CN105219652B - A kind of isolation and purification method of wild Bachu mushroom mycelium - Google Patents
A kind of isolation and purification method of wild Bachu mushroom mycelium Download PDFInfo
- Publication number
- CN105219652B CN105219652B CN201510593514.7A CN201510593514A CN105219652B CN 105219652 B CN105219652 B CN 105219652B CN 201510593514 A CN201510593514 A CN 201510593514A CN 105219652 B CN105219652 B CN 105219652B
- Authority
- CN
- China
- Prior art keywords
- wild
- mycelia
- bachu
- isolation
- bachu mushroom
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Landscapes
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
- Mushroom Cultivation (AREA)
- Breeding Of Plants And Reproduction By Means Of Culturing (AREA)
Abstract
The invention belongs to wild mushroom hypha separation technical field of purification, and in particular to a kind of isolation and purification method of wild Bachu mushroom mycelium, wild Bachu mushroom tissue or the spore of ejection be obtained into heterozygosis mycelia in cultivating 68 days in PDA culture medium first；Then heterozygosis mycelia is taken to obtain single homozygous thread mycelia in being cultivated 7 10 days on Characteristic education base；The picking homozygous mycelia is transferred in PDA culture medium and cultivated 68 days.Using the DNA after the CTAB method extraction purifications of improvement, and ITS sequence sequencing is carried out, obtained sequence and the ITS sequence of known Bachu mushroom fruitbody is compared, and sequence similarity is laid a good foundation up to more than 99% for artificial culture Bachu mushroom.The isolation and purification method of wild Bachu mushroom mycelium provided by the invention, there is simple technique, easily operated, purifying property height, purifying is accurate, is easy to the characteristics of precise Identification.
Description
Technical field
The invention belongs to wild mushroom hypha separation technical field of purification, and in particular to a kind of wild Bachu mushroom mycelium
Isolation and purification method.
Background technology
Xinjiang Wild domestic fungus resource is relatively fewer, and famous edible mushroom is in addition to hickory chick, asafoetida mushroom, also in Keshen
" the Bachu mushroom " in area.It is tender delicious, nutritious and famous with matter.Because Bachu mushroom is not tamed successfully so far,
As people with characteristic fragrance and the understanding of delicate flavour Bachu mushroom and nutrition, demand to increasingly increasing, the market price is significantly
Increase, wild quantity is reduced, this situation serious threat Bachu mushroom species year by year due to the extinctive collection of local people
Living or death.
But found through years of researches, Bachu mushroom mycelium purifying difficulty is very big, and the mycelia of majority separation is to be mixed with bar
The heterozygosis mycelia of two kinds of miscellaneous bacterias of shape and sickle shaped, thus causes research to continue deeper into.Bachu mushroom can be purified by finding one kind
Bottleneck of the new method of mushroom silk into further investigation Bachu mushroom.
So more effective, the accurately wild separation of Bachu mushroom mycelium and purifying is introduced in traditional hypha separation
The preservation and consumer demand for Bachu mushroom species of technology and method be to have very great meaning.
The content of the invention
It is an object of the invention to provide a kind of isolation and purification method of wild Bachu mushroom mycelium, this method passes through wild
The step such as Bachu mushroom tissue or spore separation culture, purifying culture, realizes the separation and purifying of wild Bachu mushroom mycelium,
High with purification degrees, purifying is accurate, is easy to the advantages of precise Identification.
The purpose of the present invention can be achieved through the following technical solutions：
Compared with prior art, the beneficial effects of the present invention are：
A kind of isolation and purification method of wild Bachu mushroom mycelium, its step include：
(1) wild Bachu mushroom tissue or the spore of ejection, are obtained into heterozygosis mycelia in cultivating 6-8 days in PDA culture medium；
(2) the heterozygosis mycelia in step (1), is taken in being cultivated 7-10 days on Characteristic education base, is obtained single homozygous thread
Mycelia；Preferably, the cultivation temperature of this step is 20-25 DEG C.
(3), the mycelia in picking step (2) is transferred in PDA culture medium and cultivated 6-8 days.
In the step (1), wild Bachu mushroom tissue is the bacterial context of wild Bachu mushroom fruitbody；By bacterial context or ejection
Spore, be positioned under open environment in the PDA culture medium of sterilizing, under the conditions of 25 DEG C, indoor culture 7 days.Preferably, it is described
The bacterial context of wild Bachu mushroom fruitbody and the culture weight of PDA culture medium are 1:90-100；The wild Bachu mushroom ejection
The inoculum concentration of spore sterilized water be 0.1-0.5 ‰.There is mycelia to grow after the culture of 7 days, take the mycelia grown in prior
Drop has on the cover glass of distilled water or 5%KOH solution, covered, observes mycelia situation under the microscope, and discovery has three kinds
Hypha form, a kind of a kind of thread, sickle shaped, another kind are shaft-like, so, by the culture of step (1), the mycelia turned out
For heterozygosis mycelia.
Preferably, the bacterial context of the wild Bachu mushroom fruitbody is stem and cap joint portion, and its tissue growth enlivens,
Do not contacted with extraneous air.
The formula of PDA culture medium is potato (peeling) 200g, glucose 20g, agar 15-20g, distilled water 1000mL.
In the step (2), Characteristic education base by glucose, thiamine, gentamicin sulphate, penicillin, neomycin and
Distilled water forms.Preferably, the concentration of glucose of the Characteristic education base is 0.02g/mL；Sulphur in the Characteristic education base
Amine element, gentamicin sulphate, penicillin, the concentration of neomycin are 0.001mg/mL.
The collocation method of the Characteristic education base is to pour into plate after glucose, agar and distilled water sterilize, be cooled to
Add thiamine, gentamicin sulphate, penicillin and neomycins after less than 60 DEG C, well mixed to pour into flat board stand-by to solidifying.
The growth that the advantages of Characteristic education base is that the miscellaneous bacteria such as sickle shaped and shaft-like and bacterium can be suppressed is without hindering
The growth of thread mycelia, it is easy to fast-growth and the separation of filamentous fungi mycelia.
In the step (2), the inoculum concentration of heterozygosis mycelia is 1-2 ‰.Suitable heterozygosis mycelium inoculation amount, is advantageous to want
Mycelia fast-growth, quick separating.
In the step (3), the inoculum concentration of mycelia is 1-2 ‰.The homozygous culture again of suitable inoculum concentration is selected, is advantageous to
Mycelia to be separated faster grow, recover its original vigor.
The homozygous thread mycelia obtained in step (3) is subjected to homozygous identification by microscope inspection and molecular sequence identification,
Microscopy is consistent with sequence alignment have been purified, on the contrary then impure.
1st, the invention provides wild Bachu mushroom mycelium purification process, after the CTAB method extraction purifications of improvement
DNA, and ITS sequence sequencing is carried out, obtained sequence and the ITS sequence of known Bachu mushroom fruitbody is compared, sequence
Similarity is laid a good foundation up to more than 99% for artificial culture Bachu mushroom.
2nd, the isolation and purification method of wild Bachu mushroom mycelium provided by the invention, there is purifying property height, purifying accurately, easily
In the precise Identification the characteristics of.
3rd, wild Bachu mushroom mycelium purifying process of the invention is simple, easily operated, strong applicability.
Brief description of the drawings
Fig. 1 is the heterozygosis mycelia figure in embodiment 1.
Fig. 2 is the single homozygous thread mycelia figure in embodiment 1.
Embodiment
With reference to embodiment, the invention will be further described：
Embodiment 1
The preparation of culture medium
PDA culture medium：Potato (peeling) 200g, glucose 20g, agar 15-20g, distilled water 1000mL.
Characteristic education base：Glucose, agar and distilled water are configured to 1000mL solution, plate is poured into after sterilizing, is cooled down
Thiamine 10mg, gentamicin sulphate 10mg, penicillin 10mg and neomycin 10mg are added after to less than 60 DEG C, after being well mixed
It is stand-by to solidifying to pour into flat board.
Purification step：
Take the fructification bacterial context (cap and stem joint portion) of wild Bachu mushroom (plucking from Kashi Bachu County)
0.1g is incubated in 9g PDA culture medium, under the conditions of 25 DEG C, indoor culture 7 days.
There is mycelia to grow after the culture of 7 days, take the mycelia grown to have distilled water or 5%KOH solution in prior drop
On cover glass, covered observes mycelia situation under the microscope, and discovery has three kinds of hypha forms, a kind of a kind of thread, sickle
Knife-like, another kind are shaft-like, so, by the culture of above-mentioned steps, the mycelia turned out is heterozygosis mycelia, specifically such as Fig. 1 institutes
Show.
Picking contains the mycelia block of heterozygosis mycelia in the superclean bench of sterilizing, is transferred on Characteristic education base, inoculation
Measure as 1 ‰, cultivated 7-10 days under 25 DEG C of temperature conditionss, obtain single homozygous thread mycelia.
The above-mentioned single homozygous thread mycelia of picking, which is transferred in PDA culture medium, to be cultivated 7 days, and inoculum concentration is 1 ‰, in prior
Drop has on distilled water or the cover glass of KOH solution, covered, observes mycelia situation under the microscope, finds only have one kind
Thread hypha form, specific (thread 4-8 μm of the hyphal diameter, slender type, water white transparency, mycelia have barrier film, bacterium as shown in Figure 2
Silk is internal to have oily drop).
Molecular sequence identification：Above-mentioned mycelia DNA after purification is extracted using the CTAB methods of improvement, and carries out ITS sequencings, is obtained
To sequence and the ITS sequence of known Bachu mushroom fruitbody be compared, sequence similarity is then Bachu up to more than 99%
The mycelia of mushroom.
The mycelia ITS sequence after purification of measure is as follows.
TAATCAGTTACAGTTGTCTCAGTCAAGAAGACGGTTCGAAGCGGTCGCAAAAACCTTTCACAGAGTCGC
ATAGGTATCTCTCCAGAGGAGAGAACACAAAGGGAGCCGTGAGGCAAACCCTTCAAACACCCGAGCTCTGCCAACAC
TCTGAACCAAGCTAGCTTAGATATTATCACAGCTTAGCGTAGCCCAAGTAATGGTTCGTACTGCTAATGCATTTCAG
AGGAGCTGAACCCATTGAAAGGTCCGGCAGGCCTCCACCATCCAACACCATTCGAACTCGAAAAACAAGTAAGAAGG
GTTGAGAGTTTACTGACACTCAAACAGGCATGCCCTTCGGAATACCAAAGGGCGCAAGGTGCGTTCAAAGACTCGAT
GATTCACTGAATTCTGCAATTCACATTAGTTATCGCATTTCGCTGCGTTCTTCATCGATGCGAGAGCCAAGAGATCC
GTTGTTGAAAGTTGTATTAAGTTGTTTTAGAGGACGGTGAAGTCCCATAAACGAAGACATTCTAAACATGCAAGAGA
TGATATGAAGCATAGACCCGGAGGAAACGAAAGGAGGCGAACCTCACCTTCAACCCCAACCAGATCTACAAAAGGTG
CACAGGTGGACAAAGAAGAGGCGAGCGACTTCAAAACGTGCACATACTCAAGAGTCAGCAACAGAAGTGAAGCCACA
AGCGT
It is compared by ITS sequence, for sequence similarity up to more than 99%, the mycelia that the present invention cultivates is Bachu mushroom
Mycelia.
Embodiment 2
The preparation of culture medium
The preparation of PDA culture medium and Characteristic education base is the same as embodiment 1.
Purification step：
The spore sterilized water 1ml of wild Bachu mushroom ejection is taken in PDA culture medium, under the conditions of 25 DEG C, indoor culture 7
My god.
There is mycelia to grow after the culture of 7 days, take the mycelia grown to have distilled water or 5%KOH solution in prior drop
On cover glass, covered observes mycelia situation under the microscope, and discovery has three kinds of hypha forms, a kind of a kind of thread, sickle
Knife-like, another kind are shaft-like, so the culture by above-mentioned steps, the mycelia turned out is heterozygosis mycelia.
Picking contains the mycelia block of heterozygosis mycelia in the superclean bench of sterilizing, is transferred on Characteristic education base, inoculation
Measure as 2 ‰, cultivated 7-10 days under 25 DEG C of temperature conditionss, obtain single homozygous thread mycelia.
The above-mentioned single homozygous thread mycelia of picking, which is transferred in PDA culture medium, to be cultivated 7 days, and inoculum concentration is 2 ‰, in prior
Drop has on distilled water or the cover glass of KOH solution, covered, observes mycelia situation under the microscope, finds only have one kind
Thread hypha form, thread 4-8 μm of the hyphal diameter, slender type, water white transparency, mycelia have barrier film, have oily inside mycelia
Drop.
Molecular sequence identification：Above-mentioned mycelia DNA after purification is extracted using the CTAB methods of improvement, and carries out ITS sequencings, is obtained
To sequence and the ITS sequence of known Bachu mushroom fruitbody be compared, sequence similarity is up to more than 99%, so this system
The mycelia that Preparation Method is turned out is the mycelia of Bachu mushroom.
Described above is presently preferred embodiments of the present invention, but the present invention should not be limited to disclosed in the embodiment
Content.So every do not depart from the lower equivalent or modification completed of spirit disclosed in this invention, the model that the present invention protects is both fallen within
Enclose.
Claims (6)
1. a kind of isolation and purification method of wild Bachu mushroom mycelium, its step include：
(1) wild Bachu mushroom tissue or the spore of ejection, are obtained into heterozygosis mycelia in cultivating 6-8 days in PDA culture medium；
(2) the heterozygosis mycelia in step (1), is taken to obtain single homozygous thread mycelia in being cultivated 7-10 days on Characteristic education base；
The Characteristic education base is by glucose, thiamine, gentamicin sulphate, penicillin, neomycin, distilled water and agar group
Into；
(3), the mycelia in picking step (2) is transferred in PDA culture medium and cultivated 6-8 days.
2. the isolation and purification method of wild Bachu mushroom mycelium according to claim 1, it is characterised in that：The step
(1) in, wild Bachu mushroom tissue is the part bacterial context of wild Bachu mushroom fruitbody；By bacterial context or the spore of ejection, opening
Put and be positioned under environment in the PDA culture medium of sterilizing, cultivated 7 days under the conditions of 25 DEG C.
3. the isolation and purification method of wild Bachu mushroom mycelium according to claim 2, it is characterised in that：Described wild bar
The bacterial context of Chu's mushroom fruitbody and the weight ratio of PDA culture medium are 1:90-100；The spore of the wild Bachu mushroom ejection
Sterilized water inoculum concentration is 0.1-0.5 ‰.
4. the isolation and purification method of wild Bachu mushroom mycelium according to claim 1, it is characterised in that：The characteristic training
The concentration of glucose for supporting base is 0.02g/mL；It is thiamine, gentamicin sulphate, penicillin in the Characteristic education base, new
The concentration of mycin is 0.001mg/mL.
5. the isolation and purification method of wild Bachu mushroom mycelium according to claim 1, it is characterised in that：The step
(2) in, the inoculum concentration of heterozygosis mycelia is 1-2 ‰.
6. the isolation and purification method of wild Bachu mushroom mycelium according to claim 1, it is characterised in that：The step
(3) in, the inoculum concentration of the mycelia is 1-2 ‰.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201510593514.7A CN105219652B (en) | 2015-09-17 | 2015-09-17 | A kind of isolation and purification method of wild Bachu mushroom mycelium |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201510593514.7A CN105219652B (en) | 2015-09-17 | 2015-09-17 | A kind of isolation and purification method of wild Bachu mushroom mycelium |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN105219652A CN105219652A (en) | 2016-01-06 |
| CN105219652B true CN105219652B (en) | 2018-02-23 |
Family
ID=54988924
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201510593514.7A Active CN105219652B (en) | 2015-09-17 | 2015-09-17 | A kind of isolation and purification method of wild Bachu mushroom mycelium |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN105219652B (en) |
Families Citing this family (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN107619792B (en) * | 2017-10-25 | 2018-07-06 | 翔天农业开发集团股份有限公司 | A kind of edible fungus species purification and rejuvenation technology |
| CN109055230B (en) * | 2018-07-05 | 2021-07-13 | 上海市农业科学院 | Method for obtaining wild strain of rare medicinal Marasmius androsaceus |
| CN109355200A (en) * | 2018-11-19 | 2019-02-19 | 浙江海洋大学 | A kind of isolation and purification method of the small bolete mycelia of sky handle |
| CN109355201A (en) * | 2018-11-20 | 2019-02-19 | 浙江海洋大学 | A kind of isolation and purification method of the dark red mushroom silk of purple |
| CN110577900A (en) * | 2019-09-25 | 2019-12-17 | 山西农业大学 | strain separation, purification and identification method based on dried Tai mushroom fruiting body |
Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| KR20120101858A (en) * | 2011-03-07 | 2012-09-17 | 박동국 | The method of mushroom mycelium using of onion and grape |
| CN103667478A (en) * | 2013-12-05 | 2014-03-26 | 上海市农业科学院 | Identification method for wild oudemansiella species |
| CN103858668A (en) * | 2013-11-29 | 2014-06-18 | 昆明菌苑食品有限公司 | Agaricus vaporarius strain and preparing method of agaricus vaporarius strain |
| CN104521567A (en) * | 2014-12-25 | 2015-04-22 | 新疆大学 | Method for isolated culture of artificial strains of Helvella leucopus Pers |
-
2015
- 2015-09-17 CN CN201510593514.7A patent/CN105219652B/en active Active
Patent Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| KR20120101858A (en) * | 2011-03-07 | 2012-09-17 | 박동국 | The method of mushroom mycelium using of onion and grape |
| CN103858668A (en) * | 2013-11-29 | 2014-06-18 | 昆明菌苑食品有限公司 | Agaricus vaporarius strain and preparing method of agaricus vaporarius strain |
| CN103667478A (en) * | 2013-12-05 | 2014-03-26 | 上海市农业科学院 | Identification method for wild oudemansiella species |
| CN104521567A (en) * | 2014-12-25 | 2015-04-22 | 新疆大学 | Method for isolated culture of artificial strains of Helvella leucopus Pers |
Also Published As
| Publication number | Publication date |
|---|---|
| CN105219652A (en) | 2016-01-06 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN105219652B (en) | A kind of isolation and purification method of wild Bachu mushroom mycelium | |
| Yamanaka et al. | The host ranges of conifer-associated Tricholoma matsutake, Fagaceae-associated T. bakamatsutake and T. fulvocastaneum are wider in vitro than in nature | |
| CN110004069A (en) | A kind of Strain of Beauveria bassiana and its application | |
| CN108260470B (en) | Method for improving mycorrhizal seedling raising of tricholoma matsutake | |
| CN110499386A (en) | A kind of method of quick detection tomato wilt | |
| CN105969652B (en) | Simulating plant suspension cell is metabolized the co-culture device exchanged with its endogenetic fungus | |
| CN108913796A (en) | For detecting Green Fluorescent Protein gene egfp specific primer, kit and the method for green muscardine fungus plant endogenesis | |
| CN117887591A (en) | Boletus edulis growth promoting strain CxBeF11 and application | |
| CN111937680A (en) | New spawn of oospore oudemansiella mucida, artificial cultivation method and application thereof | |
| CN104403952B (en) | A kind of sclerotium oyster mushroom novel bacterial and its cultural method and application | |
| CN105331548B (en) | A kind of Lepista mucla (Bull.:Fr.) Cooke bacterial strain and its liquid spawn and preparation method | |
| CN110343621A (en) | A kind of Trichoderma asperellum strain and its application | |
| CN112772294B (en) | Separation method and application of cordyceps sinensis strain | |
| CN106929433B (en) | Phosphate solubilizing penicillium and application thereof | |
| CN108841748A (en) | Sinorhizobium nitrogen-fixing bacteria strain H6 and its application | |
| CN112111550A (en) | Identification method for grading resistance to peanut bacterial wilt and application of identification method | |
| Li et al. | Advances in artificial inoculation technology for grass-endophytic fungi | |
| CN109971658A (en) | A kind of aspergillus fungi bacterial strain and its application | |
| CN110669675A (en) | Metarhizium anisopliae MANGS71814 and application thereof in control of potato tuber moth | |
| CN110447467A (en) | A kind of fragrance cup umbrella pure culture body strain and its cultural method | |
| CN105779303A (en) | Dendrobium officinale mycorrhizal fungus Arthrinium sp. strain ZJ11C12 and application of dendrobium officinale mycorrhizal fungus Arthrinium sp. strain ZJ11C12 | |
| CN115125175A (en) | Fermentation method and application of efficient mite-killing strain | |
| CN106222097A (en) | A kind of isolation and identification method of sorghum hybrid sudangrass Leaf blotch pathogeny | |
| Antropova et al. | Report of Quambalaria cyanescens in association with the birch (Betula pendula) | |
| CN110862930A (en) | White agrocybe cylindracea and molecular marker identification method thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C41 | Transfer of patent application or patent right or utility model | ||
| CB03 | Change of inventor or designer information |
Inventor after: Li Chuanhua Inventor after: Feng Aiping Inventor after: Zhang Yong Inventor after: Fu Lianjun Inventor after: Wang Jun Inventor after: Wang Haixiao Inventor after: Song Xiaoxia Inventor after: Chen Mingjie Inventor after: Wang Hong Inventor after: Zhang Jinsong Inventor after: Bao Dapeng Inventor after: Shen Xuexiang Inventor after: Xi Liping Inventor before: Li Chuanhua |
|
| COR | Change of bibliographic data | ||
| TA01 | Transfer of patent application right |
Effective date of registration: 20160407 Address after: 201403 Shanghai City, Fengxian District Jin Qi Road No. 1000 Building No. 12. Applicant after: Shanghai Academy of Agricultural Sciences Applicant after: Xinjiang Uygur Autonomous Region Kashgar Prefecture Agricultural Technology Extension Center Address before: 201403 Shanghai City, Fengxian District Jin Qi Road No. 1000 Building No. 12. Applicant before: Shanghai Academy of Agricultural Sciences |
|
| GR01 | Patent grant | ||
| GR01 | Patent grant |