CN110393149A - A kind of method and its application of regulation tamato fruit ascorbic acid content - Google Patents
A kind of method and its application of regulation tamato fruit ascorbic acid content Download PDFInfo
- Publication number
- CN110393149A CN110393149A CN201910717419.1A CN201910717419A CN110393149A CN 110393149 A CN110393149 A CN 110393149A CN 201910717419 A CN201910717419 A CN 201910717419A CN 110393149 A CN110393149 A CN 110393149A
- Authority
- CN
- China
- Prior art keywords
- tomato
- ascorbic acid
- regulation
- acid content
- asa
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Classifications
-
- A—HUMAN NECESSITIES
- A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
- A01H—NEW PLANTS OR NON-TRANSGENIC PROCESSES FOR OBTAINING THEM; PLANT REPRODUCTION BY TISSUE CULTURE TECHNIQUES
- A01H3/00—Processes for modifying phenotypes, e.g. symbiosis with bacteria
- A01H3/04—Processes for modifying phenotypes, e.g. symbiosis with bacteria by treatment with chemicals
Landscapes
- Life Sciences & Earth Sciences (AREA)
- Chemical & Material Sciences (AREA)
- Chemical Kinetics & Catalysis (AREA)
- General Chemical & Material Sciences (AREA)
- Botany (AREA)
- Developmental Biology & Embryology (AREA)
- Environmental Sciences (AREA)
- Breeding Of Plants And Reproduction By Means Of Culturing (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention belongs to field of biotechnology more particularly to a kind of method and its application of regulation tamato fruit ascorbic acid content.The research of the invention finds that, the content of ascorbic acid in tomato can be significantly improved using methyltransferase inhibitors processing tomato tissue, start with simultaneously from the key gene in the identified AsA approach in laboratory, the influence by the technique study of bioinformatics and molecular biology Regulation by Methylation to AsA content in tomato.The present invention provides a kind of methods of ascorbic acid content in new regulation tomato, and this method is easy to operate, and cost is relatively low, and technology is easy to spread, and technical effect is preferable, can significantly improve the content of ascorbic acid in tomato.
Description
Technical field
The invention belongs to field of biotechnology more particularly to it is a kind of regulate and control tamato fruit ascorbic acid content method and its
Using.
Background technique
Tomato (Solanum lycopersicum) is model plant important in gardening research, rich in anti-bad
The nutritional ingredients such as hematic acid (AsA).Ascorbic acid (L-ascorbate acid, AsA) is also known as vitamin C, is a kind of extremely strong anti-
One of the most abundant water-soluble low molecular weight antioxidant in oxidation material and plant cell, it is raw to cellular activity and plant
Length is played a positive role, and AsA provides electronics by redox reaction, has oxidation resistant function, and plant is helped to cope with adverse circumstance.
Confactor of the AsA as relevant enzyme in plant growth and development process, is important growth regulator.AsA is to the protection mankind
Health also play very important effect.It can remove the free radical that cancer and aging are induced in human body, can increase in blood
The concentration of antibody enhances the immunocompetence of human body, can enhance blood vessel tissue, reduce Blood Cholesterol content, prevention and
Arteriosclerotic cardiovascular disease and hypertension, apoplexy etc. are treated, the formation of collagen is can promote, makes skin-tightening, bone
Tooth is firm, promotes wound healing etc..
Since mankind itself has lost the ability of synthesis ascorbic acid, can only be supplemented by diet, fresh water
Fruit and vegetables are that the mankind obtain the most important source of ascorbic acid.AsA protects plant tissue from active oxygen ROS's in plant
Injury, and it is dirty resisting pathogen infection, insect infestations, Qiang Guang, temperature stress, water stress, salt stress, UV-B and environment
It plays an important role in dye.AsA is also the cofactors of some enzymes, participates in the regeneration of vitamin E.AsA also participates in adjusting many bases
This cytology process, as photosynthesis, light protection, stomatal movement, plant growth and development and bloom, cell cycle, cell it is swollen
Greatly, apoptosis and aging etc..Therefore the content for improving AsA in plant origin food can not only improve its nutriment
The resistance of environment stress also can be enhanced in matter.
Publication No. is that the Chinese invention patent of CN109337923A is disclosed through multiple gene polymerization raising Tomato Quality group
Divide the method for Vitamin C content, which is a patent of invention of the inventor in preceding application, by synthesizing ascorbic acid
The overexpression transgenosis system of four key structure genes in approach D-MANNOSE/L- galactolipin approach carries out hybridization polymerization,
Make to polymerize ascorbic acid content and transhipment in plant raising tamato fruit and blade.
Publication No. is that the Chinese invention patent of CN106497947A discloses a kind of tomato ascorbic acid synthesis gene SLGPP
And its application, gene GPP is synthesized by ascorbic acid in overexpression tomato, improves ascorbic acid content in tomato.
But including above two patents in the prior art, the method for raising tomato ascorbic acid content is mostly
By gene cloning, the gene means of carrier construction obtain new tomato plant, to obtain kind of ascorbic acid content raising
Eggplant.This technical operation is more complex, at high cost, is unfavorable for promoting and applying between common farmer.
Summary of the invention
In view of the problems of the existing technology, the present invention provides a kind of methods of regulation tamato fruit ascorbic acid content
And its application.
The invention is realized in this way a method of regulation tamato fruit ascorbic acid content, the method includes making
Tomato tissue is handled with methyltransferase inhibitors.
Further, the tomato tissue includes tomato seedling or tomato strain.
Further, the methyltransferase inhibitors are 5-azacitidine.
Further, method tomato seedling handled are as follows: be added to the 5-azacitidine aqueous solution of 50 μ L 1mM
In common inoculation medium, seed is placed on inoculation medium and is grown.
Further, to the processing method of tomato strain be by the 5-azacitidine aqueous solution of 50 μ L 1mM when tomato blooms
Phase injects at anthocaulus.
Further, the regulation method shows as GalUR-5 gene in methyltransferase inhibitors regulation tomato tissue
Expression, the GalUR-5 gene order is as shown in SEQ ID NO.1.
A kind of method of regulation tamato fruit ascorbic acid content as described above is in regulation tomato ascorbic acid content
Application.
In conclusion advantages of the present invention and good effect are as follows:
The present invention provides a kind of methods of ascorbic acid content in new regulation tomato, and this method is easy to operate, at
This is lower, and technology is easy to spread, and technical effect is preferable, can significantly improve the content of ascorbic acid in tomato.
The present invention handles tomato by methyltransferase inhibitors and changes its own DNA methylation level, analyzes Vitamin C
Acid synthesis is influenced by DNA methylation regulation.CRISPR based on SlMET1 and SlDML2 gene knocks out material, passes through apparent group
The influence accumulated with the methylation of transcription group researching DNA to tomato ascorbic acid is learned, is pressed down in conjunction with group credit analysis and transmethylase
Preparation processing test determine ascorbic acid approach in by DNA methylation regulate and control key gene, inquired into DNA methylation to kind
The regulatory mechanism of eggplant ascorbic acid dynamic accumulation.
Detailed description of the invention
Fig. 1 is the percentage of seedgermination under 5-azaC processing；
Fig. 2 is the variation of total AsA content in seedling leaves after 5-azaC is handled；
Fig. 3 is the variation for restoring AsA content after 5-azaC is handled in seedling leaves；
Fig. 4 is the variation of tamato fruit difference mature period after 5-azaC processing；
Fig. 5 is the influence that 5-azaC handles AsA total to tomato；
Fig. 6 is influence of the 5-azaC processing to tomato reduction AsA；
Fig. 7 is that AsA anabolism gene changes in ripening of fruits；
Fig. 8 is influence of itself DNA methylation to AsA gene during Fruit development；
Fig. 9 is that the gene expression of tomato leaf GalUR-5 is influenced by 5-azaC；
Figure 10 is the gene expression of GalUR-5 in fruit；
Figure 11 is methylation variation of the GalUR-5 in SlDML2CRISPR mutant；
Figure 12 is that GalUR-5 methylates variation in SlMET1 mutant；
Figure 13 is the DNA methylation detection of GalUR-5；
Figure 14 is GalUR enzyme activity analysis in methyltransferase inhibitors processing rear blade；
Figure 15 is the enzyme activity of GalUR in methyltransferase inhibitors processing after ripening fruit；
Figure 16 is the enzyme activity determination of tomato GalUR-5 prokaryotic expression protein；
Figure 17 is GalUR evolutionary analysis；
Figure 18 is the prediction of GalUR-5 Protein secondary structure；
Figure 19 is GalUR-5 expression quantity in tomato AC different tissues.
Specific embodiment
In order to make the objectives, technical solutions, and advantages of the present invention clearer, with reference to embodiments to the present invention
It is further elaborated, equipment used in each embodiment and test example and reagent unless otherwise specified, can be from business
Approach obtains.Described herein specific examples are only used to explain the present invention, is not intended to limit the present invention.
The present invention discloses a kind of method and its application of regulation tamato fruit ascorbic acid content, each implementations specific as follows
Shown in example.
Involved plant material in the present invention: tomato routine strain Ailsa Craig (AC), the tomato material have complete
Full-length genome methylation sequencing data and transcript profile sequencing data.Methyltransferase inhibitors (5-azacitidine, 5-azaC)
AC is handled to study for Regulation by Methylation.
Involved gene sequence data source in the present invention: original sequence data: SRA046092, SRA046132,
SRA046131, SRA053345 and SRA046480.Tomato apparent gene group database (http: //
Ted.bti.cornell.edu/epigenome/) for access analysis.In the gene expression integrated database Gene of NCBI
In Expression Omnibus, it can be accessed by GEO series accession number GSE94903.The data set of generation can be in NCBI gene
It expresses integrated database Gene Expression Omnibus and obtains (GEO:http: //www.ncbi.nlm.nih.gov/
geo/)；Data entry number is GSE102273.
The methylation of 1 tomato seedling of embodiment and strain is handled
1. the methylation of tomato seedling is handled
The 5-azacitidine aqueous solution of 50 μ L 1mM is added to common inoculation medium, and (culture medium is the 1/ of standard
2MS culture medium prescription obtains MS culture medium prescription according to document Murashige and Skoog, 1962) in；Control group is by 50 μ L's
H2O is added in the identical inoculation medium of equivalent, is repeated 3 times.Seed is placed on inoculation medium to grow, every other week
Take the blade of plant, continuous sampling surrounding.The blade of taking-up is put into of short duration preservation in liquid nitrogen, if long-term preservation is put into -80 DEG C of ice
Case.
2. the methylation of tomato strain is handled
By the 5-azaC aqueous solution of 50 μ L 1mM at tomato flowering period injection anthocaulus, primary, 50 μ of control are only injected
L H2O processing, and mark and date.
As a result: respectively with water and methyltransferase inhibitors (5-azaC) processing tomato AC seed and fruit flowering period
Bennet, the sprouting of seed and reaching maturity for fruit after observation processing.The result shows that the percentage of seedgermination of 5-azaC processing reaches
95%, and only 72% germination percentage is compareed, as shown in Figure 1.AsA total in seedling leaves and reduction AsA content are examined
It surveys, as a result as shown in Figures 2 and 3, AsA content increases compared to the control group in 5-azaC treated seedling leaves, special
When not being surrounding after handling, AsA content decreases before comparing in control group, and in 5-azaC processing group, either always
AsA still restores AsA content, there is higher promotion than before, handles total ascorbic acid after seed 4th week by compareing
398.8 μ g/g rise to that treated 558.0 μ g/g, rising scale is up to 39.9%, and reduction-state ascorbic acid is by 390.3 μ g/g
Rise to 519.5 μ g/g.38 days after handling fruit, total ascorbic acid content rises to that treated by compareing 154.2 μ g/g
222.7 μ g/g are improved up to 44.4%.Processing 14 days reduction-state ascorbic acid contents of fruit are risen to by the 94.9 μ g/g compareed
154.9 μ g/g after reason improves ratio up to 63.2%.
The mature period of comparative experiments group and control group fruit, as a result as shown in figure 4, treated, fruit about does sth. in advance 5d
It is mature.
Involved germination percentage in the present embodiment, AsA detection method is as follows in blade and fruit: germination percentage statistics: by 25ml
50 μ L 1mM5- azacytidines are added in MS film solid media.100 tomato seeds are sowed on solid medium, are counted weekly
Chitting piece quantity.Germination percentage=chitting piece number/100 × 100%.Method carries out (Liu's root in AsA measuring method reference literature
Loyalty etc., 2017, gardening journal).
2 AsA approach bioinformatics of embodiment and molecular biological analysis
Based on the result of study of embodiment 1, the present invention is analyzed from gene level, explores Regulation by Methylation in tomato
The influence of AsA content.Specific experiment operation is as follows:
Bioinformatic analysis: analysis process (Lang et al 2017): In is carried out according to the method for forefathers' description
Low quality sequence (q < 20) (Harris et al 2012) is rejected using trim in BRAT-BW, will be rejected using BRAT-BW low
Reading after qualitative data is mapped to reference to genome, allow two mismatch, with reference to genome version be SL2.50 (ftp: //
ftp.solgenomics.net/tomato genome/assembly/build_2.50/；Consortium 2012).It uses
Possible PCR repeat amplification protcol is deleted in the remove-dupl order of BRAT-BW.
Utilize weighting methylation level algorithm evaluation methylation level (the Schultz et al of the propositions such as Schultz
2012).If there are 3 sites CHH in some section: first site has 10 readings 3 to be methylated；Second 5, site
There is 1 to be methylated in reading；The reading of 5, third site is not methylated.So methylation level of CHH is calculated as (3+1
+ 0)/(10+5+5)=20%.It uses Bioconductor packet: the program (Zab et al 2017) being called to carry out the mirror of DMB
It is fixed.For each context, computeDMRs function uses parameter method=bins in DMRcallerlibrary,
BinSize=100, test=score, pValueThreshold=0.01, minCytosinesCount=4, minGap=
200, minSize=50, minReadsPerCytosine=4.The minimum scale difference value of CG, CHG and CHH are 0.4,0.4 He
0.2。
The analysis of mRNA seq data: it for RNA-seq data processing, is checked on the quality control (www.bioi using FastQC
Nformatics.babraham.ac.uk/projects/fastqc the TopHat2 for) using parameter b2 option, uses genome
(Kim et al 2013) ITAG2.4 annotates gff3 file, and the parameter of TopHat2 is G option.Program featureCounts
(Liao et al 2014) is used to calculate the positioning segment of each gene.The p parameter is set as calculating segment rather than reading.
Input (Robinson et al 2010) of the output count table as edgeR is used.It is used in edgeR
EstimateCommonDisp, estimateTagwiseDisp and exactTest default analysis parameter.The gene of differential expression
(DEG) it is determined according to having multiple variation>2 and FDR<0.01 or multiple variation>1 and FDR<0.05.
As a result:
By genes such as inventor laboratory identified GMP, GME (in the China that publication No. is CN109337923A
Disclosed in patent of invention) it is compared by the method for bioinformatics, homologous gene is found, and find it by consulting literatures
His AsA approach related gene, is obtained 61 AsA anabolism related genes.As shown in Figure 7 and Figure 8.It is sent out based on tomato difference
It educates stage of ripeness RNA-seq data and expression analysis is carried out to AsA related gene, the results showed that, AC 17d after spending has more than 18
Gene is significantly expressed, and AC 42d after spending has more than 14 genes and significantly expresses.Analyze AsA related gene first in maturation
Baseization is horizontal, the results showed that, be largely the DNA methylation of CG type, during Fruit development, gene coding region and
Promoter region is more vulnerable to Regulation by Methylation relative to downstream of gene.
According to method disclosed in Solanaceae genome database (https: //solgenomics.net/search/locus)
Obtain SlDML2 and SlMET1 gene order.The gene order of SlDML2 is Solyc10g083630, the gene order of SlMET1
For Solyc01g006100.By CRISPR technology by SlDML2 and SlMET1 gene knockout, gene knockout material is obtained.Tomato
Method disclosed in CRISPR technology reference literature obtains (Li et al., 2018, Nature Biotechnology36:1160-
1163).Data based on transcript profile analyze AsA related gene in the CRISPR material of tomato dna SlDML2 and SlMET1
Changing rule, as a result such as following table 1- table 4.
The AsA related gene of up-regulated expression in table 1.SlMET1 mutant
The AsA related gene of expression is lowered in table 2.SlMET1 mutant
The AsA related gene of up-regulated expression in table 3.SlDML2 mutant
The AsA related gene of expression is lowered in table 4.SlDML2 mutant
The result shows that being had 5 by the gene of Regulation by Methylation jointly in the tomato CRISPR material of SlDML2 and SlMET1
It is a, it is GR-1, GalUR-5, GME-1, AO-1 and APX-7 respectively, is shown in Table 5 in detail.
The AsA dependency basis regulated and controled jointly in 5. tomato of table by dnmt rna SlMET1 and demethylase SlDML2
Cause
The methylation level for further analyzing AsA related gene in above-mentioned material, identifies in AsA synthesis related gene
GalUR-5 gene is significantly by epigenetic regulation.GalUR-5 gene order according to Solanaceae genome database (https: //
Solgenomics.net/search/locus method disclosed in) obtains, and GalUR-5 gene order number is
Solyc09g097960.2。
Expression analysis is carried out to GalUR-5 in 5-azaC treated plant leaf and fruit, as a result such as Fig. 9 and Figure 10 institute
Show.It was found that the equal up-regulated expression of GalUR-5 gene in blade and fruit.Gene expression amount passes through RNA sequencing approach, and with RPKM
Indicate gene expression dose.RNA-seq method by open source literature obtain (Ye et al., 2015, PLoS One.10 (7):
e0130885).It is measured using the methylation level that digestion PCR method carries out GalUR-5.
Methylation detecting method in the present embodiment: McrBC-PCR is one of method of DNA methylation assay, and McrBC can be cut
The DNA for cutting cytosine methylation does not work to the sequence of non-methylation, can be used to detect the methylation variation water on DNA
It is flat.
1. high quality DNA Sample extraction (it is reported referring to open source literature: Liu Genzhong etc., gardening journal, 2017,44 (1):
120–130.)
2. taking 2 μ g DNA to be divided to is two parts according to reaction system, portion, which is used as, to be compareed, a McrBC that 20U is added, 37 DEG C
Digestion 6h, then 65 DEG C of incubation 20min, make enzyme denaturation.Reaction system is as follows:
3. carrying out PCR, the DNA methyl of test sample by template of the DNA after digestion in purpose site both ends design primer
Change level, different genes are expanded using after the DNA of digestion as control.
Agarose gel electrophoresis is carried out after the completion of 4.PCR, DNA methylation degree is analyzed by amplified band power.
PCR reaction system is 20 μ L:10 × PCR Buffer, 2.0 μ L, 10mM dNTPs, 0.4 μ L, 10mM primer, 0.4 μ
0.1 μ L, 20ng/ μ L DNA profiling of L, 5U/ μ L Taq enzyme 1.0 μ L, ddH2O 15.7μL.PCR response procedures are as follows: 94 DEG C of initial denaturations
3min, 94 DEG C of denaturation 45s, 55 DEG C of annealing 1min, 72 DEG C of extension 1min, 34 circulations, 72 DEG C of extension 10min, 4 DEG C terminate instead
It answers.Primer sequence are as follows:
GalUR-MBP-FW:TCTGTTCCAGGGGCCGCATATGATGACGAAAGAGGGAAAGAAT GT；GalUR-MBP-
RV:TGTTAGCAGCCGGATCCTCGAGTATGTAGCCTTCCATGCTGAAATAG
As a result such as Figure 11-13, the results showed that, the fruit of 5-azaC processing after spending 25d and after spending 38d methylation level
Lower than control.The gene expression abundance of GalUR-5 in mutant fruit is studied simultaneously, as a result such as 7 institute of the following table 6 and table
Show.
The gene expression abundance of GalUR-5 in table 6.SlDML2 mutant fruit
The gene expression abundance of GalUR-5 in table 7.SlMET1 mutant fruit
The enzyme activity of activity and tomato GalUR prokaryotic expression protein to GalUR enzyme in blade and fruit is surveyed
It is fixed.Method disclosed in GalUR enzyme assay reference literature carries out (Jiang et al., 2018, Plant Physiology
and Biochemistry,124:20-28).As a result as shown in Figure 14-Figure 16, enzyme activity in the fruit and blade of 5-azaC processing
There is increase, and more significant in the fruit maturation stage, illustrate that the decline of DNA methylation level promotes the enzyme activity of GalUR enzyme,
To promote the accumulation of AsA.
By the conserved domain of bioinformatic analysis GalUR-5, physicochemical property and distribution expression pattern, and analyze
Evolution, the albumen of GalUR-5 is as a result, result is as shown in FIG. 17 and 18, the results showed that, GalUR-5 conserved domain is Aldo_
Ket_red, it is identical as GalUR conserved domain in strawberry, it is 25% with strawberry GalUR amino acid identity.And not to tomato
Expression quantity with GalUR-5 in tissue is detected, as a result as shown in figure 19.
The foregoing is merely illustrative of the preferred embodiments of the present invention, is not intended to limit the invention, all in essence of the invention
Made any modifications, equivalent replacements, and improvements etc., should all be included in the protection scope of the present invention within mind and principle.
Claims (7)
1. a kind of method of regulation tamato fruit ascorbic acid content, it is characterised in that: the method includes using methyl to shift
Enzyme inhibitor handles tomato tissue.
2. a kind of method of regulation tamato fruit ascorbic acid content according to claim 1, it is characterised in that: described kind
Eggplant tissue includes tomato seedling or tomato strain.
3. a kind of method of regulation tamato fruit ascorbic acid content according to claim 2, it is characterised in that: the first
Transferase inhibitors are 5-azacitidine.
4. a kind of method of regulation tamato fruit ascorbic acid content according to claim 3, which is characterized in that tomato
The method that seedling is handled are as follows: the 5-azacitidine aqueous solution of 50 μ L1mM is added in common inoculation medium, will plant
Son is placed on inoculation medium and is grown.
5. a kind of method of regulation tamato fruit ascorbic acid content according to claim 3, which is characterized in that tomato
The processing method of strain is to inject the 5-azacitidine aqueous solution of 50 μ L1mM at anthocaulus in tomato flowering period.
6. a kind of method of regulation tamato fruit ascorbic acid content according to claim 1, it is characterised in that: the tune
Prosecutor method shows as the expression of GalUR-5 gene in methyltransferase inhibitors regulation tomato tissue.
7. a kind of method of regulation tamato fruit ascorbic acid content as described in claim 1-6 is any is anti-bad in regulation tomato
Application in hematic acid content.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201910717419.1A CN110393149B (en) | 2019-08-05 | 2019-08-05 | Method for regulating and controlling ascorbic acid content of tomato fruits and application thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201910717419.1A CN110393149B (en) | 2019-08-05 | 2019-08-05 | Method for regulating and controlling ascorbic acid content of tomato fruits and application thereof |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN110393149A true CN110393149A (en) | 2019-11-01 |
| CN110393149B CN110393149B (en) | 2022-02-15 |
Family
ID=68327462
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201910717419.1A Active CN110393149B (en) | 2019-08-05 | 2019-08-05 | Method for regulating and controlling ascorbic acid content of tomato fruits and application thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN110393149B (en) |
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN111394362A (en) * | 2020-02-18 | 2020-07-10 | 杭州师范大学 | Gene for regulating and controlling seed development of solanaceae plant and application thereof |
| CN117204220A (en) * | 2023-09-13 | 2023-12-12 | 扬州大学 | Treatment method for improving seed production rate of cucumber seed melon |
Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN106497947A (en) * | 2016-11-04 | 2017-03-15 | 重庆大学 | A kind of Fructus Lycopersici esculenti ascorbic acid synthetic gene SLGPP and its application |
| CN109161550A (en) * | 2018-09-26 | 2019-01-08 | 华中农业大学 | A kind of the SlbHLH59 gene and application method of regulation tamato fruit ascorbic acid content |
-
2019
- 2019-08-05 CN CN201910717419.1A patent/CN110393149B/en active Active
Patent Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN106497947A (en) * | 2016-11-04 | 2017-03-15 | 重庆大学 | A kind of Fructus Lycopersici esculenti ascorbic acid synthetic gene SLGPP and its application |
| CN109161550A (en) * | 2018-09-26 | 2019-01-08 | 华中农业大学 | A kind of the SlbHLH59 gene and application method of regulation tamato fruit ascorbic acid content |
Cited By (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN111394362A (en) * | 2020-02-18 | 2020-07-10 | 杭州师范大学 | Gene for regulating and controlling seed development of solanaceae plant and application thereof |
| CN117204220A (en) * | 2023-09-13 | 2023-12-12 | 扬州大学 | Treatment method for improving seed production rate of cucumber seed melon |
| CN117204220B (en) * | 2023-09-13 | 2024-06-11 | 扬州大学 | Treatment method for improving seed production rate of cucumber seed melon |
Also Published As
| Publication number | Publication date |
|---|---|
| CN110393149B (en) | 2022-02-15 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Lee et al. | Validation of reference genes for quantitative RT-PCR studies of gene expression in perennial ryegrass (Lolium perenne L.) | |
| Su et al. | A genomic variation map provides insights into the genetic basis of spring Chinese cabbage (Brassica rapa ssp. pekinensis) selection | |
| Yuan et al. | RNA-Seq analysis of differential gene expression responding to different rhizobium strains in soybean (Glycine max) roots | |
| Min et al. | Two novel anoxia-induced ethylene response factors that interact with promoters of deastringency-related genes from persimmon | |
| Borges et al. | Reference gene validation for quantitative RT-PCR during biotic and abiotic stresses in Vitis vinifera | |
| CN101415841A (en) | Prediction of heterosis and other traits by transcriptome analysis | |
| Kong et al. | Selection of reference genes for gene expression normalization in Pyropia yezoensis using quantitative real-time PCR | |
| Oh et al. | Genomic characterization of the fruity aroma gene, FaFAD1, reveals a gene dosage effect on γ-decalactone production in strawberry (Fragaria× ananassa) | |
| Kumar et al. | Characterization of released and elite genotypes of guar [Cyamopsis tetragonoloba (L.) Taub.] from India proves unrelated to geographical origin | |
| Hu et al. | Validation of reference genes for relative quantitative gene expression studies in cassava (Manihot esculenta Crantz) by using quantitative real-time PCR | |
| Markelz et al. | Developmental stage specificity of transcriptional, biochemical and CO2 efflux responses of leaf dark respiration to growth of A rabidopsis thaliana at elevated [CO2] | |
| CN110393149A (en) | A kind of method and its application of regulation tamato fruit ascorbic acid content | |
| Merry et al. | Coincidence of maximum severity of powdery mildew on grape leaves and the carbohydrate sink‐to‐source transition | |
| Zhou et al. | Characteristics and research progress of legume nodule senescence | |
| Chao et al. | Evaluation of reference genes for quantitative real-time PCR analysis of the gene expression in laticifers on the basis of latex flow in rubber tree (Hevea brasiliensis Muell. Arg.) | |
| Niaz et al. | Identification of valid reference genes for the normalization of RT-qPCR gene expression data in Alexandrium catenella under different nutritional conditions | |
| CN113774065B (en) | Fluorescent quantitative internal reference gene for different adults of fall webworm, primer and application thereof | |
| Zhang et al. | Mining of candidate genes for grape berry cracking using a genome-wide association study | |
| Pompili et al. | Structural and expression analysis of polyphenol oxidases potentially involved in globe artichoke (C. cardunculus var. scolymus L.) tissue browning | |
| CN109599147B (en) | NACs transcription factor of differential expression in populus tomentosa under cadmium stress condition and acquisition method thereof | |
| CN116621961A (en) | Gene ZmAPC4 for regulating starch content in corn kernel, expression product, SNP marker, excellent haplotype and application | |
| Sun et al. | Comprehensive genomic identification and expression analysis of the nucleobase-ascorbate transporter (NAT) gene family in apple | |
| CN113046460A (en) | Leek reference gene under gray mold stress condition, primer of reference gene and application | |
| Bhutta | Biochemical and molecular characterization of wheat genotypes determined by RAPD analysis | |
| CN111118197A (en) | Pear pulp qRT-PCR (quantitative reverse transcription-polymerase chain reaction) reference genes as well as primers and application thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |