CN105018497B - The vegetable seeds specific expression promoter OsSee2 of embryo strongly expressed - Google Patents
The vegetable seeds specific expression promoter OsSee2 of embryo strongly expressed Download PDFInfo
- Publication number
- CN105018497B CN105018497B CN201510493310.6A CN201510493310A CN105018497B CN 105018497 B CN105018497 B CN 105018497B CN 201510493310 A CN201510493310 A CN 201510493310A CN 105018497 B CN105018497 B CN 105018497B
- Authority
- CN
- China
- Prior art keywords
- ossee2
- promoter
- vegetable seeds
- rice
- specific expression
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Expired - Fee Related
Links
Landscapes
- Breeding Of Plants And Reproduction By Means Of Culturing (AREA)
Abstract
The present invention discloses vegetable seeds specific expression promoter OsSee2 and its application of an embryo strongly expressed.The promoter of the present invention is with SEQ ID No in sequence table：Sequence in 1 and 2 is basic sequence, and is extended on this basis.The present invention contains the various variations of above-mentioned two sequence, has the sequence of promoter function in especially various variations.Present invention also offers the vegetable seeds specific expression promoter OsSee2 containing the embryo strongly expressed expression cassette and plant expression vector and be applied in plant genetic engineering.In addition, present invention also offers one group of primer pair dedicated for the amplification promoter of the present invention from Nipponbare rice.Research of the promoter of the present invention for rice paddy seed correlation molecule mechanism has important theory and practical significance.
Description
Technical field
The present invention relates to biotechnology and field of plant genetic.Specifically, the present invention relates to embryo strongly expressed
Vegetable seeds specific expression promoter OsSee2.
Background technology
Rice is one of most important cereal crops of the current mankind, in the world more than 1/3rd population all using rice as
Staple food.With expanding economy, increasingly higher demands are proposed to yield of brown rice and quality in global range.Thus using each
Kind of method improves rice yield, improvement rice quality, there is extremely important meaning.Pass through molecular biology and gene work
The means of journey go research and Crop Improvement to have good application prospect in agricultural production.In recent years, plant genetic engineering
Research achieves the progress advanced by leaps and bounds, and has become an important methods and techniques in modern biology and thremmatology.
For the seed of rice as main Leaf-feeding insects, it is very close with the production and living relation of the mankind, therefore becomes and plant
The important goal material improved in thing genetic engineering.The foreign gene of conversion in Plant accepter tissue can correctly, it is high
Imitate and specifically to express be the problem of people pay special attention to according to the wish of people.Preferable genetically modified plants generally require external source
Gene high level expression in privileged site and special time, produce it is intended that phenotypic character.Promoter is determining gene
Play a crucial role in terms of expression.Promoter is to determine the key element of transcripting start point and transcription frequency.To promoter structure and
The research of function, not only has important theory significance to the mechanism for studying gene expression regulation, but also to utilizing genetic engineering
Method improvement crop has important practice significance.It is also special suitable there are some in addition to containing basic promoter in promoter
Formula regulating element, these cis regulatory elements play a significant role in the specifically expressing of gene.Seed-specific expression promoter is upper
There are the regulation and control seed specific gene expression of some specific elements for trip.
Expressed using seed specific promoters controlling gene, expression quantity of the gene at these positions can be improved, by biology
Energy consumption is preferably minimized, and using the separation of expression product, and can purposefully improve the nutrition or improvement of transgenic plant seed
Its quality.Tomlinson etc. mediates yeast cane sugar enzyme gene specifically expressing in oilseed using napin promoters, significantly
Invertase content is added, the accumulation of oily substance substantially increases (Tomlinson etc., 2004)；Hornung etc. is opened using USP
Mover driving polycyclic fatty acid isomerase gene is expressed in tobacco, as a result Transgenic Tobacco Seeds Linoleic acid conjugate content
Increase substantially (Hornung etc., 2005)；Holmberg etc. drives the sterol methylferase in downstream using ACP gene promoters
Gene is specifically expressed in Transgenic Tobacco Seeds, sterol content in seed is added 44%, corresponding other alcohol
Class material is also significantly increased (Holmberg etc., 2002).
But the research in terms of the promoter carried out currently for EMBRYO IN RICE is not very much, and not on embryo
Report in terms of strong promoter.
The content of the invention
In view of the above-mentioned problems, present inventor thinks, specificity promoter is found for privileged site as embryo
It is necessary.Therefore, for the present invention desirable to provide a kind of embryo-specific promoter, it can efficiently and accurately change rice
Character, the development of regulation and control its growth and yield and improve rice quality.This to plant genetic engineering development and people life
Horizontal raising tool is of great significance.
Specifically, the present invention is desirable to provide a kind of startup for driving foreign gene specific expressed in rice paddy seed
Son, obtain the application containing the transformant of the promoter sequence and the promoter.Wherein, involved " plant " herein is
Refer to monocotyledon, such as rice, wheat, corn, barley, jowar or oat, be preferably rice.
To achieve these goals, on the one hand, the vegetable seeds specifically expressing that the present invention provides an embryo strongly expressed starts
Sub- OsSee2, it is characterised in that the vegetable seeds specific expression promoter OsSee2 is included：
(a)SEQ ID NO:Nucleotide sequence shown in 1；Or
(b) in SEQ ID NO:Substitute in nucleotide sequence shown in 1 it is being obtained after one or more nucleotide and
Nucleotide sequence with promoter function；Or
(c) in SEQ ID NO:Added in nucleotide sequence shown in 1 it is being obtained after one or more nucleotide and
Nucleotide sequence with promoter function；Or
(d)SEQ ID NO:It is being obtained after sequential nucleotide deletion one or more nucleotide shown in 1 and have
The nucleotide sequence of promoter function；Or
(e) with SEQ ID NO:Nucleotide sequence shown in 1 has at least 90% homology, and has promoter function
Nucleotide sequence；Or
(f) under strict conditions with SEQ ID NO:Nucleotide sequence hybridization shown in 1 and with promoter function
Nucleotide sequence；
(g)SEQ ID NO:Nucleotide sequence shown in 2；Or
(h) with SEQ ID NO:Nucleotide sequence shown in 2 with least 90% homology and with promoter work(
The nucleotide sequence of energy；Or
(i) in SEQ ID NO:Substitute in nucleotide sequence shown in 2 it is being obtained after one or more nucleotide and
Nucleotide sequence with promoter function；Or
(j) in SEQ ID NO:Added in nucleotide sequence shown in 2 it is being obtained after one or more nucleotide and
Nucleotide sequence with promoter function；Or
(k) in SEQ ID NO:Obtained after sequential nucleotide deletion one or more nucleotide shown in 2 and tool
There is the nucleotide sequence of promoter function；Or
(l) under strict conditions with SEQ ID NO:Nucleotide sequence hybridization shown in 2 and with promoter function
Nucleotide sequence.
On the other hand, the present invention provides one group and is used to expand the complete of above-mentioned vegetable seeds specific expression promoter OsSee2
Long or its any fragment primer pair.
On the other hand, the present invention provides a kind of recombination expression containing above-mentioned vegetable seeds specific expression promoter OsSee2
Carrier, it is characterised in that the recombinant expression carrier is the multiple cloning sites insertion power in plant expression vector pCAMBIA1391
Profit requires the recombinant plasmid that the vegetable seeds specific expression promoter OsSee2 described in 1 is obtained, in the recombinant expression carrier,
The vegetable seeds specific expression promoter OsSee2 is connected to the upstream of gene order to be expressed in carrier.
Further, the gene to be expressed is the gene for having to rice paddy seed position specific function.
On the other hand, the present invention provides a kind of expression cassette, it is characterised in that the expression cassette includes above-mentioned vegetable seeds
Specific expression promoter OsSee2.
On the other hand, the present invention provides a kind of above-mentioned vegetable seeds specific expression promoter OsSee2 and is cultivating transgenosis
Application in plant, it is characterised in that the application includes：By above-mentioned vegetable seeds specific expression promoter OsSee2 connections
The gene order upstream to be expressed in carrier, so as to build recombinant expression carrier；The recombinant expression carrier is transformed into plant
Cultivated in thing cell, tissue or organ.
Preferably, the application is used for improving plant growth characteristic, and the plant is monocotyledon：It is rice, corn, small
Wheat, barley, jowar or oat.
On the other hand, the present invention provides a kind of above-mentioned vegetable seeds specific expression promoter OsSee2 and is cultivating high yield water
Application in rice, it is characterised in that the application includes above-mentioned vegetable seeds specific expression promoter OsSee2 being connected to
Connection product is passed through carrier by target gene upstream, the target gene to promote the fissional gene of rice paddy seed
It is transferred in plant cell, tissue or organ.
Preferably, the application is further included cultivates transgenic rice plant using the plant cell, tissue or organ.
SEQ ID No in sequence table:DNA sequence dna shown in 1 and 2 is from Nipponbare rice (Oryza sativa L
Cv.Nipponbare the rice paddy seed strongly expressed promoter for) expanding and extracting, referred to herein as OsSee2 or promoter
OsSee2.Specifically, inventors herein have recognized that Nipponbare rice (Oryza sativa L cv.Nipponbare) base
Because of the DNA sequence dna of 2044bp of the upstream including transcription initiation site, there is driving target gene rice paddy seed specificity table
The function of reaching, which can play its effect in rice seedling, therefore the present inventor separates and clones and identify
The function of the DNA sequence dna.
Preferably, the gene to be expressed is Gus genes, and the recombinant expression carrier is pCAMBIA1391-
OsSee2, the recombinant expression carrier are by SEQ ID No:Sequence, that is, OsSee2 or promoter OsSee2 shown in 1 are implemented in
The recombinant expression carrier obtained in pCAMBIA1391, referred to herein as pCAMBIA1391-OsSee2.Or gene to be expressed can
Think any rice paddy seed specific expression gene.
It should be noted that：In the DNA sequence dna of above-mentioned promoter, SEQ ID No：Sequence in 2 is to eliminate SEQ ID
No：Sequence after the 22bp and the 22bp of ending that start in 1, for obtained from the DNA sequence dna in Nipponbare rice.SEQ ID No：
The 22bp started in 1 is the retention sequence for obtaining the forward primer used during promoter；SEQ ID No：End up in 1
22bp is retention sequence (the retention sequence and the corresponding sequence of reverse primer for obtaining the reverse primer used during promoter
It is complementary).It is emphasized that promoter mentioned herein can both refer to above-mentioned whole DNA sequence dna, can also refer in removal
State primer and retain the DNA sequence dna after sequence.It should be noted that even if those skilled in the art on the basis of the present invention, adopt
Similar sequence is obtained with other primers, it is also fallen within protection scope of the present invention.
In conclusion the inventors found that, extract and identify Nipponbare rice Os See2 upstream region of gene and include
The DNA sequence dna of 2044bp including transcription initiation site, and it is named as promoter OsSee2.The sequence is connected after digestion
It is connected on plant binary expression vector pCAMBIA1391, obtains corresponding recombinant plasmid (i.e. recombinant expression carrier), it is heavy using this
Group plasmid conversion Agrobacterium tumefaciens strain EHA105, the conversion of rice is then carried out with agriculture bacillus mediated method, obtains turning base
Because of rice plant.
Promoter sequence of the present invention can be connected with plant binary expression vector, for substituting constitutive promoter.
Also, the promoter sequence can be connected with required target gene, recombinant plant expression vector is built, after inverted, can be driven
Dynamic target gene is specific expressed in rice paddy seed, so as to improve expression of the exogeneous target gene in specific plant tissues
Amount, increases the effect of transgenosis.
Technique effect
The rice starter OsSee2 that is cloned of the present invention can controlling gene in plant seed, it is strong especially in embryo
Expression, has significantly value in practical applications.Since seed is the edible part of rice, and embryo is the hereditary portion in seed
It is also part most nutritious in edible part to divide, and promoter of the invention can be with to seed, especially embryo, having and changing
The gene of good action is used cooperatively, there is provided and the product of rice, increases the nutritive value of EMBRYO IN RICE, such as, protein content etc., this
The popularization and application of research and rice varieties for rice paddy seed development molecular mechanism have important theory and realistic meaning.
Brief description of the drawings
Hereinafter, the embodiment that the present invention will be described in detail is carried out with reference to attached drawing, wherein：
Fig. 1 is that OsSee2 promoters are implemented in schematic diagram in pCAMBIA1391 vector plasmids, and A is in wherein Fig. 1
PCAMBIA1391 schematic diagrames, B is pCAMBIA1391-OsSee2 schematic diagrames in Fig. 1, illustrated therein is and utilizes OsSee2 promoters
The Gus gene expressions of driving downstream；
Fig. 2 is the result schematic diagram that digestion verification is carried out to promoter of the present invention；
Fig. 3 is maturation plant (90 days) OsSee2::Gus transfer-gen plant tissue staining figures.Wherein root (a), stem (b), leaf
(c), sheath (d) is not colored, and from the point of view of the longitudinal section (e) and cross section (f) of mature seed, represent reporter gene Gus activity
Blueness only come across in the embryo and albuminous cell of mature seed, the wherein intensity in blastocyte is apparently higher than albuminous cell.This
Show that OsSee2 promoters are only expressed in rice paddy seed, and expression intensity is higher than endosperm in embryo, is an embryo strongly expressed
Seed specific promoter (scale=2.5mm).
Embodiment
Illustrate the present invention referring to specific embodiment.It will be appreciated by those skilled in the art that these embodiments are only
For illustrating the present invention, it is not limited the scope of the invention in any way.
Experimental method in following embodiments, is conventional method unless otherwise specified.Medicine used in following embodiments
Material raw material, reagent material etc., unless otherwise specified, are commercially available products.
The acquisition of OsSee2 promoters containing restriction enzyme site
Step 1, the design of primer
According to rice varieties Nipponbare (the Oryza sativa L cv.Nipponbare) full-length genome provided in NCBI
Sequence, according to the sequence design amplimer of rice Os See2 genes, and according to the characteristics of the carrier and target gene of selection, if
Count the restriction enzyme site of primer.
CAMBIA (is come from, open to use carrier, peace with rice binary expression vector pCAMBIA1391 in this experimental example
Genetically modified organism product composition supervision and inspection center of the emblem Ministry of Agriculture of Shanxi Academy of Agricultural Sciences rice group preserves) exemplified by, target base
Because Gus genes, the primer specifically designed is：Forward primer (SEQ ID No:3) 5 ' end band HindIII, restriction enzyme site
(AAGCTT), reverse primer (SEQ ID No:4) 5 ' end band SalI, restriction enzyme site (GTCGAC), primer sequence is as follows：
Forward primer：AAGCTTCAATGGTTAGGGAAGGGTTATG HindIII
Reverse primer：GTCGACAGCTATACTTCGATGAGCTTTG SalI
Synthesized by Shenzhen Huada gene company.
The acquisition of step 2, promoter OsSee2
Using rice varieties Nipponbare DNA as template, promoter OsSee2 is expanded using forward primer, reverse primer, by normal
PCR system is advised, using following amplification program：
95 DEG C of pre-degeneration 5min；95 DEG C of denaturation 30s, 58 DEG C of annealing 30s, 72 DEG C of extension 2min30s, are circulated 35 times；Finally
72 DEG C of extension 10min.
The purpose fragment of PCR amplification is recycled, purpose fragment length 2044bp, is connected to (the purchase of PGEM-T-Easy carriers
From Promega companies, mixed in the ratio in carrier specification) on, convert Escherichia coli XL-Blue competence according to cold shock method
After cell, competent cell is activated, and then purpose fragment is transferred to the competent cell of activation, then, sieved through bacterium colony PCR
Choosing obtains positive colony, and picking monoclonal bacterium solution upgrading grain, carries out double digestion verification, as shown in Figure 2 with HindIII and SalI.
It will be sent by the positive colony of identification and Invitrogen companies are sequenced.Correctly clone is the promoter to be obtained for verification
OsSee2, its nucleotide sequence such as SEQ ID No:Shown in 1 and 2.
The structure of plant expression vector and the conversion of Agrobacterium
Extract plasmid in the positive colony obtained from above during " acquisition of promoter OsSee2 ", with HindIII and
SalI digestions, recycle promoter OsSee2 fragments.PCAMBIA1391 is carried out at linearisation using HindIII and Sal at the same time
Reason, recycling pCAMBIA1391, (TaKaRa public affairs are purchased from by above-mentioned OsSee2 fragments and pCAMBIA1391 fragments T4 ligases
Department) it is attached, the plant expression vector pCAMBIA1391-OsSee2 of promoter OsSee2 and Gus Gene Fusions are obtained, profit
Plant expression vector is transferred to Agrobacterium tumefaciems (Agrobacterium tumefaciens) EHA105 (Anhui Province with freeze-thaw method
Genetically modified organism product composition supervision and inspection center of the Ministry of Agriculture of Academy of Agricultural Sciences rice group preserves).
Expressed in rice using promoter OsSee2 driving Gus reporter genes
Step 1：Agriculture bacillus mediated rice transformation
After mature seed removes glume, seed 1min is soaked with 70% alcohol, outwells alcohol.Drip Tween20's with containing 1
50% sodium hypochlorite (stoste effective chlorine density is more than 4%) solution immersion seed 40min (150r/min).Outwell sodium hypochlorite,
It is sterile to wash 5 times to solution clarification, no sodium hypochlorite taste.Sterile water immersion seed is stayed overnight.With aleuron of the scalpel along seed
Layer peels embryo, and embryo is inoculated on calli induction media.Light culture divided callus and endosperm and plumule after 11 days at 30 DEG C
From being used for the conversion of Agrobacterium after in good condition, the vigorous primary callus of division that remove bud are carried out preculture 3~5 days.
Using it is above-mentioned " plant expression vector structure and Agrobacterium conversion " during be transferred to recombinant expression carrier
Agrobacterium tumefaciems carries out Agrobacterium-mediated genetic transformation, obtains OsSee2::Gus transgenic rice plants, the genetic transformation,
Transformant screening and transgenic plant regeneration etc. are with reference to Yongbo Duan (Yongbo Duan, Chenguang Zhai, et
al.An efficient and high-throughput protocol for Agrobacterium mediated
transformation based on phOsphomannOse isomerase pOsitive selection in
Japonica rice(Oryza sativa L.)[J].Plant Cell Report,2012.DOI10.1007/s00299-
The method of proposition such as 01201275-3.).
The histoorgan dyeing of step 2, transgenic paddy rice seedling
The histoorgan of the transgenic paddy rice of OsSee2 promoters, i.e. root, stem, blade, leaf sheath and mature seed will be converted
Gus dyeing is carried out respectively.By it is each tissue be dipped in respectively in Gus dyeing liquors, 37 DEG C, overnight 24 it is small when, 75% ethanol decolorization, by group
Chlorophyll in knitting is taken off.Then observed under disecting microscope and record the result of Gus dyeing.Coloration result as shown in figure 3,
In root, stem, blade, leaf sheath (a-d in figure, it is the black of itself rather than the blueness dyed to scheme root in a), do not detect substantially
To the expression of Gus genes, and in the seed of transgenic paddy rice maturation, the very strong blueness that naked eyes can be observed substantially is shown
(upper left corner in figure e), and expression intensities of the Gus in embryo is higher than endosperm.This shows that promoter of the invention can turn base
It is the seed-specific expression promoter of an embryo strongly expressed because instructing Gus protein expressions downstream in the seed of plant.
Specific description of embodiments of the present invention above is not intended to limit the present invention, and those skilled in the art can be according to this
Invention is variously modified or deforms, and without departing from the spirit of the present invention, should all belong to the models of appended claims of the present invention
Enclose.
Although the principle of the present invention is described in detail above in conjunction with the preferred embodiment of the present invention, this area skill
Art personnel are it should be understood that above-described embodiment is only the explanation to the exemplary implementation of the present invention, not to present invention bag
Restriction containing scope.Details in embodiment is simultaneously not meant to limit the scope of the invention, in the spirit without departing substantially from the present invention and
In the case of scope, any equivalent transformation based on technical solution of the present invention, simple replacement etc. obviously change, and all fall within
Within the scope of the present invention.
Claims (7)
1. the vegetable seeds specific expression promoter OsSee2 of an embryo strongly expressed, it is characterised in that the vegetable seeds is special
Promoter OsSee2 is expressed by SEQ ID NO:Nucleotide sequence shown in 1；Or SEQ ID NO:Nucleotide shown in 2
Sequence composition.
2. one group of primer pair for being used to expand the vegetable seeds specific expression promoter OsSee2 described in claim 1, its feature
It is, the primer pair includes the first primer and the second primer, the sequence such as SEQ ID NO of first primer:Shown in 3, institute
State the sequence such as SEQ ID NO of the second primer:Shown in 4.
3. a kind of recombinant expression carrier containing vegetable seeds specific expression promoter OsSee2 described in claim 1, its feature
It is, the recombinant expression carrier is described in the multiple cloning sites insertion claim 1 in plant expression vector pCAMBIA1391
The obtained recombinant plasmids of vegetable seeds specific expression promoter OsSee2, in the recombinant expression carrier, the plant species
Sub- specific expression promoter OsSee2 is connected to the upstream of gene order to be expressed in carrier.
4. recombinant expression carrier according to claim 3, it is characterised in that the gene to be expressed is to rice seed sub-portion
There is the gene of specific function in position.
5. a kind of expression cassette, it is characterised in that the vegetable seeds specifically expressing that the expression cassette includes described in claim 1 opens
Mover OsSee2.
6. a kind of vegetable seeds specific expression promoter OsSee2 according to described in claim 1 is in transgenic paddy rice is cultivated
Application, it is characterised in that the application includes：By according to the vegetable seeds specific expression promoter described in claim 1
OsSee2 is connected to gene order upstream to be expressed in carrier, so as to build recombinant expression carrier；The recombination expression is carried
Body is transformed into rice cell, tissue or organ and is cultivated.
7. a kind of vegetable seeds specific expression promoter OsSee2 according to described in claim 1 is in high-yield rice is cultivated
Using, it is characterised in that the application is included vegetable seeds specific expression promoter OsSee2 according to claim 1
Target gene upstream is connected to, and connection product is transferred in rice cell, tissue or organ by carrier.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201510493310.6A CN105018497B (en) | 2015-08-12 | 2015-08-12 | The vegetable seeds specific expression promoter OsSee2 of embryo strongly expressed |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201510493310.6A CN105018497B (en) | 2015-08-12 | 2015-08-12 | The vegetable seeds specific expression promoter OsSee2 of embryo strongly expressed |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN105018497A CN105018497A (en) | 2015-11-04 |
| CN105018497B true CN105018497B (en) | 2018-05-11 |
Family
ID=54408799
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201510493310.6A Expired - Fee Related CN105018497B (en) | 2015-08-12 | 2015-08-12 | The vegetable seeds specific expression promoter OsSee2 of embryo strongly expressed |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN105018497B (en) |
Family Cites Families (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US7550578B2 (en) * | 2001-09-26 | 2009-06-23 | Syngenta Participations Ag | Rice promoters for regulation of plant expression |
| CN105087581A (en) * | 2015-07-24 | 2015-11-25 | 中国科学院华南植物园 | Rice seed specific expression promoter and application thereof |
-
2015
- 2015-08-12 CN CN201510493310.6A patent/CN105018497B/en not_active Expired - Fee Related
Also Published As
| Publication number | Publication date |
|---|---|
| CN105018497A (en) | 2015-11-04 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN104946649B (en) | A kind of Rice Anther specific expression promoter OsAnth1 | |
| CN105695466B (en) | A kind of strong specific expression promoter OsPoll3 of paddy pollen and its application | |
| CN103740717B (en) | A kind of EMBRYO IN RICE specific expressing promoter and application thereof | |
| CN105063047B (en) | Vegetable seeds specific expression promoter OsSee1 | |
| CN103540592B (en) | A kind of rice endosperm specific expresses promotor and application thereof | |
| CN105838718B (en) | A kind of stems and leaves of rice strongly expressed promoter SAFES7 and its application | |
| CN105087589B (en) | A kind of promoter element OsEmb2 and the methods and applications that transgenic paddy rice is cultivated using it | |
| CN103740720B (en) | Identification and application of rice root specific strong promoter POsRo2 | |
| CN105861506B (en) | A kind of paddy endosperm does not express promoter SAFES2 and its separation method and application | |
| CN105018497B (en) | The vegetable seeds specific expression promoter OsSee2 of embryo strongly expressed | |
| CN104087588A (en) | Rice drought-induced promoter POsDro4 responding to environmental water stress | |
| CN103773766B (en) | A kind of rice root specific expressing promoter POsRo1 and application thereof | |
| CN104073491A (en) | High-temperature-induced expressed plant promoter Posheat2 and application thereof | |
| CN103740719A (en) | Separation and application of rice vascular bundle specific expression promoter POsvas 1 | |
| CN103088022A (en) | Plant-salt-induced expression promoter | |
| CN104845974B (en) | The DNA fragmentation POscold5 of long-term cold stress can be responded | |
| CN103031303B (en) | Identification and applications of plant pulvinus specific expression promoter ProCol1 | |
| CN105602956B (en) | A kind of paddy pollen strongly expressed promoter OsPoll4 and its application | |
| CN104845973B (en) | The strong evoked promoter POscold6 of paddy rice low clone and application | |
| CN104946652B (en) | Plant gynoecium specific expression promoter OsPis1 and its derivative | |
| CN105567695B (en) | A kind of rice non-endosperm expression promoter SAFES3 and its application | |
| CN103725680B (en) | Plant endosperm specificity expression promoter pENP3 and application thereof | |
| CN103740721B (en) | A kind of Plant coleoptile specific expression promoter and application thereof | |
| CN104946651B (en) | One kind has the specific DNA fragmentation of Rice Ovary | |
| CN105296484B (en) | The special strongly expressed promoter pENP4 of albumen and its application |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant | ||
| CF01 | Termination of patent right due to non-payment of annual fee | ||
| CF01 | Termination of patent right due to non-payment of annual fee |
Granted publication date: 20180511 Termination date: 20200812 |