CN110438250A - LsH3 infects the purposes in lower bottle gourd analysis as reference gene in cucumber green mottle mosaic virus - Google Patents
LsH3 infects the purposes in lower bottle gourd analysis as reference gene in cucumber green mottle mosaic virus Download PDFInfo
- Publication number
- CN110438250A CN110438250A CN201810422078.0A CN201810422078A CN110438250A CN 110438250 A CN110438250 A CN 110438250A CN 201810422078 A CN201810422078 A CN 201810422078A CN 110438250 A CN110438250 A CN 110438250A
- Authority
- CN
- China
- Prior art keywords
- gene
- bottle gourd
- artificial sequence
- fruit
- reference gene
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6844—Nucleic acid amplification reactions
- C12Q1/686—Polymerase chain reaction [PCR]
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
- C12Q1/6895—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms for plants, fungi or algae
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/166—Oligonucleotides used as internal standards, controls or normalisation probes
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Organic Chemistry (AREA)
- Engineering & Computer Science (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Health & Medical Sciences (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Analytical Chemistry (AREA)
- Biotechnology (AREA)
- Microbiology (AREA)
- Biochemistry (AREA)
- Biophysics (AREA)
- Molecular Biology (AREA)
- Physics & Mathematics (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Genetics & Genomics (AREA)
- Immunology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Botany (AREA)
- Mycology (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention belongs to technical field of molecular biology, and in particular to LsH3 gene infects the purposes in lower bottle gourd blade or fruit qRT-PCR analysis as reference gene in cucumber green mottle mosaic virus.The present invention utilizes bottle gourd transcript profile data, the expression and stability of gene are compared in full-length genome level, and it is verified by using LsIPT or LsDdRP gene, determining that revealed LsH3 gene infects in lower bottle gourd blade and fruit in cucumber green mottle mosaic virus can stablize expression, and being bottle gourd infects the lower reliable reference gene using qRT-PCR technology detection gene expression analysis in cucumber green mottle mosaic virus.The present invention is used for bottle gourd gene expression analysis for LsH3 gene as reference gene for the first time, and solving in existing bottle gourd quantitative PCR detection does not have the status of reference gene.
Description
Technical field
The invention belongs to technical field of molecular biology, and in particular to a kind of gene is infected in cucumber green mottle mosaic virus
Purposes in lower bottle gourd blade or fruit qRT-PCR analysis as reference gene.
Background technique
Bottle gourd (Lagenaria siceraria var.hispida) is the annual tendril draft of Curcurbitaceae hois spp, is
Can reduce swelling knot, moisten skin medicinal melon dish.Just there is cultivation in China from ancient times, and okra fruit is the delicacies often eaten in the civil summertime, and mouthfeel is delicate
Softness, slightly sweet taste, it is complete edible after peeling.Mature old fruit is inedible, and Chinese ancient times makees container with its aging dry shell,
Also make medicinal.Bottle gourd has cultivation in China, various regions, north and south, and south cultivation is universal, and the north also started introducing and planting in recent years.
In recent years, with cucumber green mottle mosaic virus (Cucumber green mottle mosaic on watermelon
Virus, CGMMV) occurrence injury report again and again, as watermelon-stock bottle gourd carry CGMMV case also have a large amount of reports.
CGMMV, which infects watermelon, causes young leaves to generate light green or flaxen piebald, then forms the protrusion of green, or even produces blade
Raw deformity.With sick leaf aging, symptom gradually weakens, and compared with normal plant, diseased plant slow growth, plant is short and small, sometimes also
There is wilting symptom.Sometimes the surface of susceptible Watermelon Fruit occurs inlaying mottled or dark green color round spot, and center can also
There may be downright bad points.Sometimes susceptible Watermelon Fruit surface does not have symptom, but inside fruit, and the pulp close to seed is in brown purple
Muddy and opaque water soaking mode, there is fibrosis in pulp, or even cavity, rotten occurs.And the bottle gourd blade that CGMMV infects
Yellow is shown as between yellow, floral leaf or arteries and veins along vein in greenbelt shape, sometimes with green protrusion.General diseased plant top vane table
It is now yellow, floral leaf, green protrusion, becomes smaller, wavy, leaf malformation is presented along vein shrinkage, limb edge in bottom blade, sometimes
Old leaf also will appear hidden disease.After young fruit is susceptible, fruit surface shows the symptoms such as mottled or green portion protrusion, to fruit maturation
Symptom disappears afterwards, and brown necrosis occurs in disease fruit carpopodium.It is similar that CGMMV infects different host's blade performance symptoms, but on fruit
The phenomenon that then differing greatly attracts attention.
It is still relatively backward to the functional gene research of ground family crop at present, qRT- is utilized in the research of bottle gourd functional gene
There is not been reported for the research of PCR analysis gene expression, only for biology or the abiotic side of body in the nearly source species such as muskmelon and watermelon
There are the relevant report of the traditional reference gene of a small amount of application in the stages such as urgent, fruit development.Therefore rear bottle gourd leaf is infected to CGMMV at present
When piece and fruit gene carry out expression analysis, expression stability can only be selected to lack in the tradition of system verifying with reference to other species
Join gene, this has seriously affected the accuracy of bottle gourd gene expression analysis in by virus infection rear blade and fruit.And in recent years
Come the transcript profile sequencing technologies risen, screens CGMMV for us and infect and stablize the reference gene of expression in rear bottle gourd blade and provide
It may.
This just needs to provide exclusive reference gene of the cucurbitaceous plant in the case where infecting as cucumber green mottle mosaic virus, is
Accurate measurements prevent disease offer possibility.
Summary of the invention
The bottle gourd that the application infects front and back using CGMMV detects in candidate housekeeping gene and Curcurbitaceae tradition as test material
Join gene expression conditions in bottle gourd blade and fruit, discloses candidate gene in cucumber green mottle mosaic virus and infect a lower a kind of edible gourd
Purposes in melon blade or fruit qRT-PCR analysis as reference gene.
Progress quantitative gene expression point in rear blade or fruit is being infected by cucumber green mottle mosaic virus to solve bottle gourd
Lack when analysis through system verifying, express the problem of stable reference gene.One of the objects of the present invention is to provide a kind of LsH3
Gene infects the purposes in lower bottle gourd blade or fruit qRT-PCR analysis as reference gene in cucumber green mottle mosaic virus.
In some preferred modes, the LsH3 gene order is as shown in SEQ ID No.1.
In some preferred modes, the primer of the reference gene are as follows: forward primer sequence:
CAAACTGCCCGTAAGTCCAC；Reverse primer sequences: GGCTTCTTCACTCCTCCTGT.
On the other hand, the present invention provides a kind of cucumber green mottle mosaic virus and infects lower bottle gourd blade or fruit qRT-PCR
The method for analyzing LsIPT or LsDdRP, includes the following steps:
Step 1: test sample processing
Bottle gourd seedling cultivation is kept for 20-25 DEG C of temperature, pours a water within every 3 days in greenhouse soil, will in one heart stage of two leaves
Cucumber green mottle mosaic virus disease juice frictional inoculation is in the system blade of expansion；Sick juice is by by 100mg cucumber green statin
The homogenate of mosaic virus susceptible tissue is refuted formed in the PBS buffer solution of 20 times of volumes；Healthy plant is handled with PBS buffer solution to be made
For control；
Randomly select bottle gourd system blade, fruit that cucumber green mottle mosaic virus infects and healthy bottle gourd system blade,
Fruit saves backup in liquid nitrogen；
The extraction of step 2:RNA and the synthesis of cDNA
The test sample saved backup in liquid nitrogen is subjected to RNA extraction, each processing is arranged 3 secondary pollutants and repeats；With change
Property gel electrophoresis and biological analyser detection RNA mass and concentration；Above-mentioned each RNA progress reverse transcription is obtained corresponding
cDNA；
Step 3: the primer for referring to gene LsIPT or LsDdRP is provided；The nucleotide sequence of LsIPT primer is as follows: positive
Primer sequence is GCACTCCAATGGCTCGTTTA, reverse primer sequences GGTCGATGGTGGATTTGTCG；LsDdRP primer
Nucleotide sequence it is as follows: forward primer sequence is AAACTCCCTTTCAGCCTCGA, and reverse primer sequences are
AGATGTGGCCCTGTTGAGAA；
The primer of reference gene LsH3 is provided, the nucleotide sequence of LsH3 primer is as follows: forward primer sequence is
CAAACTGCCCGTAAGTCCAC；Reverse primer sequences are GGCTTCTTCACTCCTCCTGT；
Step 4:qRT-PCT analysis
The cDNA solution synthesized is diluted into 5 times of initial concentrations as qRT-PCR；10 μ L qRT-PCR reaction system packets
2 × SYBR Premix Ex TaqTM solution containing 5 μ L, the cDNA solution of 0.5 μ L, upstream and downstream detection primer (refer to gene:
LsIPT or LsDdRP；Reference gene LsH3) each 0.15 μ L, the RNase Free dH2O of 3.9 μ L.
Response procedures are as follows: 95 DEG C of initial denaturation 5min；95 DEG C of denaturation 15sec, 58 DEG C of annealing 15sec, 72 DEG C of extension 15sec,
40 circulations；3 repetitions are arranged in each sample；
If being up-regulated expression, table with reference to expression pattern of the gene LsIPT or LsDdRP in bottle gourd blade to be measured or fruit
It is improved up to amount, then shows that LsH3 is suitable as the reference gene that CGMMV infects bottle gourd blade or fruit.
The advantageous effects that the present invention has are as follows:
Expression stability is high: the present invention utilizes bottle gourd transcript profile data, compares CGMMV in full-length genome level and infects
Afterwards in bottle gourd blade and fruit gene expression and stability, and be screened out from it suitable new reference gene, and
Traditional reference gene expression and stability in transcriptome analysis is not high.Therefore, the reference gene that the present invention obtains
Expression stability is better than traditional reference gene used at present.
Use scope is wide: the present invention analyzes reference gene in 2 kinds of different tissues of bottle gourd blade and fruit and health and sense
The expression stability in CGMMV bottle gourd is contaminated, the reference gene of acquisition has wide applicability.
Detailed description of the invention
Fig. 1 is bottle gourd blade and fruit candidate's reference gene PCR amplification result electrophoretogram, wherein figure A) indicate that blade is waited
Select reference gene PCR amplification result figure；Scheme B) indicate blade and fruit candidate reference gene PCR amplification result figure and fruit jointly
Real candidate's reference gene PCR amplification result figure.
Fig. 2 is the solubility curve analysis of bottle gourd blade and fruit candidate's reference gene, wherein A) figure indicates blade and fruit
Common candidate's reference gene solubility curve；B) figure indicates blade candidate reference gene solubility curve；C) figure indicates in fruit candidate
Join gene solubility curve.
Fig. 3 is bottle gourd blade and fruit candidate the reference gene original Ct Distribution value box-shaped figure in all samples group, wherein
Scheme A) indicate the original Ct Distribution value box-shaped figure of bottle gourd blade candidate's reference gene；Scheme B) indicate that bottle gourd fruit candidate reference gene is former
Beginning Ct Distribution value box-shaped figure；Scheme C) indicate bottle gourd blade and the fruit original Ct Distribution value box-shaped figure of candidate reference gene jointly.
Fig. 4 is that geNorm analysis CGMMV infects bottle gourd blade and fruit candidate reference gene stability M figure jointly.
Fig. 5 is that geNorm analysis CGMMV infects bottle gourd blade and fruit candidate reference gene stability V figure jointly.
Fig. 6 is NormFinder software analysis bottle gourd blade and fruit candidate reference gene stability jointly.
Fig. 7 is that geNorm analysis CGMMV infects bottle gourd blade candidate gene stability M figure.
Fig. 8 is that geNorm analysis CGMMV infects bottle gourd blade candidate gene stability V figure.
Fig. 9 is that NormFinder analysis CGMMV infects candidate gene stability in bottle gourd blade.
Figure 10 is that geNorm analysis CGMMV infects candidate gene stability M figure in bottle gourd fruit.
Figure 11 is that geNorm analysis CGMMV infects candidate gene stability V figure in bottle gourd fruit.
Figure 12 is that NormFinder analysis CGMMV infects candidate gene stability in bottle gourd fruit.
Figure 13 is that qRT-PCR analyzing IP T and DdRP gene expression verifying CGMMV infects screening reference gene stabilization in bottle gourd
Property.
Figure 14 is that CGMMV infects related bottle gourd blade and fruit candidate reference gene primer sequence jointly.
Figure 15 is the bottle gourd blade screened in transcript profile data and fruit candidate's reference gene primer sequence
Specific embodiment
Below in conjunction with specific embodiment, invention is further explained, but should not be understood as protecting model to the present invention
Enclose the limitation of progress.Experimental method in following embodiments is unless otherwise specified conventional method, institute in following embodiments
Material, reagent etc., are commercially available unless otherwise specified.
Embodiment 1: the selection of reference gene
One, bottle gourd plantation and sample acquisition
Bottle gourd kind " the long melon in Hangzhou " plantation is rich in in Zhejiang Academy of Agricultural Science virology and biotechnology institute greenhouse
In the soil of organic matter, 20-25 DEG C is maintained the temperature at, pours within every 3 days a water, keeps soil moisture.It will in one heart stage of two leaves
CGMMV disease juice frictional inoculation is in the system blade of expansion, the sick specific preparation method of juice are as follows: the susceptible tissue of 100mgCGMMV is even
(0.1M PBS, pH7.5,0.2%sodiumsulfite and 0.01M 2- is starched in the PBS buffer solution of 20 times of volumes
Mercaptoethanol), compare healthy plant and only use PBS buffer solution frictional inoculation.Other management routinely carry out.It collects
Bottle gourd system blade, fruit and healthy bottle gourd system blade, the fruit that CGMMV infects are extracted for RNA, each processing setting 3
Secondary pollutant repeats.Need to be immediately placed in liquid nitrogen after bottle gourd blade and fruit sample acquisition, for RNA extraction or be placed in -70
DEG C refrigerator saves.
Two, Total RNAs extraction, the first chain cDNA synthesis
Bottle gourd to be measured and control bottle gourd total serum IgE, extraction process are extracted respectively using Trizol method (Invitrogen, USA)
It is carried out referring to the specification of supplier.RNA mass and concentration pass through denaturing gel electrophoresis and 2100Bioanalyzer
(Agilent, USA) is detected.To extract bottle gourd total serum IgE as template, using PrimeScriptTM RT reagent Kit
With gDNA Eraser (Perfect Real Time) kit first removes another mistake transcription synthesis cDNA after genomic DNA,
Step is carried out referring to kit specification.
Three, CGMMV infects the detection of sample
CGMMV MP is used using the cDNA of sample as template using the Ex Taq archaeal dna polymerase system of TaKaRa company
Specific detection primer carry out PCR amplification detection, verifying bottle gourd blade CGMMV infects situation.Specifically, forward primer
CGMMV-MP-f (+): CTGTTGCAGAGGGAACTATA (SEQ ID No.7), reverse primer CGMMV-MP-r (-):
GCTGAAATAG GAACTTTGTC(SEQ ID No.8)。
Four, CGMMV infects the screening for stablizing the screening of expression reference gene and conventional reference gene in bottle gourd transcript profile data
1, CGMMV infects front and back bottle gourd blade and the common internal reference screening parameter setting of fruit
It is filtered out before and after CGMMV infects by the way that conditional parameter is arranged in blade and fruit from the RNA seq data obtained
In stable expression bottle gourd reference gene.Ideal reference gene should be expressed in moderate under virus infection or height, therefore
40 (RPKM > 40) are set by the minimum RPKM value in bottle gourd transcript profile data, and according to conservative, by the variation in bottle gourd
Coefficient CV is set smaller than 0.3, and p value only has the gene of a transcript less than 0.05 (CV < 0.3, p < 0.05), screening.
2 candidate reference genes for meeting the above standard are screened altogether, are respectively: comp19078_c0 encode a base
Because of WD repeat-containing protein (its nucleotide sequence is as shown in SEQ ID No.2) and comp17031_c0,
Encode a histone H 3 .3 gene (histone H3.3, H3, nucleotide sequence is as shown in SEQ ID No.1).Simultaneously
14 common traditional ground family crop reference genes have been screened as control, respectively actin 7 (Actin-7,
ACT7), glyceraldehyde-3-phosphate dehydrogenase (glyceraldehyde-3-phosphate dehydrogenase, GAPDH), egg
White phosphatase 2A (phosphatase PP2A catalytic subunit, PP2A), small GTP hydrolase (Ran-GTPase,
RAN), 40S ribosomal protein S15-4, (40S ribosomal protein S15-4, PRS15), TATA binding protein
(transcription initiation factor TFIID TATA-box-binding protein, TBP), tubulin
(tubulin alpha-3chain-like, TUA), peptidyl prolyl cis-trans isomerase cyp20-1 (peptidyl-prolyl
Cis-trans isomerase CYP20-1, CYP20), (the peptidyl-prolyl cis- of peptidyl prolyl cis-trans isomerase 1
Trans isomerase, PIN1), it is 60S Homo sapiens ribosomal protein L23 A (60S ribosomal protein L23a, RPL23A), general
Plain 60S ribosomal protein L 40 (ubiquitin-60S ribosomal protein L40, UBA), 60S Homo sapiens ribosomal protein L23
(60S ribosomal protein L23, RPL23), ADP- ribosylation factor (ADP ribosylation factor,
ADP) and extension factor 1 α (Elongation factor1 α, EF1 α) (Kong, Q., Gao, L., Cao, L., Liu, Y., Saba,
H.,Huang,Y.,et al.(2016).Assessment of suitable reference genes for
quantitative gene expression studies in melon fruits.Front.Plant Sci.7:
1178.doi:10.3389/fpls.2016.01178；Kong,Q.,Yuan,J.,Niu,P.,Xie,J.,Jiang,W.,
Huang,Y.,et al.(2014).Screening suitable reference genes for normalization in
reverse transcription quantitative real-time PCR analysis in melon.Plos
One.9:e87197.doi:10.1371/journal.pone.0087197), specifically it is shown in Table 1.
2, CGMMV infects preferred reference gene screening in the bottle gourd blade transcript profile of front and back
Screening conditions referring to above-mentioned processing method, in blade are as follows: by the minimum RPKM value in bottle gourd transcript profile data
40 (RPKM > 40) are set as, and according to conservative, the coefficient of variation CV in bottle gourd are set smaller than 0.3, p value is less than
0.05 (CV < 0.3, p < 0.05), screening only have a transcript gene, respectively LsARL, LsTPT, LsSTK, LsCNX,
LsP4HB, LsSHAGGY, LsUBC, LsGAD and LsRBP.
3, CGMMV infects preferred reference gene screening in the bottle gourd fruit transcript profile of front and back
Screening conditions referring to above-mentioned processing method, in fruit are as follows: minimum RPKM value is set as 40 (RPKM > 40), becomes
Different coefficient CV is set smaller than 0.3, and p value only has the gene of a transcript less than 0.05 (CV < 0.3, p < 0.05), screening, point
Not Wei LsBTB/POZ, LsP4H, LsXRN1, LsPARP, LsHD, LsEIF5AL1, LsVAMP, LsPLA, LsISCU, LsclpC and
LsCBRLK。
Embodiment 2:CGMMV infects the design of bottle gourd reference gene real-time fluorescence quantitative PCR and Standard PCR detection
One, the design of quantitative primer
Primer is quantified using online design of primers program Primer3.0 design internal reference, main design parameters include: amplification piece
Segment length range is 80-250bp, and quantitative primer Tm is set as 58 DEG C -64 DEG C, and primer G/C content range is 45%-55%.
CGMMV infect related bottle gourd blade and fruit jointly candidate reference gene be respectively LsH3, LsWD, LsACT, LsUBA52,
LsPRL23, LsRAN, LsPP2A, LsGAPDH, LsEF1 α, LsADP, LsTUA, LsTBP, LsRPS15, LsCYP20, LsCYP and
LsL23A, the primer sequence of design is as shown in Figure 14；The bottle gourd blade candidate's reference gene screened in transcript profile data is
LsARL, LsTPT, LsSTK, LsCNX, LsP4HB, LsSHAGGY, LsUBC, LsGAD and LsRBP, bottle gourd fruit candidate's internal reference base
Because LsBTB/POZ, LsP4H, LsXRN1, LsPARP, LsHD, LsEIF5AL1, LsVAMP, LsPLA, LsISCU, LsclpC and
LsCBRLK, as shown in Figure 15, the primer of design is closed the primer sequence of design by Hangzhou Qing Ke Zi Xi Bioisystech Co., Ltd
At.
Two, the reference gene sequence fragment amplification screened
For determine design quantitative primer specificity, with above-mentioned designed quantitative primer with bottle gourd blade and fruit
CDNA is template, using TaKaRa company Ex Taq archaeal dna polymerase system carry out standard PCR amplification, specific reaction system and
PCR reaction process is carried out referring to kit specification.Meanwhile in order to identify the genomic DNA in RNA whether remove completely, with
Healthy bottle gourd blade and fruit cDNA control are template, carry out standard PCR amplification.
Pcr amplification product is subjected to 1% agarose gel electrophoresis detection, testing result is as shown in Figure 1；As shown in Figure 1,
The candidate reference gene band that PCR amplification goes out is bright, single, and clip size is consistent with expection, illustrates the RT-qPCR primer of design
Specificity it is good, the real-time fluorescence quantitative PCR primer verifying in downstream can be continued.Control cDNA with bottle gourd blade and fruit is
Template does not amplify band, illustrates that the genomic DNA removal in RNA is complete.Further by the PCR product gel extraction of amplification,
It is sequenced with carrier connecting detection Hou Song genetic test company, sequencing result and candidate reference gene sequence phase in transcription group data set
Unanimously, show that these genes are stabilized in bottle gourd really.
The verifying of 3 real-time fluorescence quantitative PCR primer of embodiment
Using bottle gourd blade and fruit cDNA as template, with the quantitative primer of design in ABI Prism 7900HT FAST type
Fluorescence quantitative PCR instrument carries out RT-qPCR amplification, and the reaction system and response procedures of PCR reaction are as follows:
Reaction system are as follows: 2 × SYBR Green Master Mix, 5 μ L, each 0.15 μ L of upstream and downstream detection primer (Figure 14 and
Reference gene listed by Figure 15), 0.5 μ L, RNase Free dH of cDNA2O 4.2μL.Response procedures are as follows: 95 DEG C of initial denaturations
5min；95 DEG C of denaturation 15sec, 58 DEG C of annealing 15sec, totally 40 recycle.
It is analyzed according to qRT-PCR and obtains solubility curve as shown in Fig. 2, as can be seen from Figure 2, the dissolution of all candidate's reference genes
Curve is in unimodal state, it was demonstrated that quantitative primer specificity is good.
The analysis of 4 real-time fluorescence quantitative PCR of embodiment
Real-time fluorescence quantitative PCR reaction uses the SYBR Green Realtime PCR Master Mix fluorescence of TOYOBO
Dyestuff carries out on ABI Prism 7900HT FAST type fluorescence quantitative PCR instrument.
RT-qPCR reaction uses 10 μ L loading systems, and system is as follows: 2 × SYBR Green Master Mix, 5 μ L, on
Each 0.15 μ L of downstream detector primer (Figure 14 and Figure 15 listed by reference gene), 0.5 μ L, RNase Free dH of cDNA2O 4.2
μL.Quantitative fluorescent PCR response procedures: 95 DEG C of initial denaturation 5min；95 DEG C of denaturation 15sec, 58 DEG C of annealing 15sec, 72 DEG C extend
15sec, 40 circulations；Signal is acquired after 72 DEG C of extensions, adds solubility curve.Each sample has 3 technologies to repeat.
When RT-qPCR analysis based on absolute quantitation makes standard curve, cDNA template is successively diluted into 6 gradients, point
Not Wei 1 ︰ 1,1 ︰ 4,1 ︰ 16,1 ︰ 64,1 ︰ 256,1 ︰ 1024 according to fluorescent quantitative PCR result be cross with the log value of original template
Coordinate draws standard curve as ordinate using obtained Ct value, and obtains the regression equation of curve.The amplification efficiency E of gene
According to calculation formula: E (%)=(10-1/slope- 1) it × 100 obtains.Fluorescent quantitation is carried out as template using the cDNA for diluting 5 times
PCR, each sample need to be arranged 3 biology and repeat, and the Ct value of acquisition carries out the analysis of next step.
It is analyzed by quantitative fluorescent PCR and obtains primer amplification efficiency (E), melting temperature (Tm) etc. parameters be listed in table 1 and table
2.As can be known from the results, each reference gene amplification efficiency be 90%-120%, R2 >=0.98 of each gene, illustrate amplification efficiency compared with
It is good.
Table 1:CGMMV infects related bottle gourd blade and fruit candidate reference gene amplification information jointly
Table 2: bottle gourd blade and fruit candidate's reference gene the amplification information screened in transcript profile data
Embodiment 5: gene expression abundance and the expression stability analysis of candidate reference gene
One, the gene expression abundance analysis of candidate reference gene
The gene expression abundance of all candidate reference genes is analyzed, the mRNA content of gene expression is higher, the Ct of acquisition
Value is lower, conversely, mRNA content is lower, the Ct value of acquisition is higher.The Ct value range of bottle gourd blade from 16.51 to 25.63, wherein
The expression quantity highest of CYP, Ct value are that the expression quantity of 16.51, TBP is minimum, and Ct value is 25.63.From Fig. 3 A it is found that in bottle gourd blade
The smallest gene of middle expression quantity variation is UBC gene.The Ct value range of bottle gourd fruit is from 20.94 to 28.88, the wherein expression of H3
Highest is measured, Ct value is that the expression quantity of 20.94, TBP is minimum, and Ct value is 28.88.From Fig. 3 B it is found that in bottle gourd fruit expression quantity
The smallest gene that makes a variation is PLA.From Fig. 3 C it is found that co-expressing the smallest reference gene that makes a variation in bottle gourd fruit and blade is
ACT, ADP and WD.
Two, the expression stability analysis of candidate reference gene
The Ct value obtained by fluorescent quantitation RT-qPCR is arranged with Excel, using 4 kinds of different analysis softwares
Delta Ct, geNorm, NormFinder and RefFinder carry out stability analysis to candidate reference gene, to pick out
More suitable for the reference gene of bottle gourd blade and fruit quantitative fluorescence analysis.
1, bottle gourd blade and the common reference gene stability analysis of fruit
(1) Delta Ct is analyzed
Delta Ct analysis is the result shows that in the case where CGMMV infects, and shared candidate's reference gene is steady in bottle gourd blade and fruit
Qualitative sequence are as follows: WD > TBP > GAPDH > H3 > EF1 α > L23A > CYP20 > TUA > PP2A > RAN > PRS15 > UBA52 > PRL23 > ADP
> ACT > CYP, wherein WD, TBP, GAPDH stability are relatively preferable.
(2) geNorm is analyzed
Candidate's internal reference the result shows that, is shared in the case where CGMMV infects, in bottle gourd blade and fruit using the analysis of geNorm software
Gene stability sequence are as follows: H3=GAPDH > WD > EF1 α > CYP20 > ACT7 > ADP > PP2A > TBP > RAN > TUA > L23A > PRS15
> UBA52 > PRL23 > CYP (table 3).The M value of 16 bottle gourd blades and the common internal reference candidate gene of fruit is below 1.5 (Fig. 4),
Vn/Vn+1 both less than defaults V value 0.15 (Fig. 5), meets geNorm software screening method standard, and be not required to the new reference gene of primer.
Data result shows that in the comprehensive analysis of 16 bottle gourd blades and the common internal reference candidate gene of fruit, H3, GADPH and WD are
The preferable reference gene of stability in candidate gene.
The stationary value and sequence of the geNorm blade calculated of table 3 and fruit candidate reference gene jointly
(3) NormFinder is analyzed
NormFinder analyzes the stability sequence of alternative gene are as follows: and TBP > WD > GAPDH > EF1 α > H3 > L23A > TUA >
CYP20 > RAN > PP2A > PRS15 > UBA52 > PRL23 > ADP > ACT > CYP, wherein TBP and WD is 16 bottle gourd candidate's internal reference bases
Because of most stable of (Fig. 6).
Further, bottle gourd blade and fruit sample are divided into normal healthy controls and CGMMV infects two groups of progress
NormFinder analysis, data result show: in 16 bottle gourd blades and the common internal reference candidate gene of fruit, UBA52 has
Minimum between-group variation, TBP have variation in minimum group；TBP is most stable of reference gene in candidate gene
(stability value value is 0.079)；Meanwhile WD and TBP can be used as two optimal combined reference genes, have minimum
Group between and most interior combination variation；CYP is most unstable reference gene.
(4) RefFinder is analyzed
The stability of the alternative gene of RefFinder software integrated-analysis: WD > GAPDH > H3 > TBP > EF1 α > ACT > CYP20 >
ADP > L23A > PP2A > TUA > RAN > PRS15 > UBA52 > PRL23 > CYP, wherein WD, GAPDH and H3 are relatively most stable.
For the above analysis as a result, preferred reference gene is WD and H3 in above-mentioned 16 genes, next is common interior
Join gene GAPDH, can be used as bottle gourd blade and the common reference gene of fruit.
2, CGMMV infects front and back bottle gourd blade reference gene stability analysis
(1) Delta Ct is analyzed
The result shows that in the case where CGMMV infects, bottle gourd blade candidate's reference gene stability sorts for Delta Ct analysis are as follows:
CYP>H3>PP2A>TBP>P4HB>STK>TPT>WD>ARL>RBP>SHAGGY>ADP>CNX>PRS15>UBC>GAD>EF1α>
PRL23, wherein CYP, H3, PP2A stability are relatively preferable.
(2) geNorm is analyzed
Using the analysis of geNorm software, the result shows that, in the case where CGMMV infects, bottle gourd blade candidate's reference gene stability is arranged
Sequence are as follows: CYP=TBP > H3 > WD > ARL > PP2A > STK > SHAGGY > ADP > P4HB > TPT > RBP > UBC > GAD > CNX > PRS15 >
EF1 α > PRL23 (table 4).The M value of 18 bottle gourd blade internal reference candidate genes is below 1.5 (Fig. 7), and Vn/Vn+1 both less than defaults
V value 0.15 (Fig. 8) meets geNorm software screening method standard, and is not required to the new reference gene of primer.Data result shows 18
In the comprehensive analysis of a bottle gourd blade and the common internal reference candidate gene of fruit, wherein TBP, CYP, H3 are most stable in candidate gene
Reference gene.
The stationary value and sequence for blade candidate's reference gene that the geNorm of table 4 is calculated
(3) NormFinder is analyzed
Bottle gourd leaf sample is divided into normal healthy controls and CGMMV infects two groups of carry out NormFinder analyses, data result
Show that NormFinder analyzes the stability sequence of alternative gene are as follows: CYP > H3 > PP2A > TBP > P4HB > STK > RBP > TPT > ARL
> WD > SHAGGY > ADP > CNX=PRS15 > EF1 α > UBC > GAD > PRL23, in 18 bottle gourd blade internal reference candidate genes, H3
With minimum between-group variation, CYP has variation in minimum group；CYP is most stable of reference gene in candidate gene
(stability value value is 0.106), wherein CYP, H3 and PP2A are that 18 bottle gourd blade candidate's reference genes are most stable
, RPL23 is most unstable reference gene (Fig. 9).
(4) RefFinder is analyzed
The stability of the alternative gene of blade is screened in the case of RefFinder software integrated-analysis CGMMV infects in transcript profile
Ranking are as follows: CYP > H3 > TBP > PP2A > STK > ARL > WD > P4BH > UBC > SHAGGY > TPT > GAD > ADP > RBP > CNX > PRS15 >
EF1 α > PRL23, wherein CYP, H3 and TBP are relatively most stable.
The above analysis as a result, CGMMV infect it is most suitable for CYP in 18 reference genes of bottle gourd blade candidate,
It secondly is H3 and TBP.
3, full-length genome screening CGMMV infects front and back bottle gourd fruit reference gene
(1) Delta Ct is analyzed
The result shows that in the case where CGMMV infects, bottle gourd fruit candidate's reference gene stability sorts for Delta Ct analysis are as follows:
P4H>TBP>XRN1>ADP>VAMP>H3>ISCU>HD>RARP>WD>EIF5AL1>BTB/POZ>CBRLK>PP2A>clpC>
GAPDH > TUA > PLA, wherein P4H, TBP, XRN1 stability are relatively preferable.
(2) geNorm is analyzed
Candidate's reference gene the result shows that, it is steady to be shared in the case where CGMMV infects, in bottle gourd fruit using the analysis of geNorm software
Qualitative sequence are as follows: P4H=VAMP > TBP > ADP > HD > XRN1 > EIF5AL1 > ISCU > H3 > BTB/POZ > WD > PARP > CBRLK >
PP2A > clpC > GAPDH > TUA > PLA (table 5).The M value of 18 bottle gourd blade internal reference candidate genes is below 1.5 (Figure 10), Vn/
Vn+1 both less than defaults V value 0.15 (Figure 11), meets geNorm software screening method standard, and be not required to the new reference gene of primer.Number
According to the result shows that, in the comprehensive analysis of 18 bottle gourd blades and the common internal reference candidate gene of fruit, wherein P4H, VAMP, TBP
For reference gene most stable of in candidate gene.
The stationary value and sequence for fruit candidate's reference gene that the geNorm of table 5 is calculated
| Stability sequence | Gene Name | Stationary value (M) |
| 1 | LsP4H | 0.212 |
| 2 | LsVAMP | 0.212 |
| 3 | LsTBP | 0.245 |
| 4 | LsADP | 0.266 |
| 5 | LsHD | 0.284 |
| 6 | LsXRN1 | 0.304 |
| 7 | LsEIF5AL1 | 0.337 |
| 8 | LsISCU | 0.354 |
| 9 | LsH3 | 0.371 |
| 10 | LsBTB/POZ | 0.389 |
| 11 | LsWD | 0.402 |
| 12 | LsPARP | 0.415 |
| 13 | LsCBRLK | 0.427 |
| 14 | LsPP2A | 0.439 |
| 15 | LsclpC | 0.454 |
| 16 | LsGAPDH | 0.474 |
| 17 | LsTUA | 0.494 |
| 18 | LsPLA | 0.531 |
(3) NormFinder is analyzed
NormFinder analyzes the stability sequence of alternative gene are as follows: TBP > P4H > XRN1 > ADP > VAMP > H3 > ISCU > WD
=HD > CBRLK > PARP > EIF5AL1 > clpC > BTB/POZ > PP2A > TUA > GAPDH > PLA, wherein TBP, P4H and XRN1 are 18
A bottle gourd fruit candidate's reference gene is most stable of (Figure 12).
(4) RefFinder is analyzed
RefFinder software integrated-analysis CGMMV infects the stability ranking of alternative gene in the bottle gourd fruit of front and back: P4H >
ADP>TBP>VAMP>XRN1>H3>EIF5AL1>HD>ISCU>WD>CBRLK>PARP>BTB/POZ>PLA>PP2A>clpC>
GAPDH > TUA, wherein P4H, ADP and TBP are relatively most stable.
6 cucumber green mottle mosaic virus of embodiment infects lower bottle gourd blade or fruit qRT-PCR analysis with reference to gene LsIPT
Or the expression of LsDdRP
According to above-mentioned analysis, we are LsTBP, LsWD, the LsH3 in the top to stability in blade and fruit,
LsGAPDH and LsCYP gene, and express stable LsP4H gene in fruit and judged, it verifies it and is infected in CGMMV
Stability in the bottle gourd of front and back.
Reference gene of the LsIPT and LsDdRP as verifying reference gene stability is chosen respectively.LsIPT gene primer
Nucleotide sequence is as follows, and specifically, forward primer sequence is GCACTCCAATGGCTCGTTTA, and reverse primer sequences are
GGTCGATGGTGGATTTGTCG；The nucleotide sequence of LsDdRP gene primer is as follows, and specifically, forward primer sequence is
AAACTCCCTTTCAGCCTCGA, reverse primer sequences AGATGTGGCCCTGTTGAGAA.
Method in accordance with the above-mentioned embodiment 1 carries out the separation of total serum IgE, the synthesis of the first chain cDNA.QRT-PCR analysis is pressed
Carry out according to 4 the method for above-described embodiment, reaction system: 2 × SYBR Green Master Mix, 5 μ L, upstream and downstream, which detects, draws
Object (refers to gene: LsIPT or LsDdRP；Reference gene: LsTBP, LsWD, LsH3, LsGAPDH, LsCYP or LsP4H) it is each
0.15 0.5 μ L, RNase Free dH of μ L, cDNA2O3.9μL.Response procedures are as follows: 95 DEG C of initial denaturation 5min；95 DEG C of denaturation
15sec, 58 DEG C of annealing 15sec, totally 40 recycle.
Transcript profile data analysis shows, relative to normal healthy controls, LsIPT is expressed in blade in the bottle gourd that CGMMV infects
Level has raised 1.78 times, and 1.2 times have been lowered in fruit.And LsDdRP has raised 1.4 times in blade, raises in fruit
1.63 times.
In blade, when using LsWD as blade reference gene, LsIPT increases 2.75 times relative to control, with
When LsGAPDH, LsH3, LsCYP and LsTBP are reference gene, LsIPT has increased separately 2.95,3.82 relative to control,
3.93,4.43 again.In fruit, with LsTBP, LsWD, LsH3, LsGAPDH, LsCYP and LsP4H for reference gene, to LsIPT
Expression quantity homogenization after detected, find its relative to control decline 0.54,0.52,0.60,0.57,0.59,0.56 times
(Figure 13).And in blade, respectively with LsWD, LsGAPDH, LsH3, LsCYP and LsTBP are internal reference, detect the table of LsDdRP
It reaches, the results showed that, it has raised 1.78,1.95,2.51,2.57 and 2.88 times (Figure 13) relative to control respectively after homogenization.
In fruit, respectively with LsWD, LsTBP, LsH3, LsGAPDH, LsP4H and LsCYP for internal reference, LsDdRP is detected
Expression, the results showed that, after homogenization its relative to control raised 1.42,1.53,1.60,1.62,1.80 Hes respectively
2.31 times (Figure 13).QRT-PCR analysis the result shows that being become with the result and transcript profile data of these candidate gene quantitative analyses
Gesture is consistent.
Compare homogenization expression and transcript profile data and quantitative fluorescent PCR as a result, analysis shows LsWD,
LsGAPDH and LsH3 is suitable as CGMMV and infects the blade of bottle gourd and the common reference gene of fruit.LsCYP, LsH3 and
LsTBP is suitable as the reference gene that CGMMV infects bottle gourd blade, and LsP4H, LsADP and LsTBP are suitable as CGMMV and infect
The reference gene of bottle gourd fruit.
Sequence table
<110>Zhejiang Academy of Agricultural Science
<120>LsH3 infects the purposes in lower bottle gourd analysis as reference gene in cucumber green mottle mosaic virus
<130> 18-100070-00004990
<141> 2018-05-04
<160> 80
<170> SIPOSequenceListing 1.0
<210> 1
<211> 101
<212> DNA
<213>bottle gourd (Lagenaria siceraria)
<400> 1
caaactgccc gtaagtccac cggaggaaag gctccaagga agcagctggc cacaaaggct 60
gctcgtaagt ctgccccaac cacaggagga gtgaagaagc c 101
<210> 2
<211> 95
<212> DNA
<213>bottle gourd (Lagenaria siceraria)
<400> 2
tctgtggtac tcgagaaggc taccatatgt tcgatcccat actccaatga aaagtgattc 60
tgtgtctgga ctaaacgaca caccggagat ttctc 95
<210> 3
<211> 20
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 3
caaactgccc gtaagtccac 20
<210> 4
<211> 20
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 4
ggcttcttca ctcctcctgt 20
<210> 5
<211> 20
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 5
tctgtggtac tcgagaaggc 20
<210> 6
<211> 21
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 6
gagaaatctc cggtgtgtcg t 21
<210> 7
<211> 20
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 7
ctgttgcaga gggaactata 20
<210> 8
<211> 20
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 8
gctgaaatag gaactttgtc 20
<210> 9
<211> 20
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 9
ggcagtggtt gtgaacatgt 20
<210> 10
<211> 20
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 10
cccatgctat cctccgtctt 20
<210> 11
<211> 20
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 11
aagtgtggac acagcaacca 20
<210> 12
<211> 20
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 12
gggaaagagc caaaaatagg 20
<210> 13
<211> 22
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 13
catgaccata tcaccaacac aa 22
<210> 14
<211> 21
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 14
cgacaataca ggagctaaga a 21
<210> 15
<211> 20
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 15
tctactgttg ggataccgct 20
<210> 16
<211> 21
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 16
cagagatcac gatgccatgt t 21
<210> 17
<211> 23
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 17
ggcagataac tcaagtttat gga 23
<210> 18
<211> 27
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 18
gctgtaagag gtaaataatc aaagagg 27
<210> 19
<211> 20
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 19
cccaggggat atctgcaggg 20
<210> 20
<211> 22
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 20
catggtgttt tcaatggaac ca 22
<210> 21
<211> 20
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 21
ctgcttgctc ctgcgtgaaa 20
<210> 22
<211> 25
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 22
ccacgatgtt gatgtgaatc ttctc 25
<210> 23
<211> 21
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 23
atattgccaa caaggcgtag a 21
<210> 24
<211> 21
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 24
tgcccgtaaa caatggacaa a 21
<210> 25
<211> 20
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 25
aggactggga cgtaccgaca 20
<210> 26
<211> 20
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 26
cggctaattt tcgcactcgg 20
<210> 27
<211> 20
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 27
aaactcttcc cgcttcctca 20
<210> 28
<211> 20
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 28
agccttgatc tgccattcct 20
<210> 29
<211> 20
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 29
agtcctcttc ttcggcactc 20
<210> 30
<211> 20
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 30
tccactcgaa accctagcag 20
<210> 31
<211> 20
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 31
tttaccctcg gcgatggaag 20
<210> 32
<211> 21
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 32
tgtgaaccat ttgtatctgg a 21
<210> 33
<211> 20
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 33
cacaccggcc ctggtatttt 20
<210> 34
<211> 20
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 34
catccatgcc ttcaacgact 20
<210> 35
<211> 22
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 35
aaggatgccg tgaagaagat gt 22
<210> 36
<211> 22
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 36
gcatcgtagt caggagtcaa cc 22
<210> 37
<211> 20
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 37
gcactccaat ggctcgttta 20
<210> 39
<211> 20
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 39
ggtcgatggt ggatttgtcg 20
<210> 39
<211> 20
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 39
aaactccctt tcagcctcga 20
<210> 40
<211> 20
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 40
agatgtggcc ctgttgagaa 20
<210> 41
<211> 20
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 41
gctggtcgaa agttgactcc 20
<210> 42
<211> 21
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 42
gtcaaggcca aagagtaggc a 21
<210> 43
<211> 21
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 43
accacctacg attggcagaa g 21
<210> 44
<211> 21
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 44
gtctgggaaa agtggcggta t 21
<210> 45
<211> 21
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 45
ttgaccacta cccatcttgc a 21
<210> 46
<211> 20
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 46
gcgagcctca tcctcactaa 20
<210> 47
<211> 20
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 47
tcgctctctc atcccaatcc 20
<210> 48
<211> 21
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 48
gtgcgcattc tcattgatgg g 21
<210> 49
<211> 21
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 49
aggcccactt tgcttcttca a 21
<210> 50
<211> 21
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 50
gagcagtcat gaccctccaa t 21
<210> 51
<211> 21
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 51
cttgcttcac gtctgcttca a 21
<210> 52
<211> 21
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 52
gttgttaggg aggcggacat t 21
<210> 53
<211> 20
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 53
cacttggtgc ttcgtctcag 20
<210> 54
<211> 20
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 54
tcgatcgtgt cagagctctc 20
<210> 55
<211> 21
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 55
tgtcataggg cttgccttca g 21
<210> 56
<211> 20
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 56
cattgggtga tgctgagacg 20
<210> 57
<211> 22
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 57
tacatcttca agttgcctgc gt 22
<210> 58
<211> 20
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 58
ccagaagtgt accgggttct 20
<210> 59
<211> 21
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 59
ctccccaatg caaaagctga c 21
<210> 60
<211> 21
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 60
gaggtgctgt tcgaccctta a 21
<210> 61
<211> 20
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 61
agagagagag aggccttgga 20
<210> 62
<211> 21
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 62
cctgtgtttc gccatggaaa c 21
<210> 63
<211> 20
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 63
accttccaga tcacaccagg 20
<210> 64
<211> 20
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 64
aggcctcaca gttcctcttc 20
<210> 65
<211> 20
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 65
ttggagtctt cagggagctg 20
<210> 66
<211> 20
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 66
tcctcttgaa cgtggggtac 20
<210> 67
<211> 21
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 67
atggcgaaaa gagaaacggt g 21
<210> 68
<211> 20
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 68
gaaggatcat gtgacgcgtc 20
<210> 69
<211> 20
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 69
gcagccaata gtctcagcac 20
<210> 70
<211> 21
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 70
gtagttcaaa gtggagggcg t 21
<210> 71
<211> 21
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 71
aaccttcgat ctcaggcaca a 21
<210> 72
<211> 21
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 72
cgccgcagac agacaaaatg a 21
<210> 73
<211> 20
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 73
cgaatgggac tctgctttgg 20
<210> 74
<211> 21
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 74
tattccgacg aaatccatcc g 21
<210> 75
<211> 21
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 75
atggcagctt cttcgtcttc c 21
<210> 76
<211> 21
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 76
tggcgctgtt gaagaagttg t 21
<210> 77
<211> 22
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 77
tgtggatgtt gattctgatg ga 22
<210> 78
<211> 23
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 78
acaggttaca caggaatagc atc 23
<210> 79
<211> 21
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 79
accgactgtc cctttcactt g 21
<210> 80
<211> 22
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 80
gtggcggatt ttggatttgc aa 22
Claims (3)
1.LsH3 infects in lower bottle gourd blade or fruit qRT-PCR analysis in cucumber green mottle mosaic virus as reference gene
Purposes.
2. purposes according to claim 1, it is characterised in that:
The nucleotide sequence of the reference gene LsH3 is as shown in SEQ ID No.1.
3. the side that a kind of cucumber green mottle mosaic virus infects lower bottle gourd blade or fruit qRT-PCR analysis LsIPT or LsDdRP
Method, which is characterized in that it includes the following steps:
Step 1: test sample processing
Bottle gourd seedling cultivation is kept for 20-25 DEG C of temperature, pours a water within every 3 days in greenhouse soil, in one heart stage of two leaves by cucumber
Green mottle mosaic virus disease juice frictional inoculation is in the system blade of expansion；Sick juice is by spending 100mg cucumber green mottle
The homogenate of mosaic virus susceptible tissue is formed in the PBS buffer solution of 20 times of volumes；Healthy plant use PBS buffer solution processing as pair
According to；
Randomly select bottle gourd system blade, fruit and healthy bottle gourd system blade, fruit that cucumber green mottle mosaic virus infects
It is saved backup in liquid nitrogen；
The extraction of step 2:RNA and the synthesis of cDNA
The test sample saved backup in liquid nitrogen is subjected to RNA extraction, each processing is arranged 3 secondary pollutants and repeats；It is solidifying with denaturation
Gel electrophoresis and biological analyser detection RNA mass and concentration；Reverse transcription is carried out to above-mentioned each RNA and obtains corresponding cDNA；
Step 3: the primer for referring to gene LsIPT or LsDdRP is provided, wherein
The nucleotide sequence of LsIPT primer is as follows:
Forward primer sequence: GCACTCCAATGGCTCGTTTA；
Reverse primer sequences: GGTCGATGGTGGATTTGTCG；
The nucleotide sequence of LsDdRP primer is as follows:
Forward primer sequence: AAACTCCCTTTCAGCCTCGA,
Reverse primer sequences: AGATGTGGCCCTGTTGAGAA；
The primer of reference gene LsH3 is provided, the nucleotide sequence of the LsH3 primer is as follows:
Forward primer sequence: CAAACTGCCCGTAAGTCCAC；
Reverse primer sequences: GGCTTCTTCACTCCTCCTGT；
Step 4:qRT-PCT analysis
The cDNA solution synthesized is diluted into 5 times of initial concentrations as qRT-PCR；10 μ L qRT-PCR reaction systems include 5 μ
2 × SYBR Premix Ex TaqTM solution of L, the cDNA solution of 0.5 μ L, upstream and downstream detection primer (refer to gene: LsIPT
Or LsDdRP；Reference gene LsH3) each 0.15 μ L, the RNase Free dH2O of 3.9 μ L；
Response procedures are as follows: 95 DEG C of initial denaturation 5min；95 DEG C of denaturation 15sec, 58 DEG C of annealing 15sec, 72 DEG C of extension 15sec, 40
Circulation；3 repetitions are arranged in each sample.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201810422078.0A CN110438250B (en) | 2018-05-04 | 2018-05-04 | Application of LsH3 as internal reference gene in analysis of cucumber green mottle mosaic virus infection of cucumber by using bottle gourd |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201810422078.0A CN110438250B (en) | 2018-05-04 | 2018-05-04 | Application of LsH3 as internal reference gene in analysis of cucumber green mottle mosaic virus infection of cucumber by using bottle gourd |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN110438250A true CN110438250A (en) | 2019-11-12 |
| CN110438250B CN110438250B (en) | 2022-08-30 |
Family
ID=68427239
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201810422078.0A Active CN110438250B (en) | 2018-05-04 | 2018-05-04 | Application of LsH3 as internal reference gene in analysis of cucumber green mottle mosaic virus infection of cucumber by using bottle gourd |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN110438250B (en) |
Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN104342438A (en) * | 2014-09-28 | 2015-02-11 | 华中农业大学 | Application of ClCAC gene and ClSAND gene as reference genes in analysis of gene expression of watermelon fruits |
| CN105177187A (en) * | 2015-10-14 | 2015-12-23 | 浙江大学 | Preparing method and application of sample for detecting cucumber green mottle mosaic viruses carried by cucurbitaceae seeds |
| CN105274219A (en) * | 2015-10-13 | 2016-01-27 | 华中农业大学 | Application of CL5547.Contig2 gene to pumpkin gene expression real-time fluorogenic quantitative PCR analysis as reference gene |
| CN107227340A (en) * | 2017-04-26 | 2017-10-03 | 武汉市农业科学技术研究院作物科学研究所 | Reference gene and the stability verification method of the reference gene for melon fruit gene PCR expression analysis |
-
2018
- 2018-05-04 CN CN201810422078.0A patent/CN110438250B/en active Active
Patent Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN104342438A (en) * | 2014-09-28 | 2015-02-11 | 华中农业大学 | Application of ClCAC gene and ClSAND gene as reference genes in analysis of gene expression of watermelon fruits |
| CN105274219A (en) * | 2015-10-13 | 2016-01-27 | 华中农业大学 | Application of CL5547.Contig2 gene to pumpkin gene expression real-time fluorogenic quantitative PCR analysis as reference gene |
| CN105177187A (en) * | 2015-10-14 | 2015-12-23 | 浙江大学 | Preparing method and application of sample for detecting cucumber green mottle mosaic viruses carried by cucurbitaceae seeds |
| CN107227340A (en) * | 2017-04-26 | 2017-10-03 | 武汉市农业科学技术研究院作物科学研究所 | Reference gene and the stability verification method of the reference gene for melon fruit gene PCR expression analysis |
Non-Patent Citations (3)
| Title |
|---|
| GURU JAGADEESWARAN等: "Characterization of the small RNA component of leaves and fruits from four different cucurbit species", 《BMC GENOMICS》 * |
| 孟玉平等: "枣树内参基因ZjH3的克隆与筛选", 《生物技术通报》 * |
| 黄春等: "黄瓜绿斑驳花叶病毒病症状识别与监测方法", 《农业与技术》 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN110438250B (en) | 2022-08-30 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Oh et al. | Transcriptional regulation of secondary growth in Arabidopsis thaliana | |
| Hu et al. | Evaluation of putative reference genes for gene expression normalization in soybean by quantitative real-time RT-PCR | |
| Kou et al. | Selection and validation of suitable reference genes for miRNA expression normalization by quantitative RT-PCR in citrus somatic embryogenic and adult tissues | |
| Li et al. | Screening of valid reference genes for real-time RT-PCR data normalization in Hevea brasiliensis and expression validation of a sucrose transporter gene HbSUT3 | |
| Chope et al. | Physiological, biochemical and transcriptional analysis of onion bulbs during storage | |
| Coito et al. | Microarray-based uncovering reference genes for quantitative real time PCR in grapevine under abiotic stress | |
| CN104357564A (en) | Application of CmEF1 alpha gene and CmRAN gene used as reference genes in analysis of genetic expression of Cucumis melo L. fruits | |
| Jugran et al. | Characterization of agro-diversity by seed storage protein electrophoresis: Focus on rice germplasm from Uttarakhand Himalaya, India | |
| CN113774065B (en) | Fluorescent quantitative internal reference gene for different adults of fall webworm, primer and application thereof | |
| Wang et al. | Screening for quantitative real-time PCR reference genes with high stable expression using the mRNA-sequencing data for pear | |
| CN103937790A (en) | Molecular marker closely related with glucosinolate content in rape seeds and application | |
| Yamashita et al. | Relationship between development of compression wood and gene expression | |
| CN105483136A (en) | wheat pre-harvest sprouting tolerance gene TaZFP18 and application thereof | |
| CN110438250A (en) | LsH3 infects the purposes in lower bottle gourd analysis as reference gene in cucumber green mottle mosaic virus | |
| CN110438257A (en) | LsWD infects the purposes in lower bottle gourd analysis as reference gene in cucumber green mottle mosaic virus | |
| CN113151505B (en) | Fluorescent quantitative reference gene for different population densities of fall webworms and primers and application thereof | |
| CN106754965B (en) | One kind reference gene relevant to poplar adversity gene expression regulation and its application | |
| CN114457187B (en) | Screening method and application of reference genes in plum blossom real-time fluorescent quantitative PCR analysis | |
| CN110393149A (en) | A kind of method and its application of regulation tamato fruit ascorbic acid content | |
| CN109609512A (en) | Application of the iris PP2A gene as reference gene | |
| CN107893129A (en) | The method for detecting apple green wrinkle fruit disease poison | |
| CN105087582A (en) | Mutation site of UBXN1 [UBX (ultrabithorax) domain-containing protein 1] gene promoter region and application of mutation site to detecting water-holding capacity of pork | |
| Baharuddin et al. | Morphological changes analysis of rice cv. IR64 under drought stress | |
| CN110283933A (en) | The fluorescent quantitation reference gene and its primer of siberian wildrye different tissues and application | |
| KR102081586B1 (en) | Housekeeping gene of onion, and method for separating the same |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |