CN105200063B - One little Bloch space gene TaRab18 and its expression vector and application - Google Patents

Abstract

The invention belongs to genetic engineering fields, disclose a little Bloch space gene TaRab18 and its expression vector and application.The cDNA sequence of little Bloch space gene TaRab18 is SEQ ID NO.1 and its amino acid sequence of coding is SEQ IDNO.2.The gene comes from common wheat (Triticum asetivum L.) 92R137.TaRab18 is enhanced in stripe rust resisting wheat kind 92R137 by strip rust bacteria induced expression, and expression is far above the expression in susceptible wheat breed Yangmai No.158.Gene insertion pBI220 is obtained into Overexpression vector, and converts sense stripe rust wheat breed Yangmai No.158, the T1 of positive transformants plant shows that the overexpression of TaRab18 can improve resistance of the sense stripe rust wheat breed to stripe rust for stripe rust resisting qualification result.

Description

One little Bloch space gene TaRab18 and its expression vector and application

Technical field

The invention belongs to genetic engineering fields, disclose a little Bloch space gene TaRab18 and its expression vector And application.

Background technology

Wheat (Triticum aestivum L.) stripe rust is by wheat stripe rust (Puccinia striiformis F.sp.tritici a kind of serious wheat diseases of harm caused by), a countries and regions generally occur more than 60 in the world.It is small Wheat yellow rust mainly occurs on wheat leaf blade, can also occur with glume on leaf sheath and stem and on fringe portion awns.Wheat item becomes rusty Disease has the characteristics that explosive strong, popular frequency height, spread speed is fast, prevention difficulty is big, occurrence scope is wide, harm is serious. In the general prevalence time, stripe rust of wheat can make wheat yield 20%-30%, and time of being very popular, production loss reach 50%- 60% in addition total crop failure.China is not only Epidemics of Wheat Strip Rust area maximum in the world and a relatively independent Endemic Area System, and have oneself unique advantage microspecies.1950th, stripe rust of wheat in 1964,1990,2002,2003 and 2009 is in China It is a wide range of popular, and cause disaster in most of time partial onsets.Past 10 years, there are about 4,000,000 hectares of Wheat Species every year on average Plant area is influenced be subject to stripe rust of wheat.

Selection and breeding for many years and popularization disease-resistant wheat kind are always that pathology of plants man and breeder endeavour to solve and prevent The main means of stripe rust of wheat, although quite becoming effective, since wheat stripe rust has the hereditary variability of height, in addition small The unification large area plantation of kind specialization disease-resistant variety, necessarily causes new dominant races to generate and send out in strip rust bacteria population Exhibition, ultimately results in the forfeiture of original varietal resistance.Kind rust quality " is lost " repeatedly, is to cause stripe rust repeatedly pandemic Main cause, kind rust quality, which loses problem, has become a global problem in Wheat Production.Therefore, stripe rust of wheat is strengthened The theoretical research on digging utilization and the resistant heredity basis of disease-resistant new gene, selection and breeding stripe rust resisting kind, so as to effectively prevent Stripe rust of wheat pandemic is very urgent.

Wheat breed 92R137 has contained Stripe Rust Resistance Gene Yr26, since 1994 into domestic breeding utilization, Yr26 In Sichuan, Yunnan, Shaanxi etc., stripe rust Chang Faqu is planted for many years, and stable highly resistant is shown to stripe rust, It is especially high to 29,30,32 performances in wheat stripe rust dominant races item anti-immune.Therefore, carry out stripe rust interaction mechanism to grind Study carefully and the clone of important stripe rust resisting related gene, be of great significance for stripe rust breeding for disease resistance.The present invention utilizes wheat Biochip technology understands the allelic expression of wheat and strip rust bacteria interaction from transcript profile level, therefrom screened one The gene TaRab18 of 10 times of up-regulated expression or more in 92R137, which, which is transferred in sense stripe rust wheat breed Yangmai No.158, makes Gene overexpression is remarkably improved the stripe rust resistance of wheat.TaRab18 genes overexpression carrier provided by the invention is Carry out stripe rust resisting wheat genetic engineering breeding and basis is provided.

The content of the invention

The purpose of the present invention is being directed to the drawbacks described above of the prior art, a kind of little Bloch space gene TaRab18 is provided Expression vector and application.

The purpose of the present invention can be achieved through the following technical solutions：

Little Bloch space gene TaRab18 comes from common wheat (Triticum asetivum L.) 92R137, core Nucleotide sequence is SEQ ID NO.1.

The protein of the little Bloch space gene is TaRab18, and amino acid sequence is SEQ ID NO.2.

The recombinant expression carrier of the TaRab18 of gene containing little Bloch space.

The recombinant expression carrier is preferably using pBI220 as the carrier that sets out, by TaRab18 genes insertion pBI220's Gained between BamH1 and KpnI restriction enzyme sites.

The expression vector of the TaRab18 of gene containing little Bloch space is in stripe rust resisting wheat kind is built Using.

Advantageous effect

The present invention is cloned from wheat has obtained a little Bloch space gene TaRab18 and its encoded albumen Matter TaRab18, the gene, by strip rust bacteria induced expression, and raise wheat in containing stripe rust resisting wheat 92R137 in susceptible wheat From strip rust bacteria induced expression in 158.TaRab18 is inserted into overexpression vector pBI220, and imports susceptible wheat breed and raises wheat In 158, resistance of the Yangmai No.158 to stripe rust can be improved.TaRab18 is used for genetic engineering breeding, is conducted into susceptible item rust In sick wheat kind, the stripe rust resistance of wheat can be improved.

Description of the drawings

The RACE of Fig. 1, Ta.1763.2.S1 and genome amplification result

A：5 ' and 3 ' RACE amplifications；B：Full length gene primer amplification result.

Rab18/RABC1 albumen conserved structure domain analysis in Fig. 2, TaRab18 and plant

That underscore marks is the several conservative subdomains of TaRab18, G1, G3, G4 and G5, is GTP/GDP binding domain.

Fig. 3, the expression using Q-PCR analysis TaRab18 in stripe rust resisting 92R137 and sense stripe rust Yangmai No.158

Abscissa represents wheat leaf blade sample when strip rust bacteria induction 0,6,12,24,48,72 is small.

The structure of Fig. 4, TaRab18 overexpression carrier

A：Plant expression vector pBI220；B：Recombinate overexpression vector pBI220:TaRab18

Fig. 5, pBI220:TaRab18 partial transgenic plant T0 are for PCR Molecular Identifications

3-14：Transfer-gen plant (4,7,9,10,13 be positive plant, remaining is negative plant), 1：Water compares, and 2：Plasmid Control, 3：Yangmai No.158 compares, M：DL2000DNA standard molecular weights

Fig. 6, TaRab18 convert the T of Yangmai No.158₁It is identified for the stripe rust resistance of positive plant

1：Disease-resistant control 92R137,2：Susceptible control Yangmai No.158,3-6：Resistance strain

Specific embodiment

Embodiment 1 is had cloning for the gene TaRab18 of GTP/GDP combinations by strip rust bacteria induced expression

It is small using gene chip hybridization method screening stripe rust resisting in order to clone the disease-resistant related gene in the disease-resistant approach of Yr26 Wheat 92R137 and the difference expression gene in sense stripe rust wheat Yangmai No.158.Therefrom repeatedly screening obtains 10 times of a up-regulated expression EST probes Ta.1763.2.S1_at.Based on this probe sequence, the amplified production of expected length has been obtained by RACE (Figure 1A), sequence length is 1015bp after splicing.According to splicing sequence design overall length primer P1 (CCAGCCATGGACTCTTCTTC, SEQ ID NO.3), P2 (AGCTGAAAGCTGCCAAGGTA, SEQ ID NO.4).With anti- Sick wheat 92R137cDNA is template, and the amplified production (Figure 1B) of expected length 826bp is obtained by RT-PCR, and by its time It receives, clone, sequencing, amplified production is consistent with splicing sequence.It is analyzed through ORF finder, 88~748- of cDNA sequence code area Bp, long 660-bp, sequence is as shown in SEQ ID NO.1.Encode 217 amino acid, amino acid sequence such as SEQ ID NO.2 institutes Show.Through SMART softwares (http://smart.embl-heidelberg.de/) analysis, TaRab18 encoding proteins sequence is with 4 (GTP/GDP combines required binding domain (i.e. G1, phosphoric acid combination windingGDSGVG；G3 coordinates γ the and β phosphoric acid motifs of GTPDTAGQ；G4 strengthens guanine binding motifGNKVD；G5 helps guanine association and dissociation motifECSAR), 2 molecules open Close (I/G2 of Switch；Switch II) and 1 C-terminal membrane positioning signal-isopentene group motif (CC) (Fig. 2), wherein structural domain (YRGA) it is that plant is peculiar.The protein sequence and the RABC1/Rab18cDNA sequence identities in false bromegrass, corn and arabidopsis It is TaRab18 up to 89%, 86% and 85%, therefore by the unnamed gene.

The expression characteristic that 2 TaRab18 genes of embodiment are induced by strip rust bacteria is analyzed

In order to study expression patterns of the TaRab18 in anti-sense stripe rust material, disease-resistant material 92R137 and susceptible is utilized RNA reverse transcription cDNA of the material Yangmai No.158 through strip rust bacteria induction 0,6,12,24,72 when small is template, utilizes P3 (CGCAGCCGGACTTCGACTACC, SEQ ID NO.5) and P4 (CCCAGACGGCGAGCTTGAGC, SEQ ID NO.6) are to draw Object carries out real-time fluorescence quantitative PCR (Q-PCR) and analyzes.PCR programs are：PCR reaction real-time fluorescence quantitative PCR instrument (MyIQ, Bio-Rad companies, the U.S.) on expand and detect fluorescence.The PCR containing 2 × SYBR Green in 20uL PCR reaction systems Master Mix 10uL, 0.5 μM of primer P3 and P4, reverse transcription cDNA templates 2uL.Amplification is：95 DEG C 10 minutes, then 95 DEG C 15 seconds, 60 DEG C 30 seconds, 72 DEG C 1 minute, totally 40 cycle.After reaction, the measure of melting curve is carried out.Detect gene Expression is analyzed with MyiQ system softwares.The result shows that in 92R137, TaRab18 is by strip rust bacteria inducible up regulation table Reach, 6 it is small when up-regulation it is notable, expression highest after 36h, 48 and 72 it is small when expression declined；In Yangmai No.158, TaRab18 does not have There is the feature by strip rust bacteria induced expression, the expression quantity of each period is below the expression quantity (Fig. 3) in 92R137.

3 TaRab18 overexpression vectors of embodiment build and its convert common wheat Yangmai No.158 and stripe rust resisting identification

Using the cDNA from 92R137 as template, with the full length gene sequence design of TaRab18 across the primer P5 of ORF (ATCCCGGGTATGGTTGAGTGCACAATGG, SEQ ID NO.7) and P6 (ATAGGTACCGAGCCTAGATCTTCAGCAGA, SEQ ID NO.8), and P5 carries the restriction enzyme site of BamH1, P6 carries the restriction enzyme site of KpnI.Using primer pair P5 and P6 into Row PCR amplification recycles amplified fragments.Double digestion is carried out to amplified production with BamH1 and KpnI, digestion products are inserted into SmaI With carrier pBI220 (Jefferson RA, Kavanagh TA, the Bevan MW.GUS fusions after KpnI double digestions: beta-glucuronidase as a sensitive and versatile gene fusion marker in higher plants.EMBO J.1987,6:In 3901-3907.), TaRa b18 are placed at the multiple cloning sites behind 35S promoter, Replace carrier per se with gus gene.Thus target gene TaRab18 is cloned into the downstream of strong promoter 35S, obtained Expression vector pBI220:TaRab18 (Fig. 4).

The method for transformation that sense stripe rust receptor is transferred to using gene gun conversion method TaRab18 is as follows：1st, picking preculture 7 Its about 2000 pieces of Yangmai No.158 Immature embryo callis, hypertonic culture medium (MS+ABA0.5mg/L+ caseinhydrolysate 500mg/L+2, 4-D 2mg/L+ glucose 30g/L+0.4mol/L mannitol, pH5.8) on pretreatment 4-5 it is small when；2nd, target gene will be carried The Overexpression vector pBI220 of TaRab18:TaRab18 is transformed into Yangmai No.158 callus by particle bombardment, bombardment Afterwards continue on hypertonic culture medium culture 16 it is small when.3rd, callus is transferred to recovery media (1/2MS+ caseinhydrolysates 500mg/L+2,4-D2mg/L+ sucrose 30g/L, pH5.8) on light culture 2 weeks；4th, callus is transferred to containing herbicide (1/2MS+ABA0.5mg/L+ caseinhydrolysate 500mg/L+2,4-D1mg/L+ sucrose 30g/L+4mg/ on screening and culturing medium LBialaphos, pH5.8) screening and culturing 2 weeks；5th, the callus with Herbicid resistant is transferred in differential medium (1/2MS+L- paddy ammonia phthalein amine 1mmol/L+ caseinhydrolysate 200mg/L+KT 1mg/L+IAA 0.5mg/L+ sucrose 30g/L+ fine jades Fat 0.8%, pH5.8) broken up, root media (1/2MS+KT 1mg/L are transferred them to when Bud Differentiation length is to 2-4cm + sucrose 30g/L+ agar 0.8%, pH5.8) in.6th, to regrowth be about 8cm, root system it is more healthy and stronger when, you can open pipe hardening 1-2 My god, basin alms bowl can be transplanted by finally washing away the culture based draff of root system carrying.Obtain regeneration plant totally 253.

All regeneration plant genomic DNAs are extracted, promoter internal primer P7 is utilized to transformed plant (AGTTCATTTCATTTGGAGAGAACAC, SEQ ID NO.9) and gene internal primer P8 (CTGGTTTGTCGAATACAGGT, SEQ ID NO.10) PCR amplification is carried out, to identify positive plant.PCR programs：10-50ng genomic DNA templates, 10 μM of P5 With each 0.5 μ l of P6；2.5μl 10×buffer；The dNTP of 2.5 μ l 2.5mM；The Mg2+ of 1.5 μ l 25mM；0.25μl(5U/μl) Taq polymerase (TaKaRa) add water to 25 μ l.PCR reaction conditions are：94 DEG C of pre-degenerations 3 minutes；94 DEG C 45 seconds, 55 DEG C 45 seconds, 72 DEG C 2 minutes, 33 cycle；72 DEG C extend 10 minutes.PCR product is detected through 1% agarose gel electrophoresis.Wherein 64 plants of purpose bands that can expand about 500bp, are accredited as positive plant.Fig. 3 show the screening of some positive plant, from 12 4 plants of positive plants are identified in strain transfer-gen plant.After TaRab18 transgenosis T0 divides single plant to receive for positive plant, by the positive The T1 of single plant in earthen basin, per 20 seeds of basin, and sets 92R137 and Yangmai No.158 to compare for seed kind, and kind growth case treats two Ye Qi is inoculated with 32 in toxicity strip rust bacteria microspecies item, and sick grade investigation is carried out after fully falling ill with reference to control Yangmai No.158.As a result table It is bright：6 strain performances are disease-resistant.Disease-resistant adjoining tree 92R137 shows strip rust bacteria highly resistance, and hypersensitive necrosis spot is generated on blade, Without spore growth；Susceptible adjoining tree Yangmai No.158 shows height to strip rust bacteria and feels, no hypersensitive necrosis spot, is covered with item rust on blade Bacterium spore (Fig. 4).More than qualification result shows：Overexpressions of the TaRab18 in susceptible material can improve the item of susceptible material Rust resistance, the gene can be used for cultivating stripe rust resisting wheat using genetic engineering means.

Claims (6)

1. small GTP binding-protein genes TaRab18, from common wheat（Triticum asetivum L.）92R137, it is special Sign is its ORF sequence as shown in SEQ ID NO.1.

2. the protein of the gene TaRab18 codings described in claim 1, it is characterised in that amino acid sequence is SEQ ID NO.2。

3. the recombinant expression carrier containing the gene TaRab18 described in claim 1.

4. recombinant expression carrier according to claim 3, it is characterised in that, will be described using pBI220 as the carrier that sets out Gained between BmaH1 the and KpnI restriction enzyme sites of gene TaRab18 insertions pBI220.

5. applications of the gene TaRab18 in stripe rust resisting wheat kind is built described in claim 1.

6. application of the recombinant expression carrier in stripe rust resisting wheat kind is built described in claim 3 or 4.