CN103667478A - Identification method for wild oudemansiella species - Google Patents
Identification method for wild oudemansiella species Download PDFInfo
- Publication number
- CN103667478A CN103667478A CN201310654406.7A CN201310654406A CN103667478A CN 103667478 A CN103667478 A CN 103667478A CN 201310654406 A CN201310654406 A CN 201310654406A CN 103667478 A CN103667478 A CN 103667478A
- Authority
- CN
- China
- Prior art keywords
- wild
- aode mushroom
- mushroom
- aode
- sporophore
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
- C12Q1/6895—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms for plants, fungi or algae
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/02—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving viable microorganisms
- C12Q1/04—Determining presence or kind of microorganism; Use of selective media for testing antibiotics or bacteriocides; Compositions containing a chemical indicator therefor
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Organic Chemistry (AREA)
- Health & Medical Sciences (AREA)
- Engineering & Computer Science (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Analytical Chemistry (AREA)
- Biotechnology (AREA)
- Microbiology (AREA)
- Biochemistry (AREA)
- Biophysics (AREA)
- Molecular Biology (AREA)
- Physics & Mathematics (AREA)
- Genetics & Genomics (AREA)
- General Health & Medical Sciences (AREA)
- Immunology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- Botany (AREA)
- Mycology (AREA)
- Toxicology (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
An identification method for wild oudemansiella species comprises: (1) field acquisition; (2) external form identification; (3) microstructure identification; (4) molecular sequence identification; and (5) comprehensive identification by integrating the external form characteristics and the species for comparing the microstructure and the molecular sequences and accurately determining the species of wild oudemansiella. Compared with routine morphological identification, the identification method provided by the invention has the advantages of high identification accuracy and accurate positioning and is representative among identification methods for our country oudemansiella species.
Description
Technical field
The invention belongs to the evaluation field of wild Aode mushroom, particularly a kind of authentication method of wild Aode mushroom kind.
Background technology
China mushroom is identified from 20 beginnings of the century just existing, but always in traditional formalness feature stage, comparatively original, and identify inaccurate, the level that can not navigate in a lot of situations kind.Along with the application of microscope in mushroom is identified, microstructure observing has been applied in the evaluation of mushroom.The combination of formalness and microtexture, makes mushroom identify that accuracy greatly improves.But in a lot of situations, can not accurately distinguish the difference between kind in belonging to, particularly two interior kinds of comparatively similar genus.20 th century later, along with the development of molecular level, molecular sequences is application to some extent in authentication gradually, and particularly in mushroom gene, comparatively conservative ITS sequence is paid attention to gradually in mushroom is identified.In mushroom, Aode mushroom kind is a large monoid, and the Aode mushroom kind of China accounts for a big chunk in the world.And identifying of Chinese Aode mushroom kind is traditional Morphological Identification always, and China is one of country that global species diversity is the abundantest, the wild Aode mushroom kind that China finds increases year by year, simultaneously, the artificial culture of Aode mushroom kind etc. comes into one's own in recent years gradually in market, as Oudemansiella radiata (Relhan.: Fr.) Sing. etc. has occurred in market, and well received, thereby therefore find and identify that to carry out the exploitation of Aode mushroom imperative.And identify that inaccurate present situation has restricted the development of Aode mushroom kind application.Therefore explore and find that the method for new evaluation Aode mushroom kind is extremely urgent.
In the face of this situation, need us further to accelerate the research of wild Aode mushroom Identification of Species technology, in traditional identification research, introduce wild Aode mushroom Identification of Species technology and method more effectively accurately.
Summary of the invention
Technical problem to be solved by this invention is to provide a kind of authentication method of wild Aode mushroom kind, by the novel method that adopts formalness feature, microstructure and molecular sequences to combine, wild Aode mushroom kind is identified.
A kind of wild Aode mushroom authentication method of the present invention, comprises the following steps:
(1) field acquisition
First the wild Aode mushroom sporophore from field acquisition is taken pictures, take and know the positions such as cap, stem, collarium and lamella and sporophore habitat around; After photograph taking, gather the wild sporophore of Aode mushroom, measure and record its formalness feature, and carry out strain separating;
(2) formalness is identified
The formalness feature of the wild Aode mushroom sporophore that step (1) is collected and the formalness feature of existing Aode mushroom sporophore are compared, and find out similar kind;
(3) microtexture is identified
The wild sporophore of Aode mushroom that step (1) is obtained is carried out displaing microstructure observing, and the microstructure of the Aode mushroom of the similar kind then wild Aode mushroom being obtained to step (2) is compared, and finds the similar kind of microstructure;
(4) molecular sequences is identified
1) DNA extraction: extract total DNA, be adjusted to 100ng/ μ L after mensuration concentration standby;
2) pcr amplification: the DNA fragmentation of selecting fungi universal primer ITS1 and ITS4 amplification Aode mushroom ribosome-RNA(rRNA) part 18S, ITS1,5.8S, ITS2 and part 28S; Reaction system total amount 20 μ L, include Taq enzyme 5U, Mg
2+each 200 μ mol/L of 1.5mmol/L, dNTP, primer each 1.0 * 10
-5μ mol, masterplate DNA100ng; 94 ℃ of denaturation 5min of PCR response procedures, 94 ℃ of 50s, 51 ℃ of 50s, 72 ℃ of 1min in 30 circulations, last 72 ℃ are extended 10min.PCR product is through 1.5% agarose gel electrophoresis, and EB dyeing, after gel imaging system is observed, reclaims amplified fragments with reclaiming test kit;
3) PCR order-checking: carry out two-way order-checking through ITS amplified fragments, sequencing result is determined ultimate sequence after comparison splicing;
4) ITS sequential analysis: the sequence having checked order is carried out in Genebank to Blast comparison;
(5) comprehensively identify: the kind of comprehensive formalness feature, microtexture and molecular sequences comparison, comprehensively compare, accurately determine the kind of wild Aode mushroom.
The wild sporophore of Aode mushroom collecting in step (1) is put into fixing utensil in order to avoid damage.
Measurement shown in step (1) is also recorded its formalness feature and is comprised: measure bacteria cover diameter, stem length and diameter, compare and record cap, stem, lamella color and shape with colorimetric card, record its taste and smell.
The concrete operations of the displaing microstructure observing described in step (3) are: the lamella of the wild sporophore of Aode mushroom that selecting step (1) obtains a little, good titration has on the slide glass of 5%KOH solution to put into configured in advance, after the abundant dissolving and reducing of lamella, covered, be placed in the micro-Microscopic observation that amplifies 400 times, observe the microstructural features such as spore, load, cystidium, mycelia, and measure its size, carry out Photomicrograph shooting simultaneously.
The method of the total DNA of extraction described in step (4), for adopting improved method of CTAB to extract total DNA, comprising:
1) by-20 ℃ of cryodesiccated wild Aode mushroom sporophore 0.1g grind into powders, add 2 * CTAB extract of 65 ℃ of preheatings, 65 ℃ insulation 45min more than, or jog mix;
2) 12000rpm, 4 ℃ of centrifugal 20min, get supernatant liquor;
3) add the mixed solution of isopyknic phenol, chloroform and primary isoamyl alcohol, wherein the volume ratio of phenol, chloroform and primary isoamyl alcohol is 25:24:1, mixes gently 10min, 12000rpm, and 4 ℃ of centrifugal 10min, get supernatant liquor and move in new centrifuge tube;
4) add isopyknic chloroform, primary isoamyl alcohol mixed solution, chloroform wherein, the volume ratio of primary isoamyl alcohol are 24:1, mix gently 10min, 12000rpm, and 4 ℃ of centrifugal 10min, get supernatant liquor and move in new centrifuge tube;
5) add the Virahol of-20 ℃ of precoolings of 2/3 volume, shake gently 5min, 8000rpm, 4 ℃ of centrifugal 10min, remove supernatant;
6) ethanol, the 10mmol/L Potassium ethanoate that by precipitation, are 75% successively by percent by volume respectively wash 2～3 times, each 8000rpm, the centrifugal 5min of room temperature;
7) add the ethanol that the percent by volume of precooling is 95%, turn upside down gently, the centrifugal 10min of 8000rpm room temperature, abandons ethanol, and vacuum is drained or naturally dried;
8) add 100uL 10 * TE damping fluid, beat gently and make resolution of precipitate;
9) add RNaseA37 ℃ of water-bath of 1uL 10mg/mL, 1hr, removes RNA, obtains DNA extraction thing, standby in-20 ℃ of refrigerator storages.
Fungi universal primer ITS1 described in step (4) is: 5 '-TCC GTA GGT GAA CCT GCG G-3 ', ITS4 is 5 '-TCC TCC GCT TAT TGA TAT GC-3 '.
In ITS sequential analysis described in step (4), have identical sequence, two kinds of Aode mushroom kinds of comparison are identical.
In ITS sequential analysis described in step (4), sequence similarity degree is lower than 98% or can not find corresponding sequence, is two different Aode mushroom kinds.
Beneficial effect:
Authentication method of the present invention is compared with conventional Morphological Identification, has advantages of that detection accuracy is high, accurate positioning.
Accompanying drawing explanation
The photo of Fig. 1, the wild sporophore of Aode mushroom;
The photo of Fig. 2, the wild sporophore of Aode mushroom;
The Photomicrograph of Fig. 3, Aode mushroom spore;
The Photomicrograph of Fig. 4, Aode mushroom cystidium.
Embodiment
Below in conjunction with specific embodiment, further set forth the present invention.Should be understood that these embodiment are only not used in and limit the scope of the invention for the present invention is described.In addition should be understood that those skilled in the art can make various changes or modifications the present invention after having read the content of the present invention's instruction, these equivalent form of values fall within the application's appended claims limited range equally.
1, field acquisition
Field finds after the wild sporophore of Aode mushroom, first to it from taking pictures, take and know bacteria cover diameter (7.0～16.0cm), first semisphere, rear convex mirror shape is to closely open and flat, smooth surface, sticky when wet, without striped, white powder is to powder yellow (4A2～5A2); Wide 0.4～the 0.6cm of lamella, sparse, slightly curved life is to from life, not isometric, tool lamellula, white powder (3A2～4A2); Stem long (9.0～22.0cm), thick (0.5～1.5cm), middle life is to wilfully, tool collarium, first meta, upper afterwards, base portion slightly expands, non-rhizoid shape, stem middle part tool wart like structure, the nearly brilliant white in top, bottom is light brown to Vandyke brown (5B3-5C4), close drape over one's shoulders light brown to brown scale; Bacterial context white is thin, lightly seasoned.
2, external structure is identified
First collect and search in the world 134 records of all Aode mushroom kinds of delivering and reporting in the world;
2) according to the Aode mushroom sporophore formalness collecting: cap 7.0～16.0cm, convex mirror shape, smooth surface, sticky when wet, white powder is yellow to powder.Wide 0.4～the 0.6cm of lamella, slightly curved life is to from life, white powder; Stem 0.5～1.5 * 9.0～22.0cm, middle life is to wilfully, tool collarium, the nearly brilliant white in top, bottom is light brown to Vandyke brown, close drape over one's shoulders light brown to brown scale.
Tentatively determine that belonging to swollen coral Cordycepps Physalacriceae Aode mushroom belongs to Oudemansiella Speg..
(3) microtexture is identified
Get Aode mushroom lamella a little, put on the slide glass of the good 5%KOH solution of prior titration, after the abundant dissolving and reducing of lamella, covered, is put in the micro-Microscopic observation that amplifies 400 times, observes and find load 17.2～19.6 * 14.7～17.0 μ m, four spores; Sporidium 17.2～19.6 * 14.7～17.0 μ m, oval is to wide ellipse, smooth, colourless; Pleurocystidium and cheilocyst 78.0～122.5 * 14.7～51.5 μ m, long clavate.Pileipellis mycelia is the arrangement of sticky thalamium-palisading type, hyphal diameter 9.8～29.4 μ m; The faint yellow pigment mycelia of tool, hyphal diameter 8.5 μ m.Stem cortex mycelia is closely arranged in parallel, hyphal diameter 3.7～7.4 μ m, tool tawny pigment.Sporophore mycelia is not found clamp connexion.During observation, carry out Photomicrograph shooting.
After displaing microstructure observing, carry out wild Aode mushroom kind to through formalness characteristic ratio to after the microstructure of similar Aode mushroom kind compare, find the similar kind of microstructure, through further identifying, belong to Aode mushroom and belong to the oudemansiella radicata group Section Oudemansiella in Oudemansiella Speg., sticky oudemansiella radicata is basic identical with intending.
(4) molecular sequences is identified
1) DNA extraction: get wild sporophore 0.1g, adopt improved method of CTAB to extract total DNA, be adjusted to 100ng/ μ L after the DNA mensuration concentration after extraction standby;
2) pcr amplification: select fungi universal primer ITS1(5 '-TCC GTA GGT GAA CCT GCG G-3 ') and ITS4(5 '-TCC TCC GCT TAT TGA TAT GC-3 ') DNA fragmentation of amplification Aode mushroom ribosome-RNA(rRNA) part 18S, ITS1,5.8S, ITS2 and part 28S; Reaction system total amount 20 μ L, include Taq enzyme 5U, Mg
2+each 200 μ mol/L of 1.5mmol/L, dNTP, primer each 1.0 * 10
-5μ mol, masterplate DNA100ng; 94 ℃ of denaturation 5min of PCR response procedures, 94 ℃ of 50s, 51 ℃ of 50s, 72 ℃ of 1min in 30 circulations, last 72 ℃ are extended 10min.PCR product is through 1.5% agarose gel electrophoresis, and EB dyeing, after gel imaging system is observed, reclaims amplified fragments with reclaiming test kit.
3) PCR order-checking: ITS amplified fragments carries out two-way order-checking through reclaiming Hou Song company, and sequencing result is determined ultimate sequence after comparison splicing.The wild Aode mushroom sporophore ITS sequence of measuring is as follows.
TAATCAGTTACAGTTGTCTCAGTCAAGAAGACGGTTCGAAGCGGTCGCAAAAACCTTTCACAGAGTCGCATAGGTATCTCTCCAGAGGAGAGAACACAAAGGGAGCCGTGAGGCAAACCCTTCAAACACCCGAGCTCTGCCAACACTCTGAACCAAGCTAGCTTAGATATTATCACAGCTTAGCGTAGCCCAAGTAATGGTTCGTACTGCTAATGCATTTCAGAGGAGCTGAACCCATTGAAAGGTCCGGCAGGCCTCCACCATCCAACACCATTCGAACTCGAAAAACAAGTAAGAAGGGTTGAGAGTTTACTGACACTCAAACAGGCATGCCCTTCGGAATACCAAAGGGCGCAAGGTGCGTTCAAAGACTCGATGATTCACTGAATTCTGCAATTCACATTAGTTATCGCATTTCGCTGCGTTCTTCATCGATGCGAGAGCCAAGAGATCCGTTGTTGAAAGTTGTATTAAGTTGTTTTAGAGGACGGTGAAGTCCCATAAACGAAGACATTCTAAACATGCAAGAGATGATATGAAGCATAGACCCGGAGGAAACGAAAGGAGGCGAACCTCACCTTCAACCCCAACCAGATCTACAAAAGGTGCACAGGTGGACAAAGAAGAGGCGAGCGACTTCAAAACGTGCACATACTCAAGAGTCAGCAACAGAAGTGAAGCCACAAGCGT。
ITS sequence size: 690bp.
ITS sequential analysis: the sequence having checked order is carried out in Genebank to Blast, do not find same or analogous Aode mushroom ITS sequence.
Qualification result: in conjunction with the kind of formalness feature, microtexture and molecular sequences comparison, relatively comprehensive, the wild Aode mushroom sporophore collecting is for intending sticky oudemansiella radicata Oudemansiella submucida Corner, belong to Aode mushroom and belong to Oudemansiella Speg., swollen coral Cordycepps Physalacriceae.
Claims (8)
1. a wild Aode mushroom authentication method, comprises the following steps:
(1) field acquisition
First the wild Aode mushroom sporophore from field acquisition is taken pictures, take and know cap, stem, collarium and lamella and sporophore habitat around; After photograph taking, gather the wild sporophore of Aode mushroom, measure and record its formalness feature, and carry out strain separating;
(2) formalness is identified
The formalness feature of the wild Aode mushroom sporophore that step (1) is collected and the formalness feature of existing Aode mushroom sporophore are compared, and find out similar kind;
(3) microtexture is identified
The wild sporophore of Aode mushroom that step (1) is obtained is carried out displaing microstructure observing, and the microstructure of the Aode mushroom of the similar kind then wild Aode mushroom being obtained to step (2) is compared, and finds the similar kind of microstructure;
(4) molecular sequences is identified
1) DNA extraction: extract total DNA, be adjusted to 100ng/ μ L after mensuration concentration standby;
2) pcr amplification: the DNA fragmentation of selecting fungi universal primer ITS1 and ITS4 amplification Aode mushroom ribosome-RNA(rRNA) part 18S, ITS1,5.8S, ITS2 and part 28S; Reaction system total amount 20 μ L, include Taq enzyme 5U, Mg
2+each 200 μ mol/L of 1.5mmol/L, dNTP, primer each 1.0 * 10
-5μ mol, masterplate DNA100ng; 94 ℃ of denaturation 5min of PCR response procedures, 94 ℃ of 50s, 51 ℃ of 50s, 72 ℃ of 1min in 30 circulations, last 72 ℃ are extended 10min;
3) PCR order-checking: carry out two-way order-checking through ITS amplified fragments, sequencing result is determined ultimate sequence after comparison splicing;
4) ITS sequential analysis: the sequence having checked order is carried out in Genebank to Blast comparison;
(5) comprehensively identify: the kind of comprehensive formalness feature, microtexture and molecular sequences comparison, comprehensively compare, accurately determine the kind of wild Aode mushroom.
2. a kind of wild Aode mushroom authentication method according to claim 1, is characterized in that: the wild sporophore of Aode mushroom collecting in step (1) is put into fixing utensil in order to avoid damage.
3. a kind of wild Aode mushroom authentication method according to claim 1, it is characterized in that: the measurement shown in step (1) is also recorded its formalness feature and comprised: measure bacteria cover diameter, stem length and diameter, compare with colorimetric card and record cap, stem, lamella color and shape, recording its taste and smell.
4. a kind of wild Aode mushroom authentication method according to claim 1, it is characterized in that: the concrete operations of the displaing microstructure observing described in step (3) are: the lamella of the wild sporophore of Aode mushroom that selecting step (1) obtains a little, good titration has on the slide glass of 5%KOH solution to put into configured in advance, after the abundant dissolving and reducing of lamella, covered, be placed in the micro-Microscopic observation that amplifies 400 times, observe the microstructural features such as spore, load, cystidium, mycelia, and measure its size, carry out Photomicrograph shooting simultaneously.
5. a kind of wild Aode mushroom authentication method according to claim 1, is characterized in that: the method for the total DNA of extraction described in step (4), for adopting improved method of CTAB to extract total DNA, comprising:
1) by-20 ℃ of cryodesiccated wild Aode mushroom sporophore 0.1g grind into powders, add 2 * CTAB extract of 65 ℃ of preheatings, 65 ℃ insulation 45min more than, or jog mix;
2) 12000rpm, 4 ℃ of centrifugal 20min, get supernatant liquor;
3) add the mixed solution of isopyknic phenol, chloroform and primary isoamyl alcohol, wherein the volume ratio of phenol, chloroform and primary isoamyl alcohol is 25:24:1, mixes gently 10min, 12000rpm, and 4 ℃ of centrifugal 10min, get supernatant liquor and move in new centrifuge tube;
4) add isopyknic chloroform, primary isoamyl alcohol mixed solution, chloroform wherein, the volume ratio of primary isoamyl alcohol are 24:1, mix gently 10min, 12000rpm, and 4 ℃ of centrifugal 10min, get supernatant liquor and move in new centrifuge tube;
5) add the Virahol of-20 ℃ of precoolings of 2/3 volume, shake gently 5min, 8000rpm, 4 ℃ of centrifugal 10min, remove supernatant;
6) ethanol, the 10mmol/L Potassium ethanoate that by precipitation, are 75% successively by percent by volume respectively wash 2～3 times, each 8000rpm, the centrifugal 5min of room temperature;
7) add the ethanol that the percent by volume of precooling is 95%, turn upside down gently, the centrifugal 10min of 8000rpm room temperature, abandons ethanol, and vacuum is drained or naturally dried;
8) add 100uL 10 * TE damping fluid, beat gently and make resolution of precipitate;
9) add 37 ℃ of water-baths of 1uL 10mg/mL RNaseA, 1hr, removes RNA, obtains DNA extraction thing.
6. a kind of wild Aode mushroom authentication method according to claim 1, it is characterized in that: the fungi universal primer ITS1 described in step (4) is: 5 '-TCC GTA GGT GAA CCT GCG G-3 ', ITS4 is 5 '-TCC TCC GCT TAT TGA TAT GC-3 '.
7. a kind of wild Aode mushroom authentication method according to claim 1, is characterized in that: in the ITS sequential analysis described in step (4), have identical sequence, two kinds of Aode mushroom kinds of comparison are identical.
8. a kind of wild Aode mushroom authentication method according to claim 1, is characterized in that: in the ITS sequential analysis described in step (4), sequence similarity degree is lower than 98% or can not find corresponding sequence, is two different Aode mushroom kinds.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201310654406.7A CN103667478B (en) | 2013-12-05 | 2013-12-05 | Identification method for wild oudemansiella species |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201310654406.7A CN103667478B (en) | 2013-12-05 | 2013-12-05 | Identification method for wild oudemansiella species |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN103667478A true CN103667478A (en) | 2014-03-26 |
| CN103667478B CN103667478B (en) | 2015-07-08 |
Family
ID=50306247
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201310654406.7A Active CN103667478B (en) | 2013-12-05 | 2013-12-05 | Identification method for wild oudemansiella species |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN103667478B (en) |
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN105219652A (en) * | 2015-09-17 | 2016-01-06 | 上海市农业科学院 | A kind of separation purification method of wild Bachu mushroom mycelium |
| CN106636433A (en) * | 2017-01-24 | 2017-05-10 | 华南农业大学 | High-throughput mulberry pathogenic bacteria identification and species classification method and application thereof |
Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN103298953A (en) * | 2010-10-28 | 2013-09-11 | 株式会社雪国舞茸 | Method for selecting fungus body and kit |
-
2013
- 2013-12-05 CN CN201310654406.7A patent/CN103667478B/en active Active
Patent Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN103298953A (en) * | 2010-10-28 | 2013-09-11 | 株式会社雪国舞茸 | Method for selecting fungus body and kit |
Non-Patent Citations (2)
| Title |
|---|
| 刘如铟等: ""裸盖菇属的真菌鉴定及分子系统学初探"", 《微生物学通报》, vol. 33, no. 2, 28 February 2006 (2006-02-28) * |
| 孙晓琳等: ""双孢奥德蘑的形态鉴定及ITS系统发育分析"", 《资源开发与市场》, vol. 29, no. 4, 30 April 2013 (2013-04-30) * |
Cited By (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN105219652A (en) * | 2015-09-17 | 2016-01-06 | 上海市农业科学院 | A kind of separation purification method of wild Bachu mushroom mycelium |
| CN105219652B (en) * | 2015-09-17 | 2018-02-23 | 上海市农业科学院 | A kind of isolation and purification method of wild Bachu mushroom mycelium |
| CN106636433A (en) * | 2017-01-24 | 2017-05-10 | 华南农业大学 | High-throughput mulberry pathogenic bacteria identification and species classification method and application thereof |
| CN106636433B (en) * | 2017-01-24 | 2020-04-14 | 华南农业大学 | Mulberry pathogenic bacterium high-throughput identification and species classification method and application thereof |
Also Published As
| Publication number | Publication date |
|---|---|
| CN103667478B (en) | 2015-07-08 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Redondo et al. | Winter conditions correlate with Phytophthora alni subspecies distribution in Southern Sweden | |
| Nouhra et al. | The species of Scleroderma from Argentina, including a new species from the Nothofagus forest | |
| CN101775440A (en) | Plasmid control molecule for detection of transgenic soybean and building method thereof | |
| Teasdale et al. | Environmental barcoding of the ectomycorrhizal fungal genus Cortinarius | |
| Corsie et al. | No combination of morphological, ecological or chemical characters can reliably diagnose species in the Parmelia saxatilis aggregate in Scotland | |
| Clasen et al. | Characterization of ectomycorrhizal species through molecular biology tools and morphotyping | |
| Reimer et al. | Preliminary molecular examination of zooxanthellate zoanthid (Hexacorallia, Zoantharia) and associated zooxanthellae (Symbiodinium spp.) diversity in Singapore | |
| Salmaso et al. | DNA sequence and taxonomic gap analyses to quantify the coverage of aquatic cyanobacteria and eukaryotic microalgae in reference databases: Results of a survey in the Alpine region | |
| Mattupalli et al. | Digital imaging to evaluate root system architectural changes associated with soil biotic factors | |
| Lawrey et al. | Phylogenetic diversity of bulbil-forming lichenicolous fungi in Cantharellales including a new genus and species | |
| Diederich et al. | New lichen-associated bulbil-forming species of Cantharellales (Basidiomycetes) | |
| CN103436605B (en) | Molecular detection method for rapidly differentiating mating type of Villosiclavavirens | |
| CN103667478B (en) | Identification method for wild oudemansiella species | |
| Montoya et al. | Two new species of Phylloporus (Fungi, Boletales) from tropical Quercus forests in eastern Mexico | |
| Suetsugu et al. | Mycorrhizal communities of two closely related species, Pyrola subaphylla and P. japonica, with contrasting degrees of mycoheterotrophy in a sympatric habitat | |
| Durán-Valle et al. | Identification of clinical yeasts by Vitek MS system compared with API ID 32 C | |
| San-Fabian et al. | New species of Cortinarius sect. Austroamericani, sect. nov., from South American Nothofagaceae forests | |
| Glotova et al. | High Genetic Diversity of Amoebae Belonging to the Genus Mayorella (Amoebozoa, Discosea, Dermamoebida) in Natural Habitats. | |
| Zhao et al. | Biodiversity patterns of soil ciliates along salinity gradients | |
| Magyar et al. | Mycoceros antennatissimus gen. et sp. nov.: a mitosporic fungus capturing pollen grains | |
| Yurchenko et al. | Fibrodontia alba sp. nov.(Basidiomycota) from Taiwan | |
| Hosen et al. | Pluteus brunneoalbus, a new species, and P. sepiicolor, a new record for China | |
| Lefkaditou et al. | On the occurrence of Alloteuthis subulata in the Eastern Ionian Sea and its distinction from the sympatric Alloteuthis media | |
| CN103468803B (en) | Rapid detection method for aureococcus anophagefferens | |
| SINNIGER | Zoantharia of New Caledonia |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C14 | Grant of patent or utility model | ||
| GR01 | Patent grant |