse transcription to synthesize cDNA, and the steps are carried out according to the Kit specification.
Third, detection of CGMMV infection sample
Ex Taq DNA polymerase system of TaKaRa company is adopted, cDNA of a sample is used as a template, a specific detection primer of CGMMV MP is used for carrying out PCR amplification detection, and the infection condition of the CGMMV of the bottle gourd leaves is verified. Specifically, the forward primer CGMMV-MP-f (+): CTGTTGCAGAGGGAACTATA (SEQ ID No.7) and the reverse primer CGMMV-MP-r (-): GCTGAAATAG GAACTTTGTC (SEQ ID No. 8).
Screening of stably expressed internal reference genes and screening of conventional internal reference genes in CGMMV (CGMMV) infected bottle gourd transcriptome data
1. Common internal reference screening parameter setting of bottle gourd leaves and fruits before and after CGMMV infection
And (3) screening bottle gourd internal reference genes which are stably expressed in leaves and fruits before and after CGMMV infection by setting condition parameters from the obtained RNA seq data. Ideally, the internal reference genes should be moderately or highly expressed under viral infection, so the minimum RPKM value in the group of bottle gourd transcriptome data is set to 40(RPKM >40), and based on conservation, the coefficient of variation CV in bottle gourd is set to less than 0.3, the p value is less than 0.05(CV <0.3, p <0.05), and genes with only one transcript are screened.
2 candidate reference genes meeting the above standards are screened in total, and are respectively: comp19078_ c0, encoding a gene WD repeat-linking protein (nucleotide sequence shown in SEQ ID No. 2) and comp17031_ c0, encoding a histone H3.3 gene (histone H3.3, H3, nucleotide sequence shown in SEQ ID No. 1). Meanwhile, 14 commonly used conventional cucurbit crop internal reference genes are screened as controls, namely Actin 7(Actin-7, ACT7), glyceraldehyde-3-phosphate dehydrogenase (GAPDH), protein phosphatase 2A (phosphatase PP2A catalytic subent, PP2A), small GTP hydrolase (Ran-GTPase, RAN), 40S ribosomal protein S15-4, (40S ribosomal protein S15-4, PRS15), TATA binding protein (transcription initiation factor TFIID TATA-box-binding protein, TBP), tubulin (tubulin alpha-3-protein-like, TUA), peptidyl pro-trans-isomerase CYP20-1 (peptides-polypeptides-20), and peptidyl-trans-isomerase (CYP 1-20, PIN1), 60S ribosomal protein L23A (60S ribosomal protein L23a, RPL23A), ubiquitin 60S ribosomal protein L40(ubiquitin-60S ribosomal protein L40, UBA), 60S ribosomal protein L23(60S ribosomal protein L23, RPL23), ADP-ribosylation factor (ADP ribosylation factor, ADP) and Elongation factor1 α (Elongation factor1 α, EF1 α) (Kong, Q., Gao, L., Cao, L.Liu., Liu, Y., Saba, H., Huang, Y., et al. (2016), Assessment of quantitative references for expression expressions, strain in detail coefficients, F4838.1178.1178; kong, q, Yuan, j, Niu, p, Xie, j, Jiang, w, Huang, y, et al (2014) Screening competent reference genes for normalization in reverse transcription quantitative real-time PCR analysis in tumor. plos one.9: eos 97.doi: 10.1371/journel.p.0087197), see in particular table 1.
2. Selection of preferable internal reference genes in bottle gourd leaf transcriptome before and after CGMMV infection
Referring to the above treatment method, the screening conditions in the leaf were: the minimum RPKM value in the bottle gourd transcriptome data was set to 40(RPKM >40), and the coefficient of variation CV in the bottle gourd was set to less than 0.3 and the p value was less than 0.05(CV <0.3, p <0.05) according to conservation, and genes of only one transcript were selected, LsARL, LsTPT, LsSTK, LsCNX, LsP4HB, lsshagggy, LsUBC, LsGAD, and LsRBP, respectively.
3. Selection of preferable internal reference genes in bottle gourd fruit transcriptome before and after CGMMV infection
With reference to the above treatment method, the screening conditions in the fruit were: minimum RPKM value was set to 40(RPKM >40), coefficient of variation CV was set to less than 0.3, p value was less than 0.05(CV <0.3, p <0.05), genes were screened for only one transcript, LsBTB/POZ, LsP4H, LsXRN1, lsarp, LsHD, LsEIF5AL1, LsVAMP, LsPLA, lsicu, LsclpC and LsCBRLK, respectively.
Example 2: real-time fluorescent quantitative PCR design and routine PCR detection of CGMMV infected bottle gourd internal reference gene
Design of quantitative primer
Internal reference primers were designed using the online primer design program primer3.0, the main design parameters included: the length range of the amplified fragment is 80-250bp, the Tm value of the quantitative primer is set to be 58-64 ℃, and the GC content range of the primer is 45-55%. Common candidate internal reference genes of CGMMV infection-related bottle gourd leaves and fruits are respectively LsH3, LsWD, LsACT, LsUBA52, LsPRL23, LsRAN, LsPP2A, LsGAPDH, LsEF1 alpha, LsADP, LsTUA, LsTBP, LsPS 15, LsCYP20, LsCYP and LsL23A, and designed primer sequences are shown in a picture 14; the candidate internal reference genes of the leaf of the bottle gourd screened in the transcriptome data are LsARL, LsTPT, LsSTK, LsCNX, LsP4HB, LsSHAGGY, LsUBC, LsGAD and LsRBP, the candidate internal reference genes of the fruit of the bottle gourd are LsBTB/POZ, LsP4H, LsXRN1, LsARP, LsHD, LsEIF5AL1, LsVAMP, LsPLA, LsISCU, LsclpC and LsCBRLK, the designed primer sequences are shown in figure 15, and the designed primers are synthesized by Hangzhou Zhikexi biotechnology Limited.
Second, amplification of the selected reference gene sequence fragment
In order to determine the specificity of the designed quantitative primers, the designed quantitative primers are used, cDNA of bottle gourd leaves and fruits is used as a template, an Ex Taq DNA polymerase system of TaKaRa company is adopted for carrying out conventional PCR amplification, and the specific reaction system and the PCR reaction process are carried out according to the instruction of a kit. Meanwhile, in order to identify whether the genomic DNA in the RNA is completely removed, the healthy bottle gourd leaf and fruit cDNA controls are used as templates, and conventional PCR amplification is carried out.
Carrying out 1% agarose gel electrophoresis detection on the PCR amplification product, wherein the detection result is shown in figure 1; as can be seen from FIG. 1, the candidate reference gene bands amplified by PCR are bright and single, and the fragment size is consistent with the expected size, which indicates that the designed RT-qPCR primer has good specificity and can be continuously verified by the downstream real-time fluorescent quantitative PCR primer. Bands were not amplified using the control cDNA from leaf and fruit of bottle gourd as template, indicating complete removal of genomic DNA from RNA. And further cutting and recovering the amplified PCR product, connecting the PCR product with a vector, detecting, sending the PCR product to a gene detection company for sequencing, wherein the sequencing result is consistent with the candidate internal reference gene sequences in the transcriptome dataset, and the genes are proved to exist in the bottle gourd stably.
Example 3 real-time fluorescent quantitative PCR primer validation
Performing RT-qPCR amplification on leaf and fruit cDNA of bottle gourd by using designed quantitative primers in an ABI Prism 7900HT FAST type fluorescent quantitative PCR instrument, wherein the reaction system and the reaction program of the PCR reaction are as follows:
the reaction system is as follows: 2 XSSYBR Green Master Mix, 5. mu.L, 0.15. mu.L each of upstream and downstream detection primers (reference genes listed in FIGS. 14 and 15), 0.5. mu.L cDNA, RNase Free dH 2 O4.2. mu.L. The reaction procedure is as follows: pre-denaturation at 95 ℃ for 5 min; denaturation at 95 ℃ for 15sec, annealing at 58 ℃ for 15sec, for 40 cycles.
The dissolution curve obtained by qRT-PCR analysis is shown in FIG. 2, and as can be seen from FIG. 2, the dissolution curves of all candidate reference genes are in a single peak state, which proves that the specificity of the quantitative primer is good.
Example 4 real-time fluorescent quantitative PCR analysis
The real-time fluorescent quantitative PCR reaction is carried out on an ABI Prism 7900HT FAST type fluorescent quantitative PCR instrument by adopting SYBR Green real time PCR Master Mix fluorescent dye of TOYOBO.
The RT-qPCR reaction adopts a 10 mu L loading system which comprises the following steps: 2 XSSYBR Green Master Mix, 5. mu.L, 0.15. mu.L each of the upstream and downstream primers (reference genes listed in FIGS. 14 and 15), 0.5. mu.L of cDNA, RNase Free dH 2 O4.2. mu.L. Fluorescent quantitative PCR reaction procedure: pre-denaturation at 95 ℃ for 5 min; denaturation at 95 ℃ for 15sec, annealing at 58 ℃ for 15sec, extension at 72 ℃ for 15sec, 40 cycles;signals were collected after the extension was completed at 72 ℃ and the dissolution curve was added. There were 3 technical replicates per sample.
When a standard curve is made based on absolute quantitative RT-qPCR analysis, a cDNA template is sequentially diluted for 6 gradients which are respectively 1: 1, 1: 4, 1: 16, 1: 64, 1: 256 and 1: 1024, a standard curve is drawn by taking the log value of the initial template as the abscissa and the Ct value obtained as the ordinate according to the fluorescent quantitative PCR result, and a regression equation of the curve is obtained. The amplification efficiency E of the gene is calculated according to the formula: e (%) - (10) -1/slope -1) × 100. And performing fluorescent quantitative PCR by using cDNA diluted by 5 times as a template, setting 3 biological repeats for each sample, and performing the next analysis on the obtained Ct value.
Primer amplification efficiency (E), melting temperature (T) obtained by fluorescent quantitative PCR analysis m ) The parameters are shown in tables 1 and 2. The results show that the amplification efficiency of each internal reference gene is 90-120%, and R2 of each gene is more than or equal to 0.98, which indicates that the amplification efficiency is better.
Table 1: amplification information of common candidate internal reference genes of leaves and fruits of CGMMV (CGMMV) infection-related bottle gourd
Table 2: amplification information of candidate internal reference genes of leaf and fruit of bottle gourd screened in transcriptome data
Example 5: analysis of expression abundance and expression stability of candidate reference genes
First, expression abundance analysis of candidate reference gene
And analyzing the expression abundance of all candidate reference genes, wherein the higher the mRNA content of gene expression, the lower the Ct value obtained, and conversely, the lower the mRNA content, the higher the Ct value obtained. The Ct value of the leaf of the bottle gourd ranges from 16.51 to 25.63, wherein the CYP expression level is the highest, the Ct value is 16.51, the TBP expression level is the lowest, and the Ct value is 25.63. As is clear from fig. 3A, the gene with the smallest expression level variation in the leaf of bottle gourd was the UBC gene. The Ct value of the fruit of Lagenaria siceraria (Lagenaria siceraria) is in the range of 20.94-28.88, wherein the expression level of H3 is the highest, the Ct value is 20.94, the expression level of TBP is the lowest, and the Ct value is 28.88. As can be seen from fig. 3B, the gene with the smallest expression level variation in the bottle gourd fruit was PLA. As seen from FIG. 3C, the internal reference genes that have the smallest coexpression variation in fruit and leaf of Lagenaria siceraria are ACT, ADP and WD.
Second, expression stability analysis of candidate reference genes
And (3) sorting the Ct values obtained by the fluorescent quantitative RT-qPCR by using Excel, and performing stability analysis on the candidate internal reference genes by adopting 4 different analysis software Delta Ct, geonorm, NormFinder and RefFinder, so as to select the internal reference genes which are more suitable for quantitative analysis of the fluorescence of the leaves and the fruits of the bottle gourd.
1. Analysis of stability of common internal reference genes of leaves and fruits of bottle gourd
(1) Delta Ct analysis
Delta Ct analysis results show that under CGMMV infection, the stability sequence of common candidate internal reference genes in leaves and fruits of the bottle gourds is as follows: WD > TBP > GAPDH > H3> EF1 alpha > L23A > CYP20> TUA > PP2A > RAN > PRS15> UBA52> PRL23> ADP > ACT > CYP, wherein WD, TBP and GAPDH are relatively good in stability.
(2) GeNorm analysis
Analysis results by adopting geNorm software show that under CGMMV infection, the stability sequence of common candidate internal reference genes in leaves and fruits of the bottle gourds is as follows: h3 ═ GAPDH > WD > EF1 α > CYP20> ACT7> ADP > PP2A > TBP > RAN > TUA > L23A > PRS15> UBA52> PRL23> CYP (table 3). M values of 16 bottle gourd leaf and fruit common reference candidate genes are all lower than 1.5 (figure 4), Vn/Vn + 1 is smaller than default V value 0.15 (figure 5), the screening standard of geNorm software is met, and new reference genes are not needed. The data result shows that H3, GADPH and WD are the internal reference genes with better stability in the comprehensive analysis of 16 common internal reference genes of the leaves and fruits of the bottle gourd.
TABLE 3 stability values and ranking of leaf and fruit common candidate reference genes calculated using geNorm
(3) NormFinder analysis
The stability of the alternative genes in the NormFinder analysis is ranked as: TBP > WD > GAPDH > EF1 α > H3> L23A > TUA > CYP20> RAN > PP2A > PRS15> UBA52> PRL23> ADP > ACT > CYP, where TBP and WD are the most stable of the 16 gourd candidate internal reference genes (fig. 6).
Further, the bottle gourd leaf and fruit samples are divided into two groups of healthy control and CGMMV infection for NormFinder analysis, and data results show that: among 16 bottle gourd leaf and fruit common internal reference candidate genes, UBA52 has the lowest interclass variation, and TBP has the lowest intraclass variation; TBP is the most stable reference gene in the candidate genes (stability value is 0.079); at the same time, WD and TBP can be used as two optimal combination reference genes with minimal variation between groups and innermost combination; CYP was the most unstable reference gene.
(4) RefFinder analysis
RefFinder software analyzes the stability of the candidate gene comprehensively: WD > GAPDH > H3> TBP > EF1 alpha > ACT > CYP20> ADP > L23A > PP2A > TUA > RAN > PRS15> UBA52> PRL23> CYP, of which WD, GAPDH and H3 are the most stable relatively.
Based on the above analysis results, WD and H3 are preferred as reference genes among the 16 genes, and GAPDH is a commonly used reference gene, and can be used as a common reference gene for leaf and fruit of pericarpium Lagenariae Hispidae.
2. Analysis of stability of internal reference genes of bottle gourd leaves before and after CGMMV infection
(1) Delta Ct analysis
Delta Ct analysis results show that under CGMMV infection, the bottle gourd leaf candidate internal reference genes have the following stability sequences: CYP > H3> PP2A > TBP > P4HB > STK > TPT > WD > ARL > RBP > SHAGGY > ADP > CNX > PRS15> UBC > GAD > EF1 alpha > PRL23, wherein CYP, H3 and PP2A have relatively good stability.
(2) GeNorm analysis
Analysis results by adopting geNorm software show that the candidate internal reference genes of the bottle gourd leaves are ranked in stability under CGMMV infection as follows: CYP ═ TBP > H3> WD > ARL > PP2A > STK > SHAGGY > ADP > P4HB > TPT > RBP > UBC > GAD > CNX > PRS15> EF1 α > PRL23 (table 4). M values of 18 bottle gourd leaf internal reference candidate genes are all lower than 1.5 (figure 7), Vn/Vn + 1 is all lower than a default V value of 0.15 (figure 8), the selection standard of geNorm software is met, and new internal reference genes do not need to be primed. The data result shows that TBP, CYP and H3 are the most stable internal reference genes in the comprehensive analysis of 18 common internal reference genes of the leaf and fruit of the bottle gourd.
TABLE 4 Stable values and ranking of leaf candidate reference genes calculated with geNorm
(3) NormFinder analysis
The bottle gourd leaf samples are divided into two groups of healthy control and CGMMV infection for NormFinder analysis, and data results show that the stability sequence of alternative genes for the NormFinder analysis is as follows: CYP > H3> PP2A > TBP > P4HB > STK > RBP > TPT > ARL > WD > SHAGGY > ADP > CNX ═ PRS15> EF1 alpha > UBC > GAD > PRL23, among the 18 bottle gourd leaf internal reference candidate genes, H3 has the lowest interclass variation, and CYP has the lowest intraclass variation; CYP is the most stable internal reference gene (stability value is 0.106) in candidate genes, wherein CYP, H3 and PP2A are the most stable internal reference genes in 18 bottle gourd leaf candidates, and RPL23 is the most unstable reference gene (FIG. 9).
(4) RefFinder analysis
Stability ranking of the selected leaf candidate genes in the transcriptome under the condition of CGMMV infection by the RefFinder software comprehensive analysis is as follows: CYP > H3> TBP > PP2A > STK > ARL > WD > P4BH > UBC > SHAGGY > TPT > GAD > ADP > RBP > CNX > PRS15> EF1 alpha > PRL23, wherein CYP, H3 and TBP are relatively most stable.
Combining the analysis results, the most suitable genes of 18 internal reference genes for infecting the bottle gourd leaf candidates by CGMMV are CYP, and then H3 and TBP.
3. Bottle gourd fruit internal reference gene before and after whole genome screening CGMV infection
(1) Delta Ct analysis
Delta Ct analysis results show that under CGMMV infection, the bottle gourd fruit candidate internal reference gene stability sequences are as follows: P4H > TBP > XRN1> ADP > VAMP > H3> ISCU > HD > RARP > WD > EIF5AL1> BTB/POZ > CBRLK > PP2A > clpC > GAPDH > TUA > PLA, wherein P4H, TBP and XRN1 are relatively good in stability.
(2) GeNorm analysis
The results analyzed by the geNorm software show that the stability sequences of the common candidate internal reference genes in the bottle gourd fruits are as follows under CGMMV infection: P4H ═ VAMP > TBP > ADP > HD > XRN1> EIF5AL1> ISCU > H3> BTB/POZ > WD > PARP > CBRLK > PP2A > clpC > GAPDH > TUA > PLA (table 5). M values of 18 bottle gourd leaf internal reference candidate genes are all lower than 1.5 (figure 10), Vn/Vn + 1 is all lower than a default V value of 0.15 (figure 11), the screening standard of geNorm software is met, and new internal reference genes do not need to be primed. The data result shows that P4H, VAMP and TBP are the most stable internal reference genes in the comprehensive analysis of 18 common internal reference genes of the leaf and fruit of the bottle gourd.
TABLE 5 Stable values and ranking of fruit candidate reference genes calculated with geNorm
| Stability ranking | Name of Gene | Stability value (M) |
| 1 | LsP4H | 0.212 |
| 2 | LsVAMP | 0.212 |
| 3 | LsTBP | 0.245 |
| 4 | LsADP | 0.266 |
| 5 | LsHD | 0.284 |
| 6 | LsXRN1 | 0.304 |
| 7 | LsEIF5AL1 | 0.337 |
| 8 | LsISCU | 0.354 |
| 9 | LsH3 | 0.371 |
| 10 | LsBTB/POZ | 0.389 |
| 11 | LsWD | 0.402 |
| 12 | LsPARP | 0.415 |
| 13 | LsCBRLK | 0.427 |
| 14 | LsPP2A | 0.439 |
| 15 | LsclpC | 0.454 |
| 16 | LsGAPDH | 0.474 |
| 17 | LsTUA | 0.494 |
| 18 | LsPLA | 0.531 |
(3) NormFinder analysis
The stability of the alternative genes in the NormFinder analysis is ranked as: TBP > P4H > XRN1> ADP > VAMP > H3> ISCU > WD ═ HD > CBRLK > PARP > EIF5AL1> clpC > BTB/POZ > PP2A > TUA > GAPDH > PLA, where TBP, P4H, and XRN1 were the most stable of the 18 internal reference genes for the bottle gourd fruit candidates (fig. 12).
(4) RefFinder analysis
RefFinder software comprehensively analyzes the stability ranking of candidate genes in bottle gourd fruits before and after CGMMV infection: P4H > ADP > TBP > VAMP > XRN1> H3> EIF5AL1> HD > ISCU > WD > CBRLK > PARP > BTB/POZ > PLA > PP2A > clpC > GAPDH > TUA, with P4H, ADP and TBP being the most stable relative.
Example 6 qRT-PCR analysis of reference Gene LsIPT on leaves or fruits of bottle gourd under infection of cucumber Green mottle mosaic Virus
Or expression of LsDdRP
According to the analysis, LsTBP, LsWD, LsH3, LsGAPDH and LsCYP genes with the highest stability in leaves and fruits and LsP4H gene with stable expression in fruits are evaluated to verify the stability of the genes in the bottle gourd before and after CGMMV infection.
And respectively selecting LsIPT and LsDdRP as reference genes for verifying the stability of the reference genes. The nucleotide sequence of the LsIPT gene primer is shown as follows, specifically, the sequence of the forward primer is GCACTCCAATGGCTCGTTTA, and the sequence of the reverse primer is GGTCGATGGTGGATTTGTCG; the nucleotide sequence of the LsDdRP gene primer is shown as follows, specifically, the sequence of the forward primer is AAACTCCCTTTCAGCCTCGA, and the sequence of the reverse primer is AGATGTGGCCCTGTTGAGAA.
Isolation of total RNA and first strand cDNA Synthesis were carried out as described above in example 1. The qRT-PCR analysis was performed as described in example 4 above, with the reaction system: 2 XSSYBR Green Master Mix, 5. mu.L, upstream and downstream detection primers (reference gene: LsIPT or LsDdRP; reference gene: LsTBP, LsWD, LsH3, LsGAPDH, LsCYP or LsP4H) 0.15. mu.L each, cDNA 0.5. mu.L, RNase Free dH 2 O3.9. mu.L. The reaction procedure is as follows: pre-denaturation at 95 ℃ for 5 min; denaturation at 95 ℃ for 15sec, annealing at 58 ℃ for 15sec, for 40 cycles.
Transcriptome data analysis showed that relative to healthy controls, expression levels of LsIPT in CGMMV-infected bottle gourds were up-regulated by 1.78-fold in leaves and down-regulated by 1.2-fold in fruits. Whereas LsDdRP is up-regulated 1.4 times in leaves and 1.63 times in fruits.
In leaves, LsIPT increased 2.75 times relative to the control when LsWD was used as a leaf reference gene, and LsIPT increased 2.95,3.82,3.93 and 4.43 times relative to the control when LsGAPDH, LsH3, LsCYP and LsTBP were used as reference genes. In the fruit, the expression levels of LsIPT were normalized and detected using LsTBP, LsWD, LsH3, LsGAPDH, LsCYP and LsP4H as reference genes, and were found to be decreased by 0.54, 0.52, 0.60, 0.57, 0.59 and 0.56 times relative to the control (fig. 13). In leaf cells, expression of LsDdRP was detected with reference to LsWD, LsGAPDH, LsH3, LsCYP and LsTBP, respectively, and it was shown that it was up-regulated by 1.78,1.95,2.51,2.57 and 2.88 fold relative to the control after homogenization (fig. 13).
The expression of LsDdRP was detected in the fruit with reference to LsWD, LsTBP, LsH3, LsGAPDH, LsP4H and LsCYP, respectively, and the results showed that it was up-regulated by 1.42,1.53,1.60,1.62,1.80 and 2.31 fold after homogenization relative to the control, respectively (fig. 13). The results of the qRT-PCR analysis showed that the results of the quantitative analysis with these candidate genes were consistent with the transcriptome data trends.
Comparing the normalized expression level with transcriptome data and the results of fluorescent quantitative PCR, the analysis shows that LsWD, LsGAPDH and LsH3 are suitable for being used as common reference genes of CGMMV infected leaf blades and fruits of bottle gourds. LsCYP, LsH3 and LsTBP are suitable for being used as internal reference genes for CGMMV to infect bottle gourd leaves, LsP4H, and LsADP and LsTBP are suitable for being used as internal reference genes for CGMMV to infect bottle gourd fruits.
Sequence listing
<110> Zhejiang province academy of agricultural sciences
Application of <120> LsH3 as internal reference gene in analysis of bottle gourd under cucumber green mottle mosaic virus infection
<130> 18-100070-00004990
<141> 2018-05-04
<160> 80
<170> SIPOSequenceListing 1.0
<210> 1
<211> 101
<212> DNA
<213> bottle gourd (Lagenaria siceraria)
<400> 1
caaactgccc gtaagtccac cggaggaaag gctccaagga agcagctggc cacaaaggct 60
gctcgtaagt ctgccccaac cacaggagga gtgaagaagc c 101
<210> 2
<211> 95
<212> DNA
<213> bottle gourd (Lagenaria siceraria)
<400> 2
tctgtggtac tcgagaaggc taccatatgt tcgatcccat actccaatga aaagtgattc 60
tgtgtctgga ctaaacgaca caccggagat ttctc 95
<210> 3
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 3
<210> 4
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 4
<210> 5
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 5
<210> 6
<211> 21
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 6
gagaaatctc cggtgtgtcg t 21
<210> 7
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 7
<210> 8
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 8
<210> 9
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 9
<210> 10
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 10
<210> 11
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 11
<210> 12
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 12
<210> 13
<211> 22
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 13
catgaccata tcaccaacac aa 22
<210> 14
<211> 21
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 14
cgacaataca ggagctaaga a 21
<210> 15
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 15
<210> 16
<211> 21
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 16
cagagatcac gatgccatgt t 21
<210> 17
<211> 23
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 17
ggcagataac tcaagtttat gga 23
<210> 18
<211> 27
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 18
gctgtaagag gtaaataatc aaagagg 27
<210> 19
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 19
<210> 20
<211> 22
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 20
catggtgttt tcaatggaac ca 22
<210> 21
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 21
ctgcttgctc ctgcgtgaaa 20
<210> 22
<211> 25
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 22
ccacgatgtt gatgtgaatc ttctc 25
<210> 23
<211> 21
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 23
atattgccaa caaggcgtag a 21
<210> 24
<211> 21
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 24
tgcccgtaaa caatggacaa a 21
<210> 25
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 25
<210> 26
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 26
<210> 27
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 27
<210> 28
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 28
agccttgatc tgccattcct 20
<210> 29
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 29
agtcctcttc ttcggcactc 20
<210> 30
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 30
<210> 31
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 31
<210> 32
<211> 21
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 32
tgtgaaccat ttgtatctgg a 21
<210> 33
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 33
<210> 34
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 34
<210> 35
<211> 22
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 35
aaggatgccg tgaagaagat gt 22
<210> 36
<211> 22
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 36
gcatcgtagt caggagtcaa cc 22
<210> 37
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 37
gcactccaat ggctcgttta 20
<210> 39
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 39
<210> 39
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 39
<210> 40
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 40
<210> 41
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 41
<210> 42
<211> 21
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 42
gtcaaggcca aagagtaggc a 21
<210> 43
<211> 21
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 43
accacctacg attggcagaa g 21
<210> 44
<211> 21
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 44
gtctgggaaa agtggcggta t 21
<210> 45
<211> 21
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 45
ttgaccacta cccatcttgc a 21
<210> 46
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 46
<210> 47
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 47
tcgctctctc atcccaatcc 20
<210> 48
<211> 21
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 48
gtgcgcattc tcattgatgg g 21
<210> 49
<211> 21
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 49
aggcccactt tgcttcttca a 21
<210> 50
<211> 21
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 50
gagcagtcat gaccctccaa t 21
<210> 51
<211> 21
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 51
cttgcttcac gtctgcttca a 21
<210> 52
<211> 21
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 52
gttgttaggg aggcggacat t 21
<210> 53
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 53
<210> 54
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 54
tcgatcgtgt cagagctctc 20
<210> 55
<211> 21
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 55
tgtcataggg cttgccttca g 21
<210> 56
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 56
<210> 57
<211> 22
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 57
tacatcttca agttgcctgc gt 22
<210> 58
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 58
<210> 59
<211> 21
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 59
ctccccaatg caaaagctga c 21
<210> 60
<211> 21
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 60
gaggtgctgt tcgaccctta a 21
<210> 61
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 61
<210> 62
<211> 21
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 62
cctgtgtttc gccatggaaa c 21
<210> 63
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 63
<210> 64
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 64
aggcctcaca gttcctcttc 20
<210> 65
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 65
<210> 66
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 66
<210> 67
<211> 21
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 67
atggcgaaaa gagaaacggt g 21
<210> 68
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 68
gaaggatcat gtgacgcgtc 20
<210> 69
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 69
<210> 70
<211> 21
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 70
gtagttcaaa gtggagggcg t 21
<210> 71
<211> 21
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 71
aaccttcgat ctcaggcaca a 21
<210> 72
<211> 21
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 72
cgccgcagac agacaaaatg a 21
<210> 73
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 73
<210> 74
<211> 21
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 74
tattccgacg aaatccatcc g 21
<210> 75
<211> 21
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 75
atggcagctt cttcgtcttc c 21
<210> 76
<211> 21
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 76
tggcgctgtt gaagaagttg t 21
<210> 77
<211> 22
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 77
tgtggatgtt gattctgatg ga 22
<210> 78
<211> 23
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 78
acaggttaca caggaatagc atc 23
<210> 79
<211> 21
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 79
accgactgtc cctttcactt g 21
<210> 80
<211> 22
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 80
gtggcggatt ttggatttgc aa 22
Claims (2)
- Use of LsH3 as an internal reference gene in qRT-PCR analysis of leaves or fruits of bottle gourd under cucumber green mottle mosaic virus infection, which is characterized in that: the nucleotide sequence of the reference gene LsH3 is shown in SEQ ID No. 1.
- 2. A method for analyzing LsIPT or LsDdRP by qRT-PCR of bottle gourd leaves or fruits under cucumber green mottle mosaic virus infection is characterized by comprising the following steps:step 1: sample handlingPlanting bottle gourd seedlings in greenhouse soil, keeping the temperature at 20-25 ℃, watering once every 3 days, and frictionally inoculating cucumber green mottle mosaic virus juice to unfolded system leaves in a two-leaf one-heart period; disease fluid was formed by homogenizing 100mg of cucumber green mottle mosaic virus-infected tissue in 20 volumes of PBS buffer; healthy plants were treated with PBS buffer as control;randomly selecting and storing bottle gourd system leaves and fruits infected by cucumber green mottle mosaic virus in liquid nitrogen for later use;step 2: extraction of RNA and cDNA SynthesisRNA extraction is carried out on a test sample preserved in liquid nitrogen for later use, and 3 biological repetitions are set for each treatment; detecting the quality and concentration of RNA by using denaturing gel electrophoresis and a bioanalyzer; carrying out reverse transcription on each RNA to obtain corresponding cDNA;and step 3: providing a primer for a reference gene LsIPT or LsDdRP, wherein,the nucleotide sequence of the LsIPT primer is as follows:forward primer sequence: GCACTCCAATGGCTCGTTTA, respectively;reverse primer sequence: GGTCGATGGTGGATTTGTCG, respectively;the nucleotide sequence of the LsDdRP primer is as follows:forward primer sequence: AAACTCCCTTTCAGCCTCGA the flow of the air in the air conditioner,reverse primer sequence: AGATGTGGCCCTGTTGAGAA, respectively;providing a primer of an internal reference gene LsH3, wherein the nucleotide sequence of the LsH3 primer is as follows:forward primer sequence: CAAACTGCCCGTAAGTCCAC, respectively;reverse primer sequence: GGCTTCTTCACTCCTCCTGT, respectively;and 4, step 4: qRT-PCT analysisDiluting the synthesized cDNA solution by 5 times to obtain the initial concentration of qRT-PCR; the 10 μ L qRT-PCR reaction system comprises: mu.L of 2 XSSYBR Premix Ex Taq solution, 0.5. mu.L of cDNA solution, 0.15. mu.L of each of forward and reverse primers for reference gene LsIPT or LsDdRP and reference gene LsH3, and 3.9. mu.L of RNase Free dH 2 O；The reaction procedure is as follows: pre-denaturation at 95 ℃ for 5 min; denaturation at 95 ℃ for 15sec, annealing at 58 ℃ for 15sec, extension at 72 ℃ for 15sec, 40 cycles; each sample was set up for 3 replicates.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201810422078.0A CN110438250B (en) | 2018-05-04 | 2018-05-04 | Application of LsH3 as internal reference gene in analysis of cucumber green mottle mosaic virus infection of cucumber by using bottle gourd |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201810422078.0A CN110438250B (en) | 2018-05-04 | 2018-05-04 | Application of LsH3 as internal reference gene in analysis of cucumber green mottle mosaic virus infection of cucumber by using bottle gourd |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN110438250A CN110438250A (en) | 2019-11-12 |
| CN110438250B true CN110438250B (en) | 2022-08-30 |
Family
ID=68427239
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201810422078.0A Active CN110438250B (en) | 2018-05-04 | 2018-05-04 | Application of LsH3 as internal reference gene in analysis of cucumber green mottle mosaic virus infection of cucumber by using bottle gourd |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN110438250B (en) |
Family Cites Families (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN104342438A (en) * | 2014-09-28 | 2015-02-11 | 华中农业大学 | Application of ClCAC gene and ClSAND gene as reference genes in analysis of gene expression of watermelon fruits |
| CN105274219B (en) * | 2015-10-13 | 2018-12-07 | 华中农业大学 | Purposes of the CL5547.Contig2 gene in the analysis of pumpkin gene expression real-time fluorescence quantitative PCR as reference gene |
| CN105177187B (en) * | 2015-10-14 | 2018-08-14 | 浙江大学 | Detect sample preparation methods and purposes that Curcurbitaceae seed carries cucumber green mottle mosaic virus |
| CN107227340A (en) * | 2017-04-26 | 2017-10-03 | 武汉市农业科学技术研究院作物科学研究所 | Reference gene and the stability verification method of the reference gene for melon fruit gene PCR expression analysis |
-
2018
- 2018-05-04 CN CN201810422078.0A patent/CN110438250B/en active Active
Non-Patent Citations (1)
| Title |
|---|
| 枣树内参基因ZjH3的克隆与筛选;孟玉平等;《生物技术通报》;20101228(第11期);第101-107页 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN110438250A (en) | 2019-11-12 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Chávez-Pesqueira et al. | Domestication and genetics of papaya: a review | |
| KR101011694B1 (en) | A method for discriminating Chinese cabbage cultivars using molecular markers | |
| CN113774065B (en) | Fluorescent quantitative internal reference gene for different adults of fall webworm, primer and application thereof | |
| CN111100945A (en) | Reference gene of toona sinensis, primer and application thereof | |
| CN113174445B (en) | Internal reference gene for analyzing different tissues of arrowhead and screening method and application thereof | |
| CN107142308B (en) | Primer pair, kit and method for identifying cotton closed pollination material | |
| CN105385768B (en) | Method for identifying millet variety by adopting SSR molecular marker technology and application | |
| CN110438250B (en) | Application of LsH3 as internal reference gene in analysis of cucumber green mottle mosaic virus infection of cucumber by using bottle gourd | |
| CN110438257B (en) | Application of LsWD as internal reference gene in bottle gourd analysis under cucumber green mottle mosaic virus infection | |
| CN111850155A (en) | Application of specific target primer in simultaneous and rapid identification of two pathogenic bacteria of strawberry infection | |
| CN111139304A (en) | Fluorescent quantitative reference gene of cinnamomum camphora peck elephant eating different plants and application | |
| CN113151505B (en) | Fluorescent quantitative reference gene for different population densities of fall webworms and primers and application thereof | |
| CN110393149A (en) | A kind of method and its application of regulation tamato fruit ascorbic acid content | |
| CN113046460B (en) | Leek reference gene under gray mold stress condition, primer of reference gene and application | |
| Baharuddin et al. | Morphological changes analysis of rice cv. IR64 under drought stress | |
| CN112725521A (en) | Dendrobium chrysotoxum SSR molecular marker primer composition and application thereof | |
| CN112980989A (en) | MiRNA fluorescent quantitative reference gene of different tissues of cryptomeria fortunei as well as primer and application thereof | |
| CN116064576B (en) | Internal reference gene of oat under ultraviolet stress, primer sequence and application of internal reference gene | |
| CN112921114B (en) | DNA sequence marker for identifying hemp plant sex and detection primer thereof | |
| CN114480702B (en) | Fluorescent quantitative PCR reference gene of different tissues of sea buckthorn under drought stress, and screening method and application thereof | |
| CN114574615B (en) | Indel mark for identifying Hainan oil tea germplasm and detection method | |
| CN117004760A (en) | Phyllostachys pubescens real-time fluorescence quantitative PCR reference gene, primer pair and application thereof | |
| CN114634991B (en) | InDel marker for identifying high-variety coconuts and application thereof | |
| CN113736902B (en) | Molecular marker related to pear fruit ethylene jump, detection method and application | |
| CN110669865B (en) | SSR molecular marker for identifying Thailand lotus germplasm and application |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |