CN110393149B - Method for regulating and controlling ascorbic acid content of tomato fruits and application thereof - Google Patents

Abstract

The invention belongs to the technical field of biology, and particularly relates to a method for regulating and controlling the content of ascorbic acid in tomato fruits and application thereof. The research of the invention finds that the content of ascorbic acid in tomato can be obviously improved by using a methyltransferase inhibitor to treat tomato tissues, and meanwhile, the influence of methylation regulation on the content of AsA in tomato is researched by methods of bioinformatics and molecular biology starting from key genes in an AsA pathway identified in a laboratory. The invention provides a novel method for regulating and controlling the content of ascorbic acid in tomatoes, which has the advantages of simple operation, low cost, easy popularization of technology and good technical effect, and can obviously improve the content of the ascorbic acid in the tomatoes.

Description

Method for regulating and controlling ascorbic acid content of tomato fruits and application thereof

Technical Field

The invention belongs to the technical field of biology, and particularly relates to a method for regulating and controlling the content of ascorbic acid in tomato fruits and application thereof.

Background

Tomato (Solanum lycopersicum) is an important model plant in horticultural research, and contains abundant nutrient components such as ascorbic acid (AsA). Ascorbic acid (also called vitamin C) is a very strong antioxidant substance, is one of the most abundant water-soluble low-molecular-weight antioxidants in plant cells, plays a positive role in cell activity and plant growth, and provides electrons through redox reaction, so that the ascorbic acid has an antioxidant function and helps plants to cope with stress. AsA is an important growth regulator as a cofactor of related enzymes in the growth and development process of plants. AsA also plays a very important role in protecting human health. It can scavenge free radicals in human body which can induce cancer and aging, increase antibody concentration in blood, enhance immunity of human body, enhance vascular tissue, reduce cholesterol content in blood, prevent and treat arteriosclerotic cardiovascular diseases, hypertension and apoplexy, promote collagen formation, make skin compact, make bone and tooth firm and promote wound healing.

Since humans have lost their ability to synthesize ascorbic acid and are only supplemented by diet, fresh fruits and vegetables are the major source of ascorbic acid for humans. AsA protects plant tissues from reactive oxygen species ROS in plants and plays an important role in combating pathogenic infection, insect infestation, intense light, temperature stress, water stress, salt stress, UV-B and environmental pollution. AsA is also a coenzyme factor for some enzymes, and is involved in the regeneration of vitamin E. AsA is also involved in the regulation of many basic cytological processes such as photosynthesis, photoprotection, stomatal opening and closing, plant growth and development and flowering, cell cycle, cell expansion, programmed cell death and senescence. Thus increasing the AsA content of a plant derived food may not only improve its nutritional quality but also enhance resistance to stress.

Chinese patent publication No. CN109337923A discloses a method for increasing the content of vitamin C in tomato quality components by polygenic polymerization, which is an invention patent previously applied by the inventor, and the method enables polymerized plants to increase the content and transportation of ascorbic acid in tomato fruits and leaves by carrying out hybrid polymerization on overexpression transgenic lines of four key structural genes in an ascorbic acid synthesis pathway D-mannose/L-galactose pathway.

Chinese patent publication No. CN106497947A discloses a tomato ascorbic acid synthetic gene SLGPP and application thereof, and the content of ascorbic acid in tomato is improved by over-expressing the tomato ascorbic acid synthetic gene GPP.

However, in the prior art including the above two patents, the method for increasing the ascorbic acid content of tomato is mostly to obtain new tomato plants by gene cloning and gene means of constructing a vector, thereby obtaining tomatoes with increased ascorbic acid content. The technology is complex in operation and high in cost, and is not beneficial to popularization and application among common planters.

Disclosure of Invention

Aiming at the problems in the prior art, the invention provides a method for regulating and controlling the ascorbic acid content of tomato fruits and application thereof.

The invention is thus achieved by a method of modulating the ascorbic acid content of a tomato fruit, said method comprising treating tomato tissue with a methyltransferase inhibitor.

Further, the tomato tissue includes tomato seedlings or tomato adult plants.

Further, the methyltransferase inhibitor is 5-azacytidine.

Further, the method for treating the tomato seedlings comprises the following steps: 50 μ L of a 1mM aqueous solution of 5-azacytidine was added to a common inoculation medium, and the seeds were placed in the inoculation medium for growth.

Further, the adult tomato plants were treated by injecting 50. mu.L of 1mM 5-azacytidine aqueous solution into the flower stalks during the flowering stage of the tomato.

Furthermore, the regulation and control method shows that the methyltransferase inhibitor regulates the expression of the GalUR-5 gene in tomato tissues, and the sequence of the GalUR-5 gene is shown as SEQ ID NO. 1.

The method for regulating the content of the ascorbic acid in the tomato fruits is applied to regulating the content of the ascorbic acid in the tomatoes.

In summary, the advantages and positive effects of the invention are:

the invention provides a novel method for regulating and controlling the content of ascorbic acid in tomatoes, which has the advantages of simple operation, low cost, easy popularization of technology and good technical effect, and can obviously improve the content of the ascorbic acid in the tomatoes.

The invention analyzes the influence of the regulation and control of the DNA methylation of the ascorbic acid synthesis by treating tomatoes with a methyltransferase inhibitor to change the DNA methylation level of the tomatoes. The CRISPR knockout material based on SlMET1 and SlDML2 genes researches the influence of DNA methylation on the accumulation of the tomato ascorbic acid through epigenomics and transcriptomics, determines key genes regulated and controlled by the DNA methylation in an ascorbic acid pathway by combining omics analysis and a methyltransferase inhibitor treatment test, and discusses a regulation mechanism of the DNA methylation on the synthesis and accumulation of the tomato ascorbic acid.

Drawings

FIG. 1 is the germination rate of 5-azaC treated seeds;

FIG. 2 is the change in total AsA content in the leaves of 5-azaC treated seedlings;

FIG. 3 is the change in reduced AsA content in the leaves of 5-azaC treated seedlings;

FIG. 4 is the variation of the different ripening stages of the tomato fruit after 5-azaC treatment;

FIG. 5 is the effect of 5-azaC treatment on total AsA in tomato;

FIG. 6 is the effect of 5-azaC treatment on tomato reduction of AsA;

FIG. 7 is a change in the AsA anabolic genes during fruit ripening;

FIG. 8 is the effect of self DNA methylation on the AsA gene during fruit developmental maturity;

FIG. 9 shows that the gene expression of tomato leaf GalUR-5 is affected by 5-azaC;

FIG. 10 is the gene expression of GalUR-5 in fruit;

fig. 11 is a methylation change of GalUR-5 in SlDML2CRISPR mutants;

FIG. 12 is a change in methylation of GalUR-5 in SlMET1 mutants;

FIG. 13 is a DNA methylation assay for GalUR-5;

FIG. 14 is a GalUR enzyme activity assay in leaves after treatment with a methyltransferase inhibitor;

FIG. 15 is the enzymatic activity of GalUR in mature fruit after treatment with a methyltransferase inhibitor;

FIG. 16 is the enzyme activity assay of the prokaryotic expression protein of tomato GalUR-5;

FIG. 17 is a GalUR evolution analysis;

FIG. 18 is a prediction of GalUR-5 protein secondary structure;

FIG. 19 shows the expression level of GalUR-5 in different tissues of tomato AC.

Detailed Description

In order to make the objects, technical solutions and advantages of the present invention more apparent, the present invention is further described in detail below with reference to examples, and the equipment and reagents used in the examples and test examples are commercially available without specific reference. The specific embodiments described herein are merely illustrative of the invention and are not intended to be limiting.

The invention discloses a method for regulating and controlling the content of ascorbic acid in tomato fruits and application thereof, and concretely relates to the following embodiments.

The invention relates to plant raw materials: tomato conventional line Ailsa Craig (AC), tomato material with complete genome-wide methylation sequencing data and transcriptome sequencing data. Methyltransferase inhibitors (5-azacytidine, 5-azaC) treated AC for methylation regulation studies.

Sources of gene sequence data involved in the invention: raw sequence data: SRA046092, SRA046132, SRA046131, SRA053345 and SRA 046480. Tomato epigenome database (http:// ted. bti. corn. edu/epigenome /) was used for access analysis. In the Gene Expression comprehensive database Gene Expression Omnibus of NCBI, it is accessible through GEO series accession number GSE 94903. The generated data set is available at the NCBI Gene Expression comprehensive database Gene Expression Omnibus (GEO: http:// www.ncbi.nlm.nih.gov/GEO /); data entry number GSE 102273.

Example 1 methylation of tomato seedlings and adult plants

1. Methylation treatment of tomato seedlings

Add 50. mu.L of 1mM 5-azacytidine in water to a common inoculation medium (medium is a standard 1/2MS medium formulation, obtained according to Murashige and Skoog, 1962); control group 50. mu.L of H₂O was added to the same volume of inoculation medium and repeated 3 times. The seeds are put in an inoculation culture medium for growth, the leaves of the plants are taken every other week, and the continuous sampling is carried out for four weeks. The leaves are taken out and put into liquid nitrogen for short-term storage, and if the leaves are stored for a long time, the leaves are put into a refrigerator at minus 80 ℃.

2. Methylation treatment of adult tomato plants

50 μ L of 1mM 5-azaC in water was injected into the petiole during the flowering stage of tomato, only once, for control 50 μ L H₂And O processing, and marking and date.

As a result: tomato AC seeds and flower stalks during flowering of the fruits were treated with water and a methyltransferase inhibitor (5-azaC), respectively, and the treated seeds were observed for germination and fruit development maturity. The results showed that the 5-azaC treated seeds had a germination rate of 95% compared to the control, which had a germination rate of 72%, as shown in FIG. 1. The results of the tests on the total AsA and reduced AsA contents in the seedling leaves are shown in fig. 2 and fig. 3, the AsA content in the 5-azaC treated seedling leaves is improved compared with that in the control group, particularly the AsA content in the control group is reduced compared with that in the previous treatment at four weeks, while the total AsA and reduced AsA contents in the 5-azaC treated group are improved higher than that in the previous treatment, the total ascorbic acid in the treated seeds at four weeks is increased from 398.8 mu g/g of the control to 558.0 mu g/g of the treated seeds at the fourth week, the increase ratio is 39.9%, and the reduced ascorbic acid is increased from 390.3 mu g/g to 519.5 mu g/g. The total ascorbic acid content was increased from 154.2. mu.g/g control to 222.7. mu.g/g post-treatment 38 days after fruit treatment, which was 44.4%. The content of the reduced ascorbic acid in the fruits treated for 14 days is increased from 94.9 mu g/g of the control to 154.9 mu g/g after treatment, and the increase ratio reaches 63.2 percent.

The ripening period of the fruits of the experimental group and the control group were compared, and the results are shown in FIG. 4, and the fruits after treatment ripen 5d earlier.

The germination percentage, the detection method of AsA in leaves and fruits related to the example are as follows: and (3) counting the germination rate: to 25ml of MS fixed medium was added 50. mu.L of 1mM 5-azacytidine. 100 tomato seeds were sown on solid medium, and the number of germinated seeds was counted weekly. The germination rate is the number of germinated seeds/100 × 100%. The AsA assay was performed according to the literature (Liu Gen faithful, et al, 2017, journal of horticulture).

Example 2 AsA pathway bioinformatics and molecular biology analysis

Based on the results of the study in example 1, the present invention was analyzed at the gene level to explore the effect of methylation regulation on AsA content in tomato. The specific experimental operations were as follows:

bioinformatics analysis: the analytical procedure was carried out according to the method described by the previous person (Lang et al 2017): low quality sequences (q <20) were culled using trim in BRAT-BW (Harris et al 2012), reads after low quality data culling were mapped to the reference genome using BRAT-BW, allowing two mismatches, the reference genome version being SL2.50(ftp:// ftp. solgenomics. net/tomato genome/assembly/build _ 2.50/; Consortium 2012). Remove-duplicate command using BRAT-BW deletes possible PCR amplifications.

Methylation levels were assessed using the weighted methylation level algorithm proposed by Schultz et al (Schultz et al 2012). If there are 3 CHH sites in a certain interval: the first site reads 10 with 3 methylated; at the second site 1 of the 5 reads was methylated; the third site 5 reads were not methylated. Then the methylation level of CHH is calculated as (3+1+0)/(10+5+5) ═ 20%. Using Bioconductor package: this program (Zab et al 2017) was called for DMB identification. For each context, the computeddmrs function uses the parameters method ═ bins, binSize ═ 100, test ═ score, pvalutethreshold ═ 0.01, mincytosinecount ═ 4, minGap ═ 200, minSize ═ 50, and minreadpercytosine ═ 4 in dmrcallirlibrary. The minimum ratio difference values of CG, CHG and CHH were 0.4, 0.4 and 0.2.

mRNA seq data analysis: for RNA-seq data processing, the TopHat2 for the parameter b2 option was used for FastQC check quality control (www.bioinformatics.babraham.ac.uk/projects/FastQC), the gff3 file was annotated with genomic (Kim et al 2013) ITAG2.4, and the parameter of TopHat2 was the G option. The program, featurepopulations (Liao et al 2014), was used to calculate the mapped fragments for each gene. The p parameter is set to compute the fragment rather than the read. An output count table is used as an input to edgeR (Robinson et al 2010). Default analysis parameters of estimaatedemomendisp, estimaetagwisdisp and actuttest are used in edgeR. Differentially Expressed Genes (DEG) were determined as having fold change >2 and FDR <0.01 or fold change >1 and FDR < 0.05.

As a result:

GMP, GME and other genes (disclosed in Chinese patent with publication number CN 109337923A) identified by the inventor laboratory are compared by a bioinformatics method, homologous genes are searched, other AsA pathway related genes are searched by consulting the literature, and 61 AsA anabolism related genes are obtained in total. As shown in fig. 7 and 8. Expression analysis is carried out on AsA related genes based on RNA-seq data of different developmental maturity stages of tomatoes, and results show that more than 18 genes are significantly expressed in 17d after flowers of the AC and more than 14 genes are significantly expressed in 42d after flowers of the AC. The methylation level of the AsA related gene in the maturation process is analyzed, and the result shows that most CG type DNA methylation exists, and the coding region and the promoter region of the gene are easier to be subjected to methylation regulation relative to the downstream of the gene in the fruit developmental maturation process.

The sequences of the genes SlDML2 and SlMET1 were obtained according to the method disclosed in the genomic database of Solanaceae (https:// solgenomics. net/search/locus). The gene sequence of SlDML2 is Solyc10g083630, and the gene sequence of SlMET1 is Solyc01g 006100. And knocking out genes SlDML2 and SlMET1 by a CRISPR technology to obtain a gene knock-out material. Tomato CRISPR technology was obtained according to the methods disclosed in the literature (Li et al, 2018, Nature Biotechnology36: 1160-1163). The rule of change of AsA-associated genes in CRISPR material of tomato genes SlDML2 and SlMET1 was analyzed based on transcriptome data, and the results are shown in tables 1-4 below.

TABLE 1 AsA-related genes up-regulated in SlMET1 mutants

TABLE 2 AsA-related genes downregulated in expression in SlMET1 mutants

TABLE 3 AsA-related genes up-regulated in SlDML2 mutants

TABLE 4 AsA-related genes downregulated in expression in SlDML2 mutants

The results show that there are 5 genes that are commonly methylation regulated in tomato CRISPR material of SlDML2 and SlMET1, GR-1, GalUR-5, GME-1, AO-1 and APX-7, respectively, detailed in Table 5.

TABLE 5 AsA-related genes in tomato under the common Regulation of DNA methyltransferase SlMET1 and demethylase SlDML2

Further analysis of methylation levels of AsA-associated genes in the above material identified that GalUR-5 gene in AsA synthesis-associated genes was significantly epigenetically regulated. The GalUR-5 gene sequence is obtained according to the method disclosed by a solanaceae genome database (https:// solgenomics. net/search/locus), and the serial number of the GalUR-5 gene sequence is Solyc09g097960.2.

The expression analysis of GalUR-5 in leaves and fruits of 5-azaC-treated plants is shown in FIGS. 9 and 10. It was found that the GalUR-5 gene was up-regulated in both leaves and fruits. The gene expression level was expressed by an RNA sequencing method and RPKM. The RNA-seq method is available from the open literature (Ye et al, 2015, PLoS one.10(7): e 0130885). The methylation level of GalUR-5 is determined by using an enzyme-cutting PCR method.

The methylation detection method in this example: McrBC-PCR is one of the methods for methylation detection, and McrBC can cut DNA methylated by cytosine, has no effect on non-methylated sequences, and can be used for detecting the methylation change level on the DNA.

1. High quality DNA sample extraction (refer to open literature report: Liu Gen faithful, gardening bulletin, 2017, 44 (1): 120-

2. According to the reaction system, 2. mu.g of DNA was divided into two portions, one portion was used as a control, and 20U of McrBC was added to the other portion, and the mixture was digested at 37 ℃ for 6 hours, followed by incubation at 65 ℃ for 20min to denature the enzyme. The reaction system is as follows:

3. designing primers at two ends of a target site, carrying out PCR by taking the digested DNA as a template, detecting the DNA methylation level of a sample, and taking different amplified genes of the digested DNA as a control.

And 4, after the PCR is finished, agarose gel electrophoresis is carried out, and the DNA methylation degree is analyzed through the strength of an amplified band.

The PCR reaction system is 20 μ L: 10 XPCR Buffer 2.0. mu.L, 10mM dNTPs 0.4. mu.L, 10mM primer 0.4. mu.L, 5U/. mu.L Taq enzyme 0.1. mu.L, 20 ng/. mu.L DNA template 1.0. mu.L, ddH₂O15.7. mu.L. The PCR reaction program is: pre-denaturation at 94 ℃ for 3min, denaturation at 94 ℃ for 45s, annealing at 55 ℃ for 1min, extension at 72 ℃ for 1min, 34 cycles, extension at 72 ℃ for 10min, and termination at 4 ℃. The primer sequence is as follows:

GalUR-MBP-FW：TCTGTTCCAGGGGCCGCATATGATGACGAAAGAGGGAAAGAATGT；GalUR-MBP-RV：TGTTAGCAGCCGGATCCTCGAGTATGTAGCCTTCCATGCTGAAATAG

the results are shown in FIGS. 11-13, and show that 5-azaC treated fruits have lower levels of methylation at 25d post-anthesis and 38d post-anthesis than the control. Meanwhile, the gene expression abundance of GalUR-5 in the mutant fruits is studied, and the results are shown in the following tables 6 and 7.

TABLE 6 abundance of GalUR-5 gene expression in SlDML2 mutant fruits

TABLE 7 abundance of GalUR-5 gene expression in SlMET1 mutant fruits

And (3) measuring the activity of GalUR enzyme in leaves and fruits and the enzyme activity of prokaryotic expression protein of tomato GalUR. GalUR enzyme activity was determined according to the methods disclosed in the literature (Jiang et al, 2018, Plant Physiology and Biochemistry,124: 20-28). The results are shown in fig. 14-16, the enzyme activity in the 5-azaC treated fruits and leaves is increased and more remarkable at the fruit ripening stage, which indicates that the decrease of the DNA methylation level promotes the enzyme activity of the GalUR enzyme, thereby promoting the accumulation of AsA.

The result of analyzing the conserved structural domain, physicochemical property and tissue expression spectrum of GalUR-5 by bioinformatics and analyzing the evolution and protein result of GalUR-5 is shown in FIGS. 17 and 18, and the result shows that the conserved structural domain of GalUR-5 is Aldo _ ket _ red, which is the same as the conserved structural domain of GalUR in strawberry, and the amino acid homology with GalUR in strawberry is 25%. And the expression level of GalUR-5 in different tissues of tomato is detected, and the result is shown in FIG. 19.

The above description is only for the purpose of illustrating the preferred embodiments of the present invention and is not to be construed as limiting the invention, and any modifications, equivalents and improvements made within the spirit and principle of the present invention are intended to be included within the scope of the present invention.

Claims (7)

1. A method for regulating and controlling the content of ascorbic acid in tomato fruits is characterized by comprising the following steps: the method comprises treating tomato tissue with a methyltransferase inhibitor.

2. The method for regulating the ascorbic acid content of tomato fruits according to claim 1, wherein the method comprises the following steps: the tomato tissue includes tomato seedlings or tomato adult plants.

3. The method for regulating the ascorbic acid content of tomato fruits as claimed in claim 2, wherein the method comprises the following steps: the methyltransferase inhibitor is 5-azacytidine.

4. The method for regulating and controlling the ascorbic acid content of tomato fruits as claimed in claim 3, wherein the method for treating tomato seedlings comprises the following steps: 50 μ L of 1mM aqueous solution of 5-azacytidine was added to a common inoculation medium, and the seeds were placed in the inoculation medium for growth.

5. The method for regulating and controlling the ascorbic acid content of tomato fruits as claimed in claim 3, wherein the tomato adult plant is treated by injecting 50 μ L of 1mM aqueous solution of 5-azacytidine at the flower stalk during the flowering period of tomato.

6. The method for regulating the ascorbic acid content of tomato fruits according to claim 1, wherein the method comprises the following steps: the regulation method is characterized in that the expression of GalUR-5 gene in tomato tissue is regulated by methyltransferase inhibitor.

7. Use of a method for modulating the ascorbic acid content of tomato fruit as claimed in any one of claims 1 to 6 for modulating the ascorbic acid content of tomato.

Images